Primer combination for identifying or quantifying purity of bulbus fritillariae cirrhosae, identifying or quantifying method based on primer combination, kit and application of primer combination

By designing specific primer combinations and combining PCR and high-throughput sequencing technology, the problem of insufficient identification and sensitivity of traditional Chinese medicinal materials identification methods in related species is solved, and the efficient, accurate purity identification and quantification of Fritillaria kebayashi is achieved, reducing detection costs and simplifying operations.

CN120099212APending Publication Date: 2025-06-06BEIJING CENT FOR PHYSICAL & CHEM ANALYSIS
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510328793.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-19
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

Traditional Chinese medicinal materials identification methods rely on professional experience, difficult to distinguish related species, complex pretreatment, low detection sensitivity and high cost. Especially for the rare medicinal material Fritillaria citrus, the effective ingredients are easily affected by the environment and harvest season, which increases the difficulty of identification.

Method used

Design a specific primer combination, combine PCR technology and high-throughput sequencing technology to construct a purity identification and quantitative method for Fritillaria citrus. Through two-step PCR amplification and high-throughput sequencing library construction, efficient and accurate identification of Fritillaria citrus was achieved.

Benefits of technology

It realizes the purity identification and quantification of Fritillaria kebayashi and its close species, reduces the detection cost, simplifies the operation process, and is suitable for the quality control of raw materials, decoctions and Chinese patent medicines of Fritillaria kebayashi.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0005319657980000071
    Figure BDA0005319657980000071
  • Figure BDA0005319657980000072
    Figure BDA0005319657980000072
  • Figure BDA0005319657980000081
    Figure BDA0005319657980000081
Patent Text Reader

Abstract

The invention provides a primer combination for identifying and / or quantifying the purity of bulbus fritillariae cirrhosae, an identifying or quantifying method based on the primer combination, a kit and application of the primer combination. The bulbus fritillariae cirrhosae purity identification and / or quantification method based on the primer combination can accurately distinguish genuine bulbus fritillariae cirrhosae from common adulterants (such as bulbus fritillariae ussuriensis and bulbus fritillariae thunbergii), so that the purity of the genuine bulbus fritillariae cirrhosae can be accurately identified and / or the content of the genuine bulbus fritillariae cirrhosae can be accurately quantified, and the method also has relatively high sensitivity and detection stability; besides, the method is easy and convenient to operate and wide in application range, the used raw materials are wide and easy to obtain, remarkable economic benefits and social benefits are achieved, reliable technical support is provided for quality control of the bulbus fritillariae cirrhosae, and wide application and popularization prospects are achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of identification of traditional Chinese medicine Fritillaria cirrhosa, and in particular to a primer combination for purity identification and / or quantification of Fritillaria cirrhosa, an identification or quantification method based thereon, a kit and applications thereof. Background Art

[0002] In the field of traditional Chinese medicine identification, methods such as morphological identification, microscopic structure observation and chemical composition analysis are mainly relied on. However, these methods have many limitations in practical applications: first, morphological identification is highly dependent on the professional experience of the identification personnel and is easily affected by the processing methods of the medicinal materials; second, although microscopic identification can provide identification characteristics at the cellular level, it is often difficult to accurately distinguish closely related species; third, chemical composition analysis methods such as high-performance liquid chromatography (HPLC), although they can provide quantitative information, have problems such as complex pre-treatment, low detection sensitivity and high cost. Especially for rare medicinal materials such as Fritillaria cirrhosa, their active ingredients are easily affected by factors such as the growth environment and harvesting season, which further increases the difficulty of traditional identification methods.

[0003] With the rapid development of molecular biology technology, especially the breakthrough progress of polymerase chain reaction (PCR) technology and high-throughput sequencing technology, new technical approaches have been provided for the accurate identification of Chinese medicinal materials. DNA molecular marker technology has become an important development direction for the identification of Chinese medicinal materials due to its advantages such as high stability, strong specificity, and no influence from growth environment and development stage. Among them, the PCR detection method based on specific primers has shown significant advantages in the authenticity identification and purity identification of Chinese medicinal materials due to its simple operation, high sensitivity, and good repeatability.

[0004] Fritillaria cirrhosa is a traditional precious Chinese medicinal material with the effects of clearing heat and moistening the lungs, resolving phlegm and relieving cough, and is widely used in clinical treatment. However, due to the wide variety of Fritillaria species and the existence of multiple closely related species, as well as the genetic diversity caused by different origins and different cultivation methods, the accurate identification of Fritillaria cirrhosa faces great challenges. Common confusion products on the market include Fritillaria ussuriensis and Fritillaria walujewii. These closely related species are very similar to Fritillaria cirrhosa in appearance and morphology, but there are significant differences in the active ingredients and content. In addition, with the continuous increase in the demand for Chinese medicinal materials in the market, some unscrupulous merchants often pass off inferior products as good ones and fake products as real ones in order to make huge profits, which seriously affects the clinical efficacy and medication safety of Fritillaria cirrhosa.

[0005] Therefore, developing a purity identification and quantification method of Fritillaria cirrhosa based on molecular biology technology can not only effectively solve the limitations of traditional identification methods, but also has important practical significance for ensuring the quality of Chinese medicinal materials, safeguarding consumer rights, and promoting the healthy development of the Chinese medicine industry. The present invention is based on this demand, and by designing a specific primer combination, a fast and accurate identification method of Fritillaria cirrhosa is established, providing reliable technical support for the quality control of Chinese medicinal materials. Summary of the invention

[0006] Purpose of the Invention

[0007] In view of the above problems or needs existing in the prior art, the object of the present invention is to provide a primer combination for purity identification and / or quantification of Fritillaria cirrhosa, an identification or quantification method based thereon, a kit and its application.

[0008] The primer combination for purity identification and / or quantification of Fritillaria cirrhosa provided by the present invention is suitable for purity identification and / or quantification of Fritillaria cirrhosa by PCR combined with high-throughput sequencing. The Fritillaria cirrhosa purity identification and / or quantification method based on the primer combination has high identification accuracy and sensitivity, and has important application value in the field of Fritillaria cirrhosa medicinal material identification.

[0009] Solution

[0010] In order to achieve the above object, the present invention provides the following technical solutions.

[0011] In a first aspect, the present invention provides a primer combination for purity identification and / or quantification of Fritillaria cirrhosa, the primer combination comprising:

[0012] a first primer pair; the first primer pair consists of a forward primer 1 and a reverse primer 1, the nucleotide sequence of the forward primer 1 is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the nucleotide sequence of the reverse primer 1 is shown in SEQ ID NO: 3 or SEQ ID NO: 4; and,

[0013] A second primer pair; the second primer pair consists of a forward primer II and a reverse primer II, the nucleotide sequence of the forward primer II includes an anchor sequence as shown in SEQ ID NO:5 and an amplification sequence as shown in SEQ ID NO:6, and the nucleotide sequence of the reverse primer II includes an anchor sequence as shown in SEQ ID NO:7 and an amplification sequence as shown in SEQ ID NO:8.

[0014] In the above primer combination, the sequences of SEQ ID NO: 1-4 involved in the first primer pair are as follows:

[0015] Reading from the 5'-3' direction, the sequences of SEQ ID NOs: 1-4 are as follows:

[0016] SEQ ID NO:1

[0017] ACACTCTTTCCCTACACGACGCTCTTCCGATCTGCACGCCTGCCTGGGCGTCA;

[0018] SEQ ID NO:2

[0019] ACACTCTTTCCCTACACGACGCTCTTCCGATCTAACCATCGAGTCTTTGAACG;

[0020] SEQ ID NO:3

[0021] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTGCGAGACGRCACGCCCTCCTC;

[0022] SEQ ID NO:4

[0023] GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCTAGACGRCACGCCCTCCTC;

[0024] The forward primer II and reverse primer II in the second primer pair are as follows:

[0025] Forward Primer II: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 5)-index-ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 6);

[0026] Reverse Primer II: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 7)-index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 8).

[0027] In the above primer combination, the first primer pair is designed based on the ITS1 region of Fritillaria cirrhosa.

[0028] The Fritillaria ITS region refers to the sequence of the internal transcribed spacer (ITS) of the ribosome. In the phylogenetic study of Fritillaria plants, the ITS region sequence is considered to be a potential excellent DNA barcode candidate sequence because of its large interspecies variation distance. The Fritillaria ITS region includes ITS1 and ITS2; ITS1 is the internal transcribed region 1 between the 18S rRNA gene and the 5.8S rRNA gene, while ITS2 is the internal transcribed region 2 between the 5.8S rRNA gene and the 28S rRNA gene; compared with ITS2, the ITS1 sequence is longer and produces more variations, and can be used for species identification. However, how to select the hypervariable region and how to design a primer pair with high PCR amplification efficiency and good specificity for the hypervariable region, and make it suitable for constructing a high-throughput sequencing library for high-throughput sequencing, are the difficulties and challenges of research in this field.

[0029] In order to solve the above difficulties and challenges, the inventors of the present invention analyzed the genomes of authentic Fritillaria cirrhosae from six plant sources (including Fritillaria cirrhosae, Fritillaria unibracteata, Fritillaria przezvalskii, Fritillaria delavayi, Fritillaria taipaiensis, Fritillaria unibracteata var. wabuensis), as well as common adulterated varieties, including Fritillaria ussuriensis, Fritillaria thunbergii, Fritillaria hupehensis, Fritillaria walujewii, Fritillaria pallidiflora, and Fritillaria puqiensis), analyzed the conservation of the genomic regions of Fritillaria, and designed primers based on highly conserved regions to amplify hypervariable regions. Based on this, the above-mentioned first primer pair was designed.

[0030] In a preferred embodiment, the nucleotide sequence of forward primer I in the first primer pair is shown as SEQ ID NO:1, and the nucleotide sequence of reverse primer I is shown as SEQ ID NO:3.

[0031] In the present invention, a first primer pair is used to perform a first round of PCR amplification on the genomic DNA of the Fritillaria cirrhosa sample; and a second primer pair is used to perform a second round of PCR amplification using the first round of PCR amplification product as a template to construct a sequencing library. To construct a sequencing library, anchor sequences for sequencing are added to both sides of the primers of the second primer pair, for example, the sequence AATGATACGGCGACCACCGAGATCTACAC as shown in SEQ ID NO:5, and the sequence CAAGCAGAAGACGGCATACGAGAT as shown in SEQ ID NO:7.

[0032] In a second aspect, the present invention provides a kit for purity identification and / or quantification of Fritillaria cirrhosa, the kit comprising the primer combination as described in the first aspect above.

[0033] In a specific embodiment, the kit further comprises a reagent selected from the group consisting of:

[0034] (I) a reagent for extracting genomic DNA from Fritillaria cirrhosae,

[0035] (II) reagents for PCR amplification, and

[0036] (III) Reagents for high-throughput sequencing.

[0037] The above reagents can all be corresponding reagents commonly used in the art.

[0038] In a third aspect, the present invention provides a method for purity identification and / or quantification of Fritillaria cirrhosae using PCR combined with high-throughput sequencing technology, the method comprising:

[0039] (1) Extracting genomic DNA from Fritillaria cirrhosa samples;

[0040] (2) using the genomic DNA extracted in step (1) as a template, and using the first primer pair in the primer combination of claim 1 or 2 to perform PCR amplification;

[0041] (3) using the PCR amplification product obtained in step (2) as a template, and using the second primer pair in the primer combination of claim 1 or 2 to perform PCR amplification to construct a sequencing library;

[0042] (4) performing high-throughput sequencing on the sequencing library constructed in step (3); and

[0043] (5) Performing data processing and analysis on the sequencing results obtained in step (4).

[0044] In a feasible preferred embodiment, for the PCR amplification in step (2):

[0045] Based on a 50 μl reaction system, the PCR reaction system includes: 2 μl of genomic DNA, 11 μl of 10 μmol / L forward primer, 11 μl of 10 μmol / L reverse primer, 25 μl of DNA polymerase premix, and nuclease-free water to make up to 50 μl; preferably, the DNA polymerase is a high-fidelity polymerase with 3'-5' exonuclease activity, preferably selected from: pfu DNA polymerase, KOD DNA polymerase, mutant polymerases modified based on these polymerases, and fusion polymerases;

[0046] And / or, the PCR reaction program is: pre-denaturation at 94°C for 2 minutes; amplification for 15 cycles, each cycle comprising the following steps: denaturation at 94°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 30 seconds; extension at 72°C for 1 minute;

[0047] Preferably, the PCR further includes a step of purifying the PCR product after the PCR; further preferably, the purification uses purification magnetic beads, preferably carboxyl purification magnetic beads.

[0048] In a feasible preferred embodiment, for the PCR amplification in step (3):

[0049] Based on a 50 μl reaction system, the PCR reaction system comprises: 2 μl of the PCR amplification product obtained in step (2), 1 μl of 10 μmol / L forward primer II, 1 μl of 10 μmol / L reverse primer II, 25 μl of DNA polymerase premix, and nuclease-free water to make up to 50 μl; preferably, the DNA polymerase is a high-fidelity polymerase with 3'-5' exonuclease activity, preferably selected from: pfu DNA polymerase, KOD DNA polymerase, mutant polymerases modified based on these polymerases, and fusion polymerases;

[0050] And / or, the PCR reaction program is: pre-denaturation at 94°C for 1 min; amplification for 9 cycles, each cycle comprising the following steps: denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s;

[0051] Preferably, the PCR further includes a step of purifying the PCR product after the PCR; further preferably, the purification uses purification magnetic beads, preferably carboxyl purification magnetic beads.

[0052] In a feasible embodiment, the high-throughput sequencing is performed using a platform selected from the following: Illumina, MGI, GenoCare or GenoLab of Zhenmai Biotechnology, Salus Pro, Salus EVO or Saluseq Nimbo of Salus Medical, SURFseq of Saina Biotechnology, preferably using the Illumina platform.

[0053] In a feasible embodiment, the data processing and analysis includes:

[0054] 1) Filtering the raw sequencing data; preferably, the filtering includes: removing adapters, primers and / or low-quality data in the sequencing data;

[0055] 2) performing sequence retrieval on the filtered sequencing data, and classifying each piece of data according to the retrieved sequence information into sequences belonging to Fritillaria cirrhosa and sequences belonging to fake products;

[0056] 3) Count the proportions of authentic and counterfeit Fritillaria cirrhosa sequences in the samples respectively, so as to determine the purity and / or content of Fritillaria cirrhosa.

[0057] In a fourth aspect, the present invention provides use of the primer combination described in the first aspect above in preparing a product for purity identification and / or quantification of Fritillaria cirrhosa.

[0058] Beneficial Effects

[0059] The present invention successfully obtains a set of primer combinations that can efficiently and specifically identify the purity of authentic Fritillaria cirrhosa and / or quantify its content through scientific and rigorous primer design and systematic screening; the primer combination has the following significant advantages: first, it has strong specificity and can accurately distinguish Fritillaria cirrhosa from its common confusion products (such as Fritillaria thunbergii, Fritillaria thunbergii, etc.), effectively solving the technical bottleneck of traditional identification methods in identifying closely related species; second, it has high sensitivity and can detect trace amounts of Fritillaria cirrhosa components in samples.

[0060] Furthermore, the present invention combines the above primer combination with PCR technology and high-throughput sequencing technology to establish a complete set of purity identification and quantitative detection methods for Fritillaria cirrhosa. This method can efficiently and accurately identify the purity of authentic Fritillaria cirrhosa and / or quantify its content. The advantages are as follows:

[0061] (1) High accuracy, with a consistency of more than 98% compared with standard samples; (2) Good stability, maintaining stable detection performance in different batches and under different experimental conditions; (3) Simple operation, no complicated sample pretreatment process is required, and ordinary laboratory personnel can complete the detection after simple training; (4) Wide range of applications, and can be applied to the quality control of Fritillaria cirrhosa raw materials, decoction pieces and Chinese patent medicines.

[0062] In addition, the Fritillaria cirrhosa identification and / or quantification kit developed based on the primer combination has widely available raw materials, which solves the problem of high detection costs and has significant economic and social benefits.

[0063] The implementation of the present invention will effectively solve the problems of high detection cost, complicated operation, and insufficient accuracy in the prior art, and provide a reliable technical guarantee for the quality control of Fritillaria cirrhosa. The promotion and application of this technology will significantly improve the quality detection level of Chinese medicinal materials, and has important practical significance for promoting the modernization and standardization of Chinese medicine and promoting the high-quality development of the Chinese medicine industry. At the same time, the technical solution of the present invention can also provide a useful reference for the identification of other rare Chinese medicinal materials, and has a broad prospect for promotion and application. DETAILED DESCRIPTION

[0064] Unless explicitly stated otherwise, throughout the specification and claims, the term “comprise” or variations such as “include” or “comprising”, etc., will be understood to include the stated elements or components but not to exclude other elements or components.

[0065] The practice of the present invention will employ, unless otherwise indicated, conventional techniques of molecular biology (including recombinant techniques), microbiology, cell biology, biochemistry and immunology, which are within the skill of the art.

[0066] In order to make the present invention more easily understood, some technical terms are specifically defined as follows. Unless otherwise clearly defined in other parts of this document, the technical terms used herein have the meanings commonly understood by ordinary technicians in the field to which the present invention belongs.

[0067] The term "and / or" should be understood to mean any one of the optional items or a combination of any two or more of the optional items.

[0068] As used herein, the term "or" should be understood to have the same meaning as "and / or" as defined above. For example, when separating items in a list, "or" or "and / or" should be interpreted as inclusive, that is, including at least one of the number or elements in the list, but also including more than one, and optionally, additional unlisted items.

[0069] The following is a further detailed description of the claims of the present invention in conjunction with specific implementation methods, but does not constitute any limitation to the present invention. Any limited modifications made within the scope of protection of the claims of the present invention are still within the scope of protection of the claims of the present invention.

[0070] The present invention aims to provide a primer combination for purity identification and / or quantification of Fritillaria cirrhosa, a purity identification and / or quantification method of Fritillaria cirrhosa based on the primer combination, a kit and its application, so as to solve the deficiencies in the prior art. The technical solution of the present invention improves the identification sensitivity and accuracy of Fritillaria cirrhosa medicinal materials by molecular biological means, thereby ensuring the quality and safety of medicinal materials, which is of great significance to the modernization and standardization of traditional Chinese medicine.

[0071] Specifically, a primer combination for purity identification and / or quantification of Fritillaria cirrhosa, the primer combination comprising:

[0072] a first primer pair; the first primer pair consists of a forward primer 1 and a reverse primer 1, the nucleotide sequence of the forward primer 1 is shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the nucleotide sequence of the reverse primer 1 is shown in SEQ ID NO: 3 or SEQ ID NO: 4; and,

[0073] A second primer pair; the second primer pair consists of a forward primer II and a reverse primer II, the nucleotide sequence of the forward primer II includes an anchor sequence as shown in SEQ ID NO:5 and an amplification sequence as shown in SEQ ID NO:6, and the nucleotide sequence of the reverse primer II includes an anchor sequence as shown in SEQ ID NO:7 and an amplification sequence as shown in SEQ ID NO:8.

[0074] In the above primer combination, the first primer pair is designed based on the ITS1 region of Fritillaria cirrhosa and is used to amplify the corresponding region of the Fritillaria cirrhosa genome; the second primer pair is used to amplify the amplification product of the above first primer pair to construct a high-throughput sequencing library, and therefore, both ends of the primers have anchor sequences for sequencing.

[0075] In the first primer pair, any forward primer I can be used in combination with any reverse primer I. In a preferred embodiment, the forward primer I shown in SEQ ID NO: 1 and the reverse primer I shown in SEQ ID NO: 3 can be used in combination.

[0076] In a preferred embodiment, the forward primer II and the reverse primer II in the second primer pair are respectively as follows:

[0077] Forward Primer II: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 5)-index-ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 6);

[0078] Reverse Primer II: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 7)-index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 8).

[0079] In addition, the present invention also provides a method for purity identification and quantification of Fritillaria cirrhosae by PCR combined with high-throughput sequencing, which comprises the following steps in sequence:

[0080] 1) Extraction of sample DNA;

[0081] In a feasible implementation scheme, a plant genomic DNA extraction kit is used to extract genomic DNA from Fritillaria cirrhosae as a DNA template for the test sample. The genomic DNA extraction kit is not particularly limited, and a DNA extraction kit familiar to those skilled in the art can be used. In the embodiment of the present invention, the kit is sourced from Promega, Catalog No. A1120.

[0082] The extracted genomic DNA was diluted to 100 ng / μL with nuclease-free water or Low-TE and used as a template for the subsequent PCR amplification.

[0083] 2) PCR amplification and high-throughput sequencing library construction;

[0084] PCR amplification and high-throughput sequencing library construction were performed using a two-step PCR amplification method.

[0085] The first step of PCR: using the first primer pair;

[0086] a) Operate on ice and prepare the PCR reaction system according to the following table:

[0087]

[0088] As a feasible implementation scheme, in the above table, forward primer I is shown as SEQ ID NO: 1, and reverse primer I is shown as SEQ ID NO: 3; DNA polymerase uses a high-fidelity DNA polymerase with 3'-5' exonuclease activity, including but not limited to pfu DNA polymerase, KOD DNA polymerase, and mutant polymerases modified with these polymerases, fusion polymerases, etc. In the embodiment of the present invention, the DNA polymerase used is KAPA HiFi HotStart ReadyMix (2x), Catalog No. KK2601.

[0089] b) Run the PCR program and set the PCR instrument parameters as follows:

[0090]

[0091] After the PCR program is completed, the next step is to purify the PCR product.

[0092] A DNA purification kit known to those skilled in the art can be used. Specifically, purification magnetic beads can be used to purify PCR products, preferably carboxyl magnetic beads. In the embodiment of the present invention, the DNA purification magnetic bead kit is Beckman Agencourt AMPure XP magnetic bead purification library kit, Catalog No. A63880.

[0093] The specific purification steps are as follows:

[0094] Use 0.9× volume of purification magnetic beads for purification experiments. Specifically, configure the purification system according to the following table:

[0095]

[0096] The specific purification steps are as follows: vortex the above purification system to mix, incubate at room temperature for 5-15 minutes, place the PCR tube on the magnetic rack for 3 minutes to clarify the solution; remove the supernatant, continue to place the PCR tube on the magnetic rack, add 200μl 80% ethanol solution to the PCR tube, and let it stand for 30s; remove the supernatant, add 200μl 80% ethanol solution to the PCR tube, let it stand for 30s, and then completely remove the supernatant; let it stand at room temperature for 3-5min to allow the residual ethanol to evaporate completely; add 20μl of nuclease-free water, remove the PCR tube from the magnetic rack, gently pipette to resuspend the magnetic beads to avoid bubbles, and let it stand at room temperature for 2min; place the PCR tube on the magnetic rack for 2min to clarify the solution; use a pipette to aspirate 20μl of supernatant, transfer it to a new PCR tube (placed on an ice box), mark the sample number on the reaction tube, and prepare for the next reaction.

[0097] Second step PCR: carried out using the second primer pair;

[0098] A) Set up the following reaction system on ice:

[0099]

[0100] As a feasible implementation scheme, in the above table, forward primer II is: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 5)-index-ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 6); reverse primer II is: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 7)-index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 8); and the DNA polymerase uses a high-fidelity DNA polymerase with 3'-5' exonuclease activity, including but not limited to pfu DNA polymerase, KOD DNA polymerase, and mutant polymerases modified with these polymerases, fusion polymerases, etc. In the embodiment of the present invention, the DNA polymerase used is KAPA HiFi HotStart Ready Mix (2x), Catalog No. KK2601.

[0101] B) Run the PCR program and set the PCR instrument parameters as follows:

[0102]

[0103] After the PCR program is completed, the next step is to purify the PCR product using the same method as above.

[0104] The specific purification steps are as follows:

[0105] Use 0.9× volume of purification magnetic beads for purification experiments and configure the reaction system according to the following table:

[0106]

[0107] The specific purification steps are as follows: vortex the above purification system to mix, incubate at room temperature for 5-15 minutes, place the PCR tube on the magnetic rack for 3 minutes to clarify the solution; remove the supernatant, continue to place the PCR tube on the magnetic rack, add 200μl 80% ethanol solution to the PCR tube, and let it stand for 30s; remove the supernatant, add 200μl 80% ethanol solution to the PCR tube, let it stand for 30s, and then completely remove the supernatant; let it stand at room temperature for 3-5min to allow the residual ethanol to evaporate completely; add 20μl of nuclease-free water, remove the PCR tube from the magnetic rack, gently pipette to resuspend the magnetic beads to avoid bubbles, and let it stand at room temperature for 2min; place the PCR tube on the magnetic rack for 2min to clarify the solution; use a pipette to aspirate 20μl of supernatant, transfer it to a new PCR tube (placed on an ice box), mark the sample number on the reaction tube, and prepare for the next reaction.

[0108] 3) High-throughput sequencing;

[0109] After obtaining the purified library, the purified library is subjected to high-throughput sequencing; the high-throughput sequencing can adopt the following sequencing platforms: Illumina, MGI, GenoCare or GenoLab of Zhenmai Biotechnology, Salus Pro, SalusEVO or Saluseq Nimbo of Salus Medical, SURFseq of Saina Biotechnology, preferably the Illumina platform.

[0110] 4) Data processing and analysis.

[0111] After obtaining the sequencing results, the sequencing data is subjected to a bioinformatics analysis process and the results are output. The analysis process includes the following steps:

[0112] i) filtering the raw sequencing data; optionally, the filtering includes: removing adapters, primers and low-quality data in the sequencing data;

[0113] ii) performing sequence retrieval on the filtered sequencing data, and classifying each piece of data according to the retrieved sequence information into sequences belonging to Fritillaria cirrhosa and sequences belonging to fake products;

[0114] iii) Counting the proportions of authentic and counterfeit sequences of Fritillaria cirrhosa in the samples respectively, so as to determine the purity and / or content of Fritillaria cirrhosa.

[0115] The technical solutions in the embodiments of the present invention are described clearly and completely below. The described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those skilled in the art without creative work are within the scope of protection of the present invention.

[0116] Unless otherwise specified, the materials, reagents, etc. used in the following examples can be obtained from commercial sources; unless otherwise specified, the examples are based on conventional experimental conditions or the conditions recommended in the manufacturer's instructions.

[0117] Example 1: Identification of genuine and counterfeit Fritillaria cirrhosa

[0118] In this example, commercially available samples of Fritillaria cirrhosa (Fritillaria pine, Fritillaria cirrhosa and Fritillaria thunbergii) and counterfeit Fritillaria thunbergii (Fritillaria pingensis, Fritillaria xinjiang, Fritillaria yili and Fritillaria hupehensis) were purchased, the corresponding samples were identified by morphology, and then they were ground into powder, DNA was extracted and identified.

[0119] 1) DNA extraction from Fritillaria samples:

[0120] Commercially available samples of Fritillaria cirrhosa and Fritillaria dahurica that have been correctly identified through morphology were ground into powder separately, and about 50 mg of each sample was weighed and weighed in parallel three times; genomic DNA was extracted from the Fritillaria cirrhosa and Fritillaria dahurica powders respectively according to the instructions of the plant genomic DNA extraction kit (Promega, Catalog No.A1120); finally, the extracted Fritillaria cirrhosa or Fritillaria dahurica genomic DNA was diluted to 100 ng / μL with nuclease-free water as a template for the subsequent PCR amplification.

[0121] 2) PCR amplification and high-throughput sequencing library construction:

[0122] PCR amplification and high-throughput sequencing library construction were performed using a two-step PCR amplification method.

[0123] The first step of PCR was performed using the following primer pair: FCB-ITS-F1 (shown in SEQ ID NO: 1), FCB-ITS-R1 (shown in SEQ ID NO: 3).

[0124] a) Operate on ice and prepare the PCR reaction system according to the table below:

[0125]

[0126] The DNA polymerase premix solution used was KAPA HiFi HotStart ReadyMix (2x), Catalog No. KK2601.

[0127] b) Run the PCR program and set the PCR instrument parameters as follows:

[0128]

[0129] After the PCR program is completed, the next step is to purify the PCR product.

[0130] The DNA purification magnetic bead kit used was Beckman Agencourt AMPure XP magnetic bead library purification kit (Catalog No. A63880), and the first round of PCR product purification was performed according to its instructions. The specific purification steps are as follows:

[0131] Use 0.9× volume of purification magnetic beads for purification experiments. Specifically, configure the reaction system according to the following table:

[0132]

[0133] The specific purification steps are as follows:

[0134] Vortex the above purification system to mix evenly, incubate at room temperature for 10 minutes, place the PCR tube on the magnetic rack for 3 minutes to clarify the solution; remove the supernatant, continue to place the PCR tube on the magnetic rack, add 200μl 80% ethanol solution to the PCR tube, and let it stand for 30s; remove the supernatant, add 200μl 80% ethanol solution to the PCR tube again, let it stand for 30s and then completely remove the supernatant; let it stand at room temperature for 3-5min to allow the residual ethanol to evaporate completely; add 20μl of nuclease-free water, remove the PCR tube from the magnetic rack, gently pipette to resuspend the magnetic beads to avoid bubbles, and let it stand at room temperature for 2min; place the PCR tube on the magnetic rack for 2min to clarify the solution; use a pipette to aspirate 20μl of supernatant, transfer it to a new PCR tube (placed on an ice box), mark the sample number on the reaction tube, and prepare for the next reaction.

[0135] Step 2 PCR: Use the following primer pairs:

[0136] Forward Primer II: AATGATACGGCGACCACCGAGATCTACAC (SEQ ID NO: 5)-index-ACACTCTTTCCCTACACGACGCTCTTCCGATCT (SEQ ID NO: 6);

[0137] Reverse Primer II: CAAGCAGAAGACGGCATACGAGAT (SEQ ID NO: 7)-index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT (SEQ ID NO: 8).

[0138] A) Set up the following reaction system on ice:

[0139]

[0140] The DNA polymerase was KAPA HiFi HotStart ReadyMix (2x), Catalog No. KK2601.

[0141] B) Run the PCR program and set the PCR instrument parameters as follows:

[0142]

[0143] After the PCR program is completed, the next step is to purify the PCR product using the same method as above. The specific purification steps are as follows: Use 0.9× volume of purification magnetic beads for purification experiments and configure the reaction system according to the following table:

[0144]

[0145] The specific purification steps are as follows: vortex the above purification system to mix, incubate at room temperature for 10 minutes, place the PCR tube on the magnetic rack for 3 minutes to clarify the solution; remove the supernatant, continue to place the PCR tube on the magnetic rack, add 200μl 80% ethanol solution to the PCR tube, and let it stand for 30s; remove the supernatant, add 200μl 80% ethanol solution to the PCR tube, let it stand for 30s, and then completely remove the supernatant; let it stand at room temperature for 3-5min to allow the residual ethanol to evaporate completely; add 20μl of nuclease-free water, remove the PCR tube from the magnetic rack, gently pipette to resuspend the magnetic beads to avoid bubbles, and let it stand at room temperature for 2min; place the PCR tube on the magnetic rack for 2min to clarify the solution; use a pipette to aspirate 20μl of supernatant, transfer it to a new PCR tube (placed on an ice box), mark the sample number on the reaction tube, and prepare for the next reaction.

[0146] 3) High-throughput sequencing: After obtaining the purified library, the purified library is subjected to high-throughput sequencing, and the sequencing platform adopts Illumina PE 150.

[0147] 4) Data processing and analysis: After obtaining the sequencing results, the sequencing data is subjected to a bioinformatics analysis process and the results are output; the analysis process includes the following steps:

[0148] i) filtering the raw sequencing data; optionally, the filtering includes: removing adapters, primers and low-quality data in the sequencing data;

[0149] ii) performing sequence retrieval on the filtered sequencing data, and classifying each piece of data according to the retrieved sequence information into sequences belonging to Fritillaria cirrhosa and sequences belonging to fake products;

[0150] iii) Counting the proportions of authentic and counterfeit sequences of Fritillaria cirrhosa in the samples respectively, so as to determine the purity and / or content of Fritillaria cirrhosa.

[0151] The experimental results are shown in Table 1 below.

[0152] Table 1. Purity and / or content test results of Fritillaria cirrhosa

[0153]

[0154] The above results show that the consistency between the detection value obtained by using the primer combination and method of the present invention and the theoretical value is 100%.

[0155] Example 2: Purity Identification of Fritillaria cirrhosae Mixed with Different Ratios of Counterfeit Fritillaria cirrhosae

[0156] As we all know, the Chinese Pharmacopoeia requires that the impurities (including adulterants) in traditional Chinese medicines and herbal pieces should not exceed 3%.

[0157] In this embodiment, the authentic and counterfeit Fritillaria cirrhosa are mixed at a set ratio, and then the adulteration ratio is identified by the method of the present invention.

[0158] Specifically, the genuine Fritillaria cirrhosa and the counterfeit Fritillaria xinjiang were ground into powder respectively, 60 mg of Fritillaria xinjiang was accurately weighed and added to 1940 mg of Fritillaria cirrhosa, and after mixing, 50 mg was taken for sample DNA extraction, and the weighing was repeated three times to obtain a sample with an adulteration ratio of 3%; the same weighing method was used to obtain samples with adulteration ratios of 10% and 20%. Then, the sequencing library was constructed, high-throughput sequencing, and data processing and analysis were performed according to the method described in Example 1.

[0159] The experimental results are shown in Table 2 below.

[0160] Table 2. Adulteration ratio and purity identification results of Fritillaria cirrhosa

[0161]

[0162] The above results show that the consistency between the detection value obtained by using the primer combination and method of the present invention and its theoretical value is 100%.

[0163] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or make equivalent replacements for some of the technical features therein. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer combination for purity identification and / or quantification of Fritillaria cirrhosa, characterized in that: The primer combination comprises: A first primer pair; the first primer pair consists of a forward primer 1 and a reverse primer 1, wherein the nucleotide sequence of the forward primer 1 is as shown in SEQ ID NO: 1 or SEQ ID NO: 2, and the nucleotide sequence of the reverse primer 1 is as shown in SEQ ID NO: 3 or SEQ ID NO: 4; and, A second primer pair; the second primer pair consists of a forward primer II and a reverse primer II, wherein the nucleotide sequence of the forward primer II includes an anchor sequence as shown in SEQ ID NO:5 and an amplification sequence as shown in SEQ ID NO:6, and the nucleotide sequence of the reverse primer II includes an anchor sequence as shown in SEQ ID NO:7 and an amplification sequence as shown in SEQ ID NO:

8.

2. The primer combination according to claim 1, characterized in that The nucleotide sequence of the forward primer 1 is shown in SEQ ID NO: 1, and the nucleotide sequence of the reverse primer 1 is shown in SEQ ID NO: 3; And / or, the sequence of the forward primer II is as follows: AATGATACGGCGACCACCGAGATCTACAC(SEQ ID NO:5)-index-ACACTCTTTCCCTACACGACGCTCTCTCCGATCT(SEQ ID NO:6); The sequence of the reverse primer II is as follows: CAAGCAGAAGACGGCATACGAGAT(SEQ ID NO:7)-index-GTGACTGGAGTTCAGACGTGTGCTCTTCCGATCT(SEQ ID NO:8).

3. A kit for purity identification and / or quantification of Fritillaria cirrhosa, characterized in that: The kit comprises the primer combination as claimed in claim 1 or 2.

4. The kit according to claim 3, characterized in that The kit further comprises a reagent selected from the group consisting of: (I) a reagent for extracting genomic DNA from Fritillaria cirrhosae, (II) reagents for PCR amplification, and (III) Reagents for high-throughput sequencing.

5. A method for purity identification and / or quantification of Fritillaria cirrhosae using PCR combined with high-throughput sequencing technology, characterized in that: The method comprises: (1) Extracting genomic DNA from Fritillaria cirrhosa samples; (2) using the genomic DNA extracted in step (1) as a template, and using the first primer pair in the primer combination of claim 1 or 2 to perform PCR amplification; (3) using the PCR amplification product obtained in step (2) as a template, and using the second primer pair in the primer combination of claim 1 or 2 to perform PCR amplification to construct a sequencing library; (4) performing high-throughput sequencing on the sequencing library constructed in step (3); and (5) Performing data processing and analysis on the sequencing results obtained in step (4).

6. The method according to claim 5, characterized in that For the PCR amplification in step (2), based on a 50 μl reaction system, the PCR reaction system includes: 2 μl of genomic DNA, 11 μl of 10 μmol / L forward primer, 11 μl of 10 μmol / L reverse primer, 25 μl of DNA polymerase premix, and nuclease-free water to make up to 50 μl; preferably, the DNA polymerase is a high-fidelity polymerase with 3'-5' exonuclease activity, preferably selected from: pfu DNA polymerase, KOD DNA polymerase, mutant polymerases modified based on these polymerases, and fusion polymerases; And / or, the PCR reaction program is: pre-denaturation at 94°C for 2 min; amplification for 15 cycles, each cycle comprising the following steps: denaturation at 94°C for 30 s, annealing at 60°C for 30 s, extension at 72°C for 30 s; extension at 72°C for 1 min; Preferably, the PCR further includes a step of purifying the PCR product after the PCR; further preferably, the purification uses purification magnetic beads, preferably carboxyl purification magnetic beads.

7. The method according to claim 5 or 6, characterized in that: For the PCR amplification in step (3), based on a 50 μl reaction system, the PCR reaction system includes: 2 μl of the PCR amplification product obtained in step (2), 1 μl of 10 μmol / L forward primer II, 1 μl of 10 μmol / L reverse primer II, 25 μl of DNA polymerase premix, and nuclease-free water to make up to 50 μl; preferably, the DNA polymerase is a high-fidelity polymerase with 3'-5' exonuclease activity, preferably selected from: pfu DNA polymerase, KOD DNA polymerase, mutant polymerases modified based on these polymerases, and fusion polymerases; And / or, the PCR reaction program is: pre-denaturation at 94°C for 1 min; amplification for 9 cycles, each cycle comprising the following steps: denaturation at 94°C for 30 s, annealing at 58°C for 30 s, and extension at 72°C for 30 s; Preferably, the PCR further includes a step of purifying the PCR product after the PCR; further preferably, the purification uses purification magnetic beads, preferably carboxyl purification magnetic beads.

8. The method according to any one of claims 5 to 7, characterized in that: The high-throughput sequencing is performed using a platform selected from the following: Illumina, MGI, GenoCare, GenoLab, Salus Pro, Salus EVO, SaluseqNimbo, SURFseq, preferably the Illumina platform.

9. The method according to any one of claims 5 to 8, characterized in that: The data processing and analysis include: 1) Filtering the raw sequencing data; preferably, the filtering includes: removing adapters, primers and / or low-quality data in the sequencing data; 2) performing sequence retrieval on the filtered sequencing data, and classifying each piece of data according to the retrieved sequence information into sequences belonging to Fritillaria cirrhosa and sequences belonging to fake products; 3) Count the proportions of authentic and counterfeit Fritillaria cirrhosa sequences in the samples respectively, so as to determine the purity and / or content of Fritillaria cirrhosa.

10. Use of the primer combination according to claim 1 or 2 in preparing a product for purity identification and / or quantification of Fritillaria cirrhosa.