Primer group for detecting SNP (Single Nucleotide Polymorphism) sites related to tomato fruit sugar degree and application of primer group

Abstract

The invention provides a primer group for detecting SNP (Single Nucleotide Polymorphism) sites related to the sugar degree of tomato fruits and application of the primer group, and belongs to the technical field of molecular biology. The SNP site disclosed by the invention is at the 55876054 base position of the 11th chromosome of the SL3.0 version tomato genome, and the sequence is shown as SEQ ID NO.1. The primer group (SEQ ID NO.2-4) provided by the invention is used for detecting the base of the site through a KASP technology, so that the sugar degree of the tomato can be quickly and accurately detected, and the genetic breeding efficiency is greatly improved.

Description

Technical Field

[0001] The invention belongs to the field of molecular biology, and in particular relates to a primer set for detecting a SNP site related to the sugar content of a tomato fruit and an application thereof. Background Art

[0002] The flavor substances in tomatoes mainly include sugars, organic acids and volatile aromatic substances in the fruit. Studies have shown that within a certain threshold range, the higher the content of total sugar and titratable acid in tomatoes, the higher the overall flavor intensity. Fructose and glucose are the most abundant flavor sugar substances in tomatoes. Some tomato varieties contain more sucrose. In addition, tomatoes also contain a small amount of mannose, melibiose, etc.

[0003] The ratio of different types of sugars in tomato fruit will affect the sweetness of tomatoes. Tomatoes with relatively high fructose content taste sweeter. The sugar substances in tomatoes are regulated by multiple biochemical pathways, including glycolysis, gluconeogenesis, fructose and mannose metabolism, starch and sucrose metabolism. Their production originates from plant photosynthesis. During the growth and development of tomato fruits, they are metabolized in the form of sucrose through the catalytic reactions of various enzymes, which contribute to the sweetness of tomatoes. In addition to being an important sweet substance in tomatoes, the sugar substances in tomatoes also have an important influence on the flavor of tomatoes as precursors of volatile flavor substances. Under the catalysis of sucrose invertase, sucrose in tomatoes is hydrolyzed into fructose and glucose. Further, fructose is irreversibly converted into fructose-6-phosphate under the catalysis of fructokinase, which can enter the shikimic acid pathway through a series of catalytic metabolism and finally converted into phenylalanine; fructose-6-phosphate can also generate branched-chain amino acids, phosphoenolpyruvate and other substances through the glycolysis pathway, and phosphoenolpyruvate can be further converted into flavor precursors such as linolenic acid, linoleic acid, and carotenoids. Therefore, the development of more molecular markers closely linked to tomato sugar can lay the foundation for a more systematic establishment of a tomato sugar molecular marker-assisted breeding technology system.

[0004] Single Nucleotide Polymorphism (SNP) refers to DNA sequence polymorphism caused by the variation of a single nucleotide in the chromosomal genome content, and the frequency of at least one allele in the population is not less than 1%, including single-base conversion, transversion, and single-base insertion / deletion. Since its discovery, SNP markers have greatly promoted the progress of population genetics and molecular genetics due to their high density, large number, and easy detection. They are widely used in genetic map construction, gene cloning, quantitative trait locus analysis, and germplasm resource evaluation. High-throughput SNP marker detection methods include genome sequencing analysis and chip methods. SNP detection methods have also been widely studied due to its advantages of high efficiency, stability, and high density.

[0005] Comprehensive identification, evaluation, improvement and innovation of tomato germplasm resources are of great significance to tomato genetic breeding research. As a new generation of molecular markers, SNP has the characteristics of high abundance and easy automation of detection. It is possible to develop markers for detecting tomato sugar content traits using the polymorphism of the above sequences. Screening through the above markers is an effective way to improve the breeding efficiency of sugar content, an important tomato quality trait, save breeding costs and enhance the economic benefits of the tomato industry.

[0006] Prior art CN112442544B discloses a method, a kit and an application for assisting the screening of tomato materials with high-sugar traits. The invention provides SNP sites at 37559435bp on chromosome 6 of the tomato genome and at 3478110bp on chromosome 9 of the tomato genome, which can be used for screening tomato materials with high-sugar traits and for high-sugar tomato breeding and assisted breeding, thereby reducing the consumption of manpower and material resources in the screening process of tomatoes with high-sugar traits and greatly shortening the breeding cycle. However, the patent requires a comprehensive judgment of the SNP conditions of the two sites, and the workload of processing data is large when performing large-scale processing.

[0007] Therefore, there is an urgent need to develop a simpler method to screen tomato materials with high sugar traits. Summary of the invention

[0008] In order to solve the above problems, the present invention provides a primer set for detecting SNP sites related to the sugar content of tomato fruits and application thereof.

[0009] In one aspect, the present invention provides a method for detecting the sugar content of tomato fruit, the method comprising the following steps: S1: Extract genomic DNA; S2: Identify the base at 55876054bp on chromosome 11 of tomato; S3: Make a decision based on the result of S2.

[0010] Specifically, in step (3), the criteria for determination are as follows: if the genotype is GG, the tomato to be tested is determined to be low in sugar; if the genotype is AA, the tomato to be tested is determined to be high in sugar; if the genotype is GA, the tomato to be tested is determined to be high in sugar.

[0011] Specifically, in step (2), the identification methods include: KASP, first-generation sequencing, second-generation sequencing, Taqman probe method and HRM method.

[0012] More specifically, when the identification method is the KASP method, the primers used include SNP site competitive primers F1: GATAACCGGAACGCCGGGCACCGGG (SEQ ID NO. 5) and F2: GATAACCGGAACGCCGGGCACCGGA (SEQID NO. 6), a fluorescent label sequence connected to the 5' end of the SNP site competitive primer and a universal primer.

[0013] Preferably, the fluorescent tag sequence connected to the 5' end of the SNP site competitive primer F1 is as shown in SEQ ID NO.7: GAAGGTGACCAAGTTCATGCT.

[0014] Preferably, the fluorescent tag sequence connected to the 5' end of the SNP site competitive primer F2 is as shown in SEQ ID NO.8: GAAGGTCGGAGTCAACGGATT.

[0015] Further preferably, the primer sequence is shown as SEQ ID NO.2-4.

[0016] SEQ ID NO.2: GAAGGTGACCAAGTTCATGCTGATAACCGGAACGCCGGGCACCGGG; SEQ ID NO.3: GAAGGTCGGAGTCAACGGATTGATAACCGGAACGCCGGGCACCGGA; SEQ ID NO.4 (universal primer): CGTCGCCTCCGCCAGTGCAGACGACGTCG.

[0017] In certain specific embodiments of the present invention, in step (2), the KASP reaction amplification system comprises: 3-7 μL of KASP PCR Mix, 1-3 μL of DNA, and 0.1-0.5 μL of each primer.

[0018] In certain specific embodiments of the present invention, in step (2), the KASP reaction amplification conditions are: pre-denaturation at 95°C for 5-10 min; denaturation at 95°C for 5-10 s, annealing and extension at 58°C for 20-30 s, for a total of 35-40 cycles; and finally, reading the genotyping data at 30°C for 20-30 s.

[0019] In certain specific embodiments of the present invention, in step (3), the judgment criteria are as follows: if only the fluorescent signal corresponding to the fluorescent sequence connected to SEQ ID NO.2 is detected, the tomato to be tested exhibits low sugar content and its genotype is GG; if only the fluorescent signal corresponding to the fluorescent sequence connected to SEQ ID NO.3 is detected, the tomato to be tested is judged to be high sugar content and its genotype is AA; if both fluorescence signals are detected at the same time, the tomato to be tested is judged to be high sugar content and its genotype is heterozygous GA.

[0020] On the other hand, the present invention provides the use of a primer set having a sequence as shown in SEQ ID NO. 2-4 in detecting the sugar content of tomatoes.

[0021] Specifically, the primer set carries a fluorescent group, which includes but is not limited to: FAM, VIC and CY5.

[0022] In another aspect, the present invention provides the use of the above primer set in detecting the sugar content of tomatoes.

[0023] In yet another aspect, the present invention provides a kit, comprising the above-mentioned primer set.

[0024] Specifically, the kit also includes other reagents required for KASP.

[0025] Specifically, the reagents include but are not limited to: Taq DNA polymerase, free nucleotides (dNTPs), MgCl 2 and buffer.

[0026] Compared with the prior art, the present invention has the following advantages: The present invention relies on a single SNP site to complete the prediction of the high-sugar trait of tomatoes. The KASP (competitive allele PCR) involved in the present invention detects the SNP site by carrying different fluorescent groups, and has the advantages of high accuracy, fast detection speed, low cost, etc.

[0027] The screening method provided by the invention can greatly shorten the breeding period and is beneficial to improving the purity of parents. BRIEF DESCRIPTION OF THE DRAWINGS

[0028] Figure 1 This is a graph showing the genotyping results for tomato sugar content and the 55,876,054th base on chromosome 11.

[0029] Figure 2 This is a genotyping test diagram of SNP markers closely linked to the sugar content of tomato fruit in the population. DETAILED DESCRIPTION

[0030] The present invention will be further described in detail below in conjunction with specific examples. The following examples are not intended to limit the present invention, but are only intended to illustrate the present invention. The experimental methods used in the following examples are generally conventional, unless otherwise specified, and the materials, reagents, etc. used in the following examples are commercially available, unless otherwise specified.

[0031] Example 1 Validation of SNP markers in natural populations According to SEQ ID NO.1 (TTTTACCACTATTTTCTGTGAACACATTAATTACCATGGCGCACAATAGCAGTAGCAGGAGAAGACCTAACATACTGATAACCGGAACGCCGGGCACCGG[G / A]AAAACGACGACGTCGTCTGCACTGGCGGAGGCGACGCAGCTCCGGCATATCAACATCGGTGAACTGGTGAAAGAGAAGAAGTTGCACGACGGATGGGACG), double-end sequencing was performed using the second-generation sequencing technology and aligned to the tomato SL3.0 reference genome for BSA positioning analysis. The results were combined with the 20K liquid phase gene chip data for joint analysis. The results are shown in Figure 1 , a SNP molecular marker closely linked to the sugar content of tomato was obtained at base 55876054 of chromosome 11 of tomato.

[0032] KASP marker primers were designed according to the upstream and downstream sequences of the SNP site (as shown in SEQ ID NO.1), the hop-F1 sequence was 5'-GATAACCGGAACGCCGGGCACCGGG-3' (SEQ ID NO.5), and the FAM fluorescent label sequence 5'-GAAGGTGACCAAGTTCATGCT-3' (SEQ ID NO.7) was added to its 5' end; the hop-F2 sequence was 5'-GATAACCGGAACGCCGGGCACCGGA-3' (SEQ ID NO.6), and the VIC fluorescent label sequence 5'-GAAGGTCGGAGTCAACGGATT-3' (SEQ ID NO.8) was added to its 5' end; the common reverse primer hop-R was 5'-CGTCGCCTCCGCCAGTGCAGACGACGTCG -3' (SEQ ID NO.4). The complete sequence used by KASP is shown in Table 1.

[0033] Table 1 KASP labeling primers

[0034] 178 tomato materials with known sugar content were obtained from Shanghai Academy of Agricultural Sciences and Shanghai Funong Seed Co., Ltd. The genomic DNA of the tomato materials to be tested was extracted, and the primers in Table 1 were used to perform PCR amplification on the tomato materials to be tested. The amplified target fragments were sequenced, the sequencing peak graph was checked, and the genotype of the tomato samples to be tested was analyzed.

[0035] The specific experimental steps are as follows: (1) Extracting tomato genomic DNA to be tested: 1) Take 0.1g of young leaves of the selected variety, put them into a sampling tube, put them into liquid nitrogen and grind them.

[0036] 2) Add 700 μL of CTAB to the sample tube and vortex for 2-3 minutes.

[0037] 3) Incubate in a 65°C water bath for 60 min and shake manually 2-3 times during the water bath.

[0038] 4) Add chloroform / isoamyl alcohol (v / v) = 24:1, 700 μL, and shake manually for 5 minutes.

[0039] 5) Centrifuge at room temperature, 12000rpm, 10min.

[0040] 6) Pipette 400 μL of supernatant, add 400 μL of isopropanol, shake well, and cool at -80℃ for 10 min.

[0041] 7) Centrifuge the sample at 12000 rpm for 5 minutes at room temperature.

[0042] 8) Pour off the supernatant, add 500 μL of 75% alcohol, shake, and centrifuge at 12,000 rpm for 5 minutes.

[0043] 9) Pour out the alcohol, place it in a clean bench to dry, and add 30-50 μL of ultrapure water.

[0044] 10) Determine the concentration of the extracted DNA and dilute the extracted DNA 50 times (DNA concentration 25-50 ng / μL).

[0045] (2) Using tomato genomic DNA as a template, KASP reaction detection was performed using SEQ ID NO. 2-4; PCR system: 10 μL system, KASP PCR Mix (BGH1001RV5F, Guangzhou Good Biotechnology Co., Ltd.) 5 μL, DNA 2 μL, hop-F1 0.1 μL, hop-F2 0.1 μL, hop-R 0.3 μL, ddH 2 O 2.5 μL.

[0046] PCR amplification was performed on a BIORAD real-time quantitative instrument. The PCR amplification program was: 95°C pre-denaturation for 5 min; 95°C denaturation for 5 s, 58°C annealing and extension for 20 s, for a total of 38 cycles; and finally, genotyping data was read at 30°C for 30 s. Results are shown in Figure 2 , where G:G is the low-sugar homozygous genotype, A:A is the high-sugar homozygous genotype, G:A is the heterozygous type, and NTC is the no-template control. Figure 2 The results showed that the typing effect was good.

[0047] (3) Judgment criteria: When testing the sugar content of tomato fruit, if only the fluorescent signal corresponding to the fluorescent sequence connected to primer hop-F1 is detected, the tomato to be tested is low in sugar and its genotype is GG; if only the fluorescent signal corresponding to the fluorescent sequence connected to primer hop-F2 is detected, the tomato to be tested is high in sugar and its genotype is AA; if both fluorescence signals are detected at the same time, the tomato is judged to be heterozygous. The tomato to be tested is judged to be high in sugar and its genotype is heterozygous GA. The experimental results of 178 tomato materials are shown in Table 2.

[0048] Table 2 Genotypes and fruit sugar content of 178 tomato materials

[0049] The population experiment confirmed that the molecular marker was closely related to the sugar content of tomatoes. Among the 178 populations tested, 69 samples had a sugar content less than 7, and 109 samples had a sugar content greater than or equal to 7. The base types of the high-sugar materials at the 55876054 test site were A:A or G:A; the base types of the low-sugar materials at the 55876054 test site were G:G. The genotypes and fruit sugar content of 178 tomato materials are shown in Table 1. 66 samples were detected to have a genotype of G:G at this site, and the sugar content was less than 7; 103 samples were detected to have a genotype of A:A at this site, and 6 samples were detected to have a genotype of G:A at 55876054, and the sugar content was greater than 7.

[0050] Finally, it should be noted that the above content is only used to illustrate the technical solution of the present invention, rather than to limit the scope of protection of the present invention. Simple modifications or equivalent substitutions of the technical solution of the present invention by ordinary technicians in this field do not deviate from the essence and scope of the technical solution of the present invention.

Claims

1. A method for detecting the sugar content of tomato fruit, characterized in that: The following steps are involved: S1: Extract genomic DNA; S2: Identify the base at 55876054bp on chromosome 11 of tomato; S3: Make a decision based on the result of S2.

2. The detection method according to claim 1, characterized in that: In step (3), the judgment criteria are as follows: if the genotype is GG, the tomato to be tested is judged to be low in sugar; if the genotype is AA, the tomato to be tested is judged to be high in sugar; if the genotype is GA, the tomato to be tested is judged to be high in sugar.

3. The detection method according to claim 1, characterized in that: In step (2), the identification methods include: KASP, first-generation sequencing, second-generation sequencing, Taqman probe method and HRM method.

4. The detection method according to claim 3, characterized in that: When the identification method is the KASP method, the primers used include SNP site competitive primers F1: GATAACCGGAACGCCGGGCACCGGG and F2: GATAACCGGAACGCCGGGCACCGGA, a fluorescent tag sequence connected to the 5' end of the SNP site competitive primer and a universal primer.

5. The detection method according to claim 4, characterized in that: The primer sequences are shown in SEQ ID NO.2-4.

6. The detection method according to claim 5, characterized in that: In step (2), the KASP reaction amplification system includes: KASP PCR Mix 3-7 μL, DNA 1-3 μL, and each primer 0.1-0.5 μL.

7. The detection method according to claim 5, characterized in that: In step (2), the KASP reaction amplification conditions are: pre-denaturation at 94-96°C for 5-10 min; denaturation at 94-96°C for 5-10 s, annealing and extension at 56-60°C for 20-30 s, for a total of 35-40 cycles; and finally, reading the genotyping data at 29-31°C for 20-30 s.

8. Application of the primer set with sequences as shown in SEQ ID NO. 2-4 in detecting the sugar content of tomatoes.

9. A kit for detecting the sugar content of tomatoes, characterized in that: The kit includes the primer set shown in SEQ ID NO.2-4.

10. The kit according to claim 9, characterized in that The kit also includes other reagents required for KASP reaction.

Images