Method and kit for identifying paeonia ostii

Through real-time fluorescence quantitative PCR technology, specific primers and fluorescent probes were designed using the ycf1 gene sequence-specific mutation sites of Luanfeng Jade, which solved the problem of rapid and accurate identification of Luanfeng Jade and achieved high sensitivity identification effect.

CN120099214APending Publication Date: 2025-06-06ANIMAL AND PLANT & FOOD DETECTION CENTER JIANGSU ENTRY EXIT INSPECTION AND QUARANTINE BUREAU
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510346069.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-24
Publication Date
2025-06-06

AI Technical Summary

Technical Problem

The prior art is difficult to quickly and accurately identify phoenix jade, especially when its morphology is similar to that of other planetary plants, resulting in identification difficulties and misjudgment.

Method used

Using real-time fluorescence quantitative PCR technology, the rapid and accurate identification of Luanfeng Jade DNA is achieved by designing specific primers and fluorescent probes based on the sequence-specific mutation sites of Luanfeng Jade ycf1 gene.

Benefits of technology

The rapid and accurate identification of phoenix jade is achieved, which avoids misjudgment in morphological identification, and has high detection sensitivity, so that reliable results can be obtained in low-concentration DNA samples.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099214A_ABST
    Figure CN120099214A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of biological identification, in particular to a method and kit for identifying paeonia ostii, and the method comprises the following steps: (1) extracting genome DNA from a plant sample to be detected; (2) designing a pair of specific primers and corresponding fluorescent probes based on a ycf1 gene sequence in a chloroplast genome of an asteroid plant on the basis of specific mutation sites existing in the paeonia ostii and other asteroid plants; (3) adding the primer, the fluorescent probe and other PCR reaction components into a real-time fluorescent PCR reaction system, and amplifying the DNA template; and (4) judging whether the sample contains a specific amplification signal of the Fengyu according to the form of the amplification curve and the threshold period so as to realize the identification of the Fengyu. By providing a rapid, accurate and low-cost molecular identification method, an effective technical means is provided for supervision of endangered wild animal and plant species in international trade, thereby playing a positive role in protecting endangered species and maintaining biodiversity.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention relates to the technical field of biological identification, and in particular to a method and a kit for identifying Luanfeng Jade. Background Art

[0002] The whole plant of the genus Astrophytum has white star-shaped dots. Its dignified posture, dark green skin inlaid with white dots, and elegant warty hairs are extremely ornamental. Therefore, it is loved and sought after by domestic enthusiasts. Some domestic botanical gardens have introduced and planted plants of this family. A large number of Astrophytum plants and their seeds are intercepted at my country's ports every year, including the Luanfeng Jade.

[0003] At present, the research on Astrophytum coahuilense in China is mainly focused on cultivation, propagation and appreciation. The identification of Astrophytum coahuilense is mainly based on morphology, and morphological identification is highly dependent on professional identification personnel. This leads to the inability of customs ports to equip a large number of morphological identification experts during the identification process. In addition, the morphology of Astrophytum coahuilense and Astrophytum coahuilense is very similar, and it is difficult to distinguish them in morphology. At the same time, the seed morphology of Astrophytum coahuilense is very similar to that of other Astrophytum coahuilense plants, and it is difficult to distinguish them. Therefore, there is an urgent need for a convenient, fast and easy-to-operate molecular identification method to accurately identify Astrophytum coahuilense and provide technical support for the identification of endangered species at customs ports.

[0004] Real-time fluorescence quantitative PCR technology is a method that adds fluorescent groups to the PCR reaction system, uses the accumulation of fluorescent signals to monitor the entire PCR process in real time, and finally uses the standard curve to perform quantitative analysis on unknown templates. Real-time fluorescence quantitative PCR has the characteristics of high sensitivity, strong specificity, good repeatability and high throughput. At present, the research on this technology in plant quarantine is constantly deepening, and it is widely used in the detection and identification of pathogens and species such as bacteria, fungi, and viruses.

[0005] By comparing and analyzing the ycf1 (hypothetical chloroplast open reading frame 1) sequences of the genus Chloroplast, specific primers and fluorescent probes for real-time fluorescence quantitative PCR were designed to study the molecular identification method of Chloroplast. The practicability of the method was tested, providing new methods and ideas for the identification of endangered species. Summary of the invention

[0006] The purpose of the present invention is to provide a method and a kit for identifying the phoenix jade, and by providing a rapid, accurate and low-cost molecular identification method, an effective technical means is provided for the supervision of endangered wild animal and plant species in international trade, thereby playing a positive role in protecting endangered species and maintaining biodiversity.

[0007] To achieve the above-mentioned purpose, the present invention provides the following technical scheme: a method for identifying ophora japonica, comprising the following steps: (1) extracting genomic DNA from a plant sample to be tested; (2) designing a pair of specific primers and corresponding fluorescent probes based on the ycf1 gene sequence in the chloroplast genome of ophora japonica and the specific mutation sites existing in ophora japonica and other ophora japonica plants; (3) adding the primers, fluorescent probes and other PCR reaction components to a real-time fluorescent PCR reaction system to amplify the DNA template; (4) judging whether the sample contains the specific amplification signal of ophora japonica based on the morphology of the amplification curve and the threshold period, thereby realizing the identification of ophora japonica.

[0008] In a specific embodiment, the design basis of the specific primers and fluorescent probes is that the ycf1 gene sequence of the jasper has a unique mutation fragment, and the fragment is used as a molecular marker to distinguish it from other genus jasper.

[0009] In a specific embodiment, the real-time fluorescent PCR reaction conditions include: initial denaturation at 94°C for 15 seconds; followed by 40 cycles, each cycle including denaturation at 94°C for 15 seconds and annealing / extension at 60°C for 1 minute.

[0010] In a specific embodiment, an endogenous reference gene detection step is also included, that is, using plant 18SrRNA as an internal reference, and verifying the quality of the extracted DNA through real-time fluorescence PCR to ensure the accuracy of the detection results.

[0011] In a specific embodiment, the sensitivity of the detection method reaches 2.0×10 -5 ng / μL, that is, a typical amplification curve can still be obtained at this concentration, thereby achieving effective detection of low-content Jadeite DNA.

[0012] A kit for identifying Luanfeng Jade, comprising:

[0013] a. Specific primer pairs for real-time fluorescence PCR amplification;

[0014] b. Fluorescent probes for real-time fluorescence PCR detection;

[0015] c. Premix, ROX internal reference and other auxiliary reaction reagents suitable for PCR reaction;

[0016] d. Instructions for sample DNA extraction and reaction operation.

[0017] In a specific embodiment, the sequences of the specific primer pair and the fluorescent probe are: upstream primer: 5′-CTCGACAGAAGAAGAGAGCAGAA-3′; downstream primer: 5′-CAAGTCCTTATTACGTGACCGA-3′; fluorescent probe: 5′-FAM-CGACGAAAAAGAAAAAGAAGAAGACACC-BHQ-3′.

[0018] Compared with the prior art, the present invention has the following beneficial effects:

[0019] 1. The real-time fluorescence quantitative PCR technology can be used to obtain test results in a relatively short time, meeting the needs of customs, plant quarantine and other departments for rapid testing.

[0020] 2. Specific primers and fluorescent probes designed based on the ycf1 gene sequence mutation unique to Pseudostellaria rapa (six mutant bases "AAAGAA" at positions 240 to 245) can accurately distinguish Pseudostellaria rapa from other morphologically similar plants of the genus Astragalus, avoiding misjudgment caused by similarities in traditional morphological identification.

[0021] 3. The sensitivity of the detection method can reach 2.0×10 -5 ng / μL, a typical amplification curve can be obtained even in low-concentration DNA samples, ensuring the reliability and accuracy of the detection.

[0022] 4. The kit is pre-configured with specific primers, fluorescent probes and corresponding PCR premixes, and with detailed operating instructions, non-professionals can also perform testing conveniently and in a standardized manner in practical applications such as customs and quarantine. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is a graph showing the results of real-time fluorescence PCR amplification of endogenous genes of the sample to be tested in the present invention;

[0024] Figure 2 This is a graph showing the specific amplification results of the real-time fluorescence quantitative PCR of the Luanfeng Jade of the present invention;

[0025] Figure 3 This is a graph showing the sensitivity results of real-time fluorescence PCR in the present invention;

[0026] Figure 4 It is a standard curve diagram of real-time fluorescence PCR amplification in the present invention. DETAILED DESCRIPTION

[0027] The following will be combined with the drawings in the embodiments of the present invention to clearly and completely describe the technical solutions in the embodiments of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] In the description of the present invention, it is necessary to understand that the terms "upper", "lower", "front", "back", "left", "right", "top", "bottom", "inside", "outside", etc., indicating the orientation or position relationship are based on the orientation or position relationship shown in the drawings, and are only for the convenience of describing the present invention and simplifying the description, rather than indicating or implying that the device or element referred to must have a specific orientation, be constructed and operated in a specific orientation, and therefore cannot be understood as a limitation on the present invention.

[0029] Embodiment 1

[0030] 1.1 Test materials

[0031] A total of 26 test materials were collected, including 18 samples of 6 species of the genus Echinocactus, 4 samples of 4 species of Echinocactus, Aztekium ritteri, Leuchtenbergia principis, and 2 samples of 2 species of Ferocactus. The test materials were intercepted from Nanjing, Jiangsu, Zhangzhou, Fujian, and ports, and were reviewed and identified by experts from Nanjing Zhongshan Botanical Garden. Fresh plant tissues were collected for testing. Detailed information on the samples is shown in Table 1.

[0032] Table 1 Plant materials and sources

[0033]

[0034]

[0035]

[0036]

[0037] 1.2 Main reagents and instruments

[0038] TaKaRa Premix Ex TapTM (Probe qPCR) was purchased from Nanjing E-Tep Instrument Co., Ltd., and the plant genomic DNA extraction kit was purchased from Beijing Tiangen Biochemical Technology Co., Ltd. The real-time fluorescence PCR instrument was ABI 7500 FAST fluorescence quantitative PCR instrument.

[0039] 1.3 Template DNA extraction

[0040] First, disinfect the surface of the test sample, grind the plant tissue into powder in a mortar, and extract the genomic DNA of the experimental sample according to the steps in the instructions of the plant genomic DNA extraction kit. The extracted genomic DNA was stored at 4°C for later use.

[0041] 1.4 Primer and probe design

[0042] According to the conserved gene sequence unique to Luanfeng Jade, the specific primers and probes of Luanfeng Jade were designed using Primer Express 3.0 software, and their sequences are shown in Table 1. The 5′ end of the probe contains a FAM fluorescent reporter group, and the 3′ end contains a non-fluorescent quencher group BHQ1.

[0043] Table 2 Primers and probes for real-time fluorescence RT-PCR detection of Luanfengyu

[0044]

[0045]

[0046] 1.5 Endogenous gene detection

[0047] The extracted DNA template was tested by real-time fluorescence PCR using the universal plant endogenous gene 18SrRNA. The endogenous gene refers to the 18SrRNA sequence in SN / T 1204-2016. The sample to be tested should have a typical amplification curve. If no real-time fluorescence PCR amplification curve appears, it means that there is a problem with the quality of DNA extraction, or there are factors that inhibit the PCR reaction in the DNA extraction solution. The DNA should be re-extracted until the PCR product is amplified. The amplification conditions are the same as 1.6.

[0048] 1.6 Real-time fluorescence PCR amplification

[0049] The real-time fluorescence PCR reaction system is shown in Table 3. When adding samples, the sample DNA solution should be completely dropped into the reaction solution and should not adhere to the tube wall. The tube cap should be tightly closed as soon as possible after adding samples.

[0050] Table 3 Real-time fluorescence PCR reaction system

[0051]

[0052]

[0053] The reaction parameters of real-time fluorescence quantitative PCR were: 94°C for 15 s, 60°C for 1 min, and 40 cycles.

[0054] Note: Different instruments can adjust the reaction parameters appropriately according to the requirements of the instrument and the reaction reagents.

[0055] 1.7 Specificity test

[0056] All samples were placed in a real-time fluorescence quantitative PCR instrument, amplified according to the set reaction conditions, and the specificity of the reaction system was observed.

[0057] 1.8 Sensitivity test

[0058] DNA was extracted from the plant tissue of Psoralea corylifolia, and the nucleic acid concentration was determined by ultraviolet spectrophotometry. The DNA was diluted 10 times in a gradient series, and real-time fluorescence quantitative PCR was performed on DNA templates of various concentrations, with 3 replicates for each concentration.

[0059] 2 Results and Analysis

[0060] 2.1 Endogenous gene detection

[0061] The real-time fluorescence PCR test was performed on the genomic DNA of 26 samples using the universal plant endogenous gene 18SrRNA. All samples had typical amplification curves with Ct values ​​between 10 and 18. This indicated that the quality of the extracted sample DNA was good and that subsequent tests (such as Figure 1 ).

[0062] 2.2 Real-time fluorescence quantitative PCR specific detection

[0063] Using the designed specific primers and fluorescent probes, real-time fluorescence quantitative PCR was performed on the DNA of 26 samples. The results showed that only 4 samples of Luanfeng Jade showed typical amplification curves (see Figure 2 ). This indicates that the designed primers and fluorescent probes have good specificity for Jadeite sphenanthera.

[0064] 2.3 Real-time fluorescence quantitative PCR detection sensitivity

[0065] After extracting the genomic DNA of the As10 sample from the Jadeite genus, the nucleic acid concentration was determined to be 2.03 ng / μL. The sample DNA was diluted 10 times in a gradient to detect the sensitivity of the real-time fluorescence quantitative PCR method. The amplification results showed that the As10 nucleic acid stock solution and the 10-1 to 10-4 times dilution samples were able to obtain typical amplification curves. The threshold line was set according to the negative control, and the Ct values ​​were obtained as 20.496, 24.193, 27.744, 32.609, and 37.008, respectively. The 10-5 to 10-7 dilution samples did not obtain a typical amplification curve and were judged to be negative (see Figure 3 The correlation coefficient of the standard curve of this sensitivity test is 0.996 (see Figure 4 ), the detection limit is 2.0×10-5ng / μL.

[0066] In particular, the inventors sequenced and analyzed the chloroplast genome of the genus Asteraceae and found that the genus Asteraceae had ycf1 functional gene sequences, and compared with other Asteraceae plants, the genus Asteraceae had 6 mutant bases AAAGAA at positions 240 to 245 of the functional gene sequence. On this basis, we designed specific primers and fluorescent probes for the real-time fluorescence quantitative PCR of Asteraceae to study the molecular identification method of Asteraceae and test the sensitivity of the method, providing a new technical route for the identification of endangered species.

[0067] Sample As10 ycf1 sequence:

[0068] 1AAACGGTGTTTGGTTACTG TTCCAATCACATGAACATTCCAAATTTTTT 50

[0069] 51TTGAACAGAA CAGATTCTTT TTTTAATATT TCGCTTTACT GGTGGTATTT 100

[0070] 101TATTAAAGGAATTTTTCTAAGTATATGAGAAAATCTCAGAATTTGAAC 150

[0071] 151TTTCGGCTTA TTACCCTTCT TTCAAAGATT TATTTATTTC TATAGAAGAA 200

[0072] 201TCGACAGAAG AAGAGAGCAG AATAGACGAC GAAAAAGAAA AAGAAGAAGA 250

[0073] 251CACCGAAACC AAAAAAGAGACCATAGAAGAAAAATAAGAGATGTTGAGT 300

[0074] 301TAATGTGGGA TGATATTCTA TTCGGTCACG TAATAAGGAC TTGGTTGCTA 350

[0075] 351ATCATCCATTCATTTATTAG AAAAAAAATT ATAATACCTT TATTGATAAT 400

[0076] 401AGCGAAAAATATTGGCCGTA TATTATTATTGCAACGTCCTGAGTTGTTGG 450

[0077] 451AAGATTTTAA AGAGTTGGAT AAAGAAATATTTATTTTTG TACCTATAAT 500

[0078] 501GGTATTCCATTCTCAGAAACGGACTTGCCT GAAACCTGGGTAGATGAGGG 550

[0079] 551TATACAGATA AAGATATTAA ATCCTTTCCG CCTAAAACCT TGGCACAAAT 600

[0080] 601CTAGGCCTTC TAATCGAAAG AGAAAGGATT ATTTTTATTT TACAACTATC 650

[0081] 651GGACTGCCAA C 661

[0082] The above shows and describes the basic principles and main features of the present invention and the advantages of the present invention. For those skilled in the art, it is obvious that the present invention is not limited to the details of the above exemplary embodiments, and the present invention can be implemented in other specific forms without departing from the spirit or basic features of the present invention; therefore, no matter from which point of view, the embodiments should be regarded as exemplary and non-restrictive. The scope of the present invention is limited by the attached claims rather than the above description. Therefore, it is intended to include all changes within the meaning and scope of the equivalent elements of the claims in the present invention, and any figure marks in the claims should not be regarded as limiting the claims involved.

[0083] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for identifying Luanfeng Jade, characterized in that: The method comprises the following steps: (1) extracting genomic DNA from a plant sample to be tested; (2) designing a pair of specific primers and corresponding fluorescent probes based on the ycf1 gene sequence in the chloroplast genome of the genus Astragalus and the specific mutation sites existing in the Astragalus and other Astragalus plants; (3) adding the primers, fluorescent probes and other PCR reaction components into a real-time fluorescent PCR reaction system to amplify the DNA template; (4) judging whether the sample contains the specific amplification signal of the Astragalus based on the morphology of the amplification curve and the threshold period, thereby realizing the identification of the Astragalus.

2. The method according to claim 1, characterized in that The design basis of specific primers and fluorescent probes is that the ycf1 gene sequence of the ophiopogon has a unique mutation fragment, which is used as a molecular marker to distinguish it from other genus ophiopogon.

3. The method according to claim 1, characterized in that The real-time fluorescence PCR reaction conditions included: initial denaturation at 94°C for 15 seconds; followed by 40 cycles, each cycle including denaturation at 94°C for 15 seconds and annealing / extension at 60°C for 1 minute.

4. The method according to claim 1, characterized in that: It also includes an endogenous reference gene detection step, which uses plant 18SrRNA as an internal reference and verifies the quality of the extracted DNA through real-time fluorescence PCR to ensure the accuracy of the test results.

5. The method according to claim 1, characterized in that The sensitivity of the detection method reached 2.0×10 -5 ng / μL, that is, a typical amplification curve can still be obtained at this concentration, thereby achieving effective detection of low-content Jadeite DNA.

6. A kit for identifying Luanfeng Jade, characterized in that: include: a. Specific primer pairs for real-time fluorescence PCR amplification; b. Fluorescent probes for real-time fluorescence PCR detection; c. Premix, ROX internal reference and other auxiliary reaction reagents suitable for PCR reaction; d. Instructions for sample DNA extraction and reaction operation.

7. The kit according to claim 3, characterized in that The sequences of the specific primer pair and fluorescent probe are: Upstream primer: 5′-CTCGACAGAAGAAGAGAGCAGAA-3′; downstream primer: 5′-CAAGTCCTTATTACGTGACCGA-3′; fluorescent probe: 5′-FAM-CGACGAAAAAGAAAAAGAAGAAGACACC-BHQ-3′.