Method for detecting mutation of euphorbia seeds ACCase gene W2027C

Abstract

The invention discloses a mutation detection method of a moleplant seed ACCase gene W2027C. The method is based on recombinase-mediated isothermal amplification and CRISPR (clustered regularly interspaced short palindromic repeats) / Cas12a (clustered regularly interspaced short palindromic repeats) technologies, and is a method for rapidly detecting the mutation of an ACCase gene W2027C in moleplant seeds. The method comprises the following steps: extracting genome DNA (Deoxyribose Nucleic Acid) from a moleplant seed sample to be detected; the method comprises the following steps: designing a specific RAA primer, and amplifying an ACCase gene segment containing a W2027C mutation site; a compound is formed by specific crRNA designed for W2027C mutation and Cas12a protein, and the compound, an amplification product and a fluorescence report probe are jointly incubated; a fluorescence signal is observed under the excitation wavelength of 492 nm, and whether W2027C mutation exists in the sample or not is judged. The method is easy and convenient to operate, rapid, efficient, free of complex equipment and suitable for field resistance monitoring and weed management.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and specifically to a method for rapidly and accurately detecting a Trp-2027-Cys (W2027C) mutation in an ACCase gene of Leptochloa chinensis (L.) Nees based on recombinase-mediated isothermal amplification (RAA) and CRISPR / Cas12a technology, which is suitable for on-site resistance monitoring and weed management. Background Art

[0002] Leptochloa chinensis is one of the more common and difficult to control weeds in rice fields, especially in Asia. This weed has high biomass and high reproductive capacity, can spread rapidly in the field, compete with rice for light, water and nutrients, and cause a significant decrease in rice yield. Studies have shown that when the density of Leptochloa chinensis reaches 40-80 plants / m 2 When the rainfall is high, rice production can drop by up to 86%, posing a serious threat to agricultural production and food security.

[0003] In recent years, acetyl-CoA carboxylase (ACCase) inhibitor herbicides have been widely used for the prevention and control of Leptochloa chinensis in rice fields, among which cyhalofop-butyl is the most widely used. ACCase is a key enzyme in the biosynthesis of fatty acids. Inhibition of its function will lead to the blockage of fatty acid synthesis, which in turn affects the metabolic function and causes the death of weeds. The long-term and large-scale use of ACCase inhibitor herbicides has led to the evolution of obvious resistance in the Leptochloa chinensis population. The main resistance mechanism is target resistance caused by point mutations in the carboxyltransferase (CT) domain of the ACCase gene. At least 12 target resistance mutations have been found, among which the Trp-2027-Cys (W2027C) mutation is more common in Leptochloa chinensis.

[0004] Traditional resistance detection methods, such as whole plant bioassays, generally take 1-2 months, traditional PCR+sequencing takes about 3 days, real-time fluorescence quantitative PCR takes about 1 day, pyrophosphate sequencing takes about 1 week, etc., although they have high accuracy, they are cumbersome to operate, require high equipment, and have a long detection cycle, making it difficult to meet the needs of rapid on-site detection. Therefore, it is urgent to develop new, accurate and rapid detection methods. Summary of the invention

[0005] The purpose of the present invention is to provide a rapid detection method based on RAA and CRISPR / Cas12a technology, which can accurately determine the W2027C mutation of the ACCase gene in Leptochloa chinensis without the need for complex instruments, thereby providing technical support for field weed resistance monitoring and precision weed control. To achieve the above purpose, the present invention adopts the following technical solutions:

[0006] A method for detecting the W2027C mutation of the ACCase gene of Leptochloa chinensis is based on recombinase-mediated isothermal amplification technology and CRISPR / Cas12a technology to detect the W2027C mutation of the ACCase gene of Leptochloa chinensis.

[0007] The specific steps include:

[0008] Step 1: Extract DNA sample from Leptochloa chinensis;

[0009] Step 2: Design specific RAA primers and amplify the ACCase gene fragment containing the W2027C mutation site;

[0010] Step 3: Use specific crRNA to bind to Cas12a protein and incubate with the amplified product and fluorescent reporter probe;

[0011] Step 4: Detect the change in fluorescence signal to determine whether the W2027C mutation exists in the sample.

[0012] Further,

[0013] The RAA primer sequences described in step 2 are as follows:

[0014] F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC

[0015] R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG.

[0016] The RAA reaction in step 2 was carried out at 37°C for 10-15 minutes.

[0017] The crRNA nucleotide sequence described in step 3 is as follows:

[0018] 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

[0019] The fluorescent reporter probe described in step 3 is a single-stranded DNA probe, and its sequence is 5'-FAM-TTTATTT-BHQ1-3'.

[0020] Incubate the reaction in step 3 at 37°C for 15-20 minutes.

[0021] The fluorescence signal detection method in step 4 is: detecting the presence of a fluorescence signal at an excitation wavelength of 492 nm. If a fluorescence signal is observed, it is determined that the W2027C mutation exists in the sample; if no fluorescence signal appears, it is determined that the W2027C mutation does not exist in the sample.

[0022] The present invention combines the recombinase-mediated isothermal amplification (RAA) technology with the CRISPR / Cas12a system for the first time and applies it to the detection of Trp-2027-Cys (W2027C) mutation in the ACCase gene of Leptochloa chinensis, which can give full play to the advantages of both: isothermal amplification can enrich the target sequence in a short time and improve the detection sensitivity, while the specific cleavage mediated by Cas12a can effectively reduce the interference caused by nonspecific amplification and improve the specificity of detection. The combined application of RAA and CRISPR / Cas12 technology in the detection of weed resistance target mutations can achieve rapid detection of mutation sites in low-concentration DNA samples within 1-2 hours, which has broad prospects for field application. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 It is the result of electrophoresis detection of RAA amplification product.

[0024] In the figure, S1-S5 are DNA sample amplification bands of 5 plants confirmed to be sensitive by sequencing, and R1-R5 are DNA sample amplification bands of 5 plants confirmed to be W2027 mutant resistant by sequencing.

[0025] Figure 2 It is the fluorescence detection result of CRISPR / Cas12a reaction.

[0026] In the figure, S is the test result of 5 samples confirmed as sensitive plants by sequencing, with no fluorescent signal; R is the test result of 5 samples confirmed as W2027C mutant resistant plants by sequencing, with obvious green fluorescent signal. DETAILED DESCRIPTION

[0027] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. The chemical reagents and materials used in the following examples, unless otherwise specified, can all be obtained from commercial sources. In addition, unless otherwise specified, the examples are all based on conventional experimental conditions, such as J. Sambrook et al. Molecular Cloning Manual (New York: Gold Spring Harbor Laboratory Press, 1989).

[0028] Example 1: Sample preparation and DNA extraction

[0029] The rapid DNA extraction kit was used from Tiangen Biochemical Technology Co., Ltd.

[0030] (1) Collect the sample of Euphorbia pulex and place it in a 1.5 mL centrifuge tube;

[0031] (2) Add 100 μL of buffer B1 and crush the sample with a pestle;

[0032] (3) Add 100 μL of buffer B2, shake to mix, and centrifuge at 12000 rpm for 2 min;

[0033] (4) Aspirate the supernatant DNA extraction solution.

[0034] Example 2: RAA reaction

[0035] The RAA nucleic acid amplification kit from Jiangsu Qitian Gene Biotechnology Co., Ltd. was used.

[0036] (1) Prepare the following reaction system:

[0037]

[0038] Primer sequences:

[0039] F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC

[0040] R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG.

[0041] Add the above reaction system to the freeze-dried enzyme powder, mix thoroughly and centrifuge briefly;

[0042] (2) Add 5 μL of magnesium acetate I to the cap of the reaction tube, then add 1 μL of DNA template to the reaction solution and immediately close the cap;

[0043] (3) Mix thoroughly, centrifuge, and react at 37°C for 10-15 minutes to amplify the ACCase gene fragment containing the W2027C mutation site;

[0044] (4) A small amount of the reaction product can be taken for 2% agarose gel electrophoresis to detect the RAA amplification effect. The results of some samples are shown in Figure 1 .

[0045] Example 3: CRISPR / Cas12a reaction

[0046] This was performed using LbCas12a (Cpf1) and reaction buffer from New England Biolabs.

[0047] (1) Configure the following reaction system:

[0048]

[0049] The crRNA nucleotide sequence is as follows:

[0050] 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

[0051] The fluorescent reporter probe is a single-stranded DNA probe with the sequence:

[0052] 5′-FAM-TTTATTT-BHQ1-3′.

[0053] (2) After thorough mixing, react at 37°C for 15-20 minutes to allow the amplified product to activate the Cas12a complex and then cut the fluorescent probe.

[0054] Example 4: Fluorescence signal detection and result determination

[0055] (1) Observe the fluorescence signal in the reaction system at an excitation wavelength of 492 nm;

[0056] (2) If an obvious fluorescent signal is detected, it is determined that the W2027C mutation exists in the sample; if no obvious fluorescent signal is observed, it is determined that the mutation does not exist in the sample. Figure 2 .

[0057] The present invention tested a total of 100 samples, of which 72 samples confirmed by sequencing to be sensitive plants had no fluorescent signals, and 28 samples confirmed by sequencing to be W2027C mutant resistant plants had obvious green fluorescent signals. The accuracy of the detection method of the present invention can reach 100%.

[0058] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements may be made thereto on the basis of the present invention. Therefore, these modifications or improvements made on the basis of not departing from the spirit of the present invention all belong to the scope of protection claimed by the present invention.

Claims

1. A method for detecting the W2027C mutation in the ACCase gene of Leptochloa chinensis, characterized in that: The W2027C mutation of the ACCase gene in Leptochloa chinensis was detected based on recombinase-mediated isothermal amplification technology and CRISPR / Cas12a technology.

2. The method according to claim 1, characterized in that: The following steps are involved: Step 1: Extract DNA sample from Leptochloa chinensis; Step 2: Design specific RAA primers and amplify the ACCase gene fragment containing the W2027C mutation site; Step 3: Use specific crRNA to bind to Cas12a protein and incubate with the amplified product and fluorescent reporter probe; Step 4: Detect the change in fluorescence signal to determine whether the W2027C mutation exists in the sample.

3. The method according to claim 1, characterized in that: The RAA primer sequences described in step 2 are as follows: F: CAACCGTGAAGGATTGCCTCTGTTCATCCTTTC R: GTAGACAAATGCTGGCTGATTATATGTCCTAAG.

4. The method according to claim 1, 2 or 3, characterized in that: The RAA reaction in step 2 was carried out at 37°C for 10-15 minutes.

5. The method according to claim 1, characterized in that: The crRNA nucleotide sequence described in step 3 is as follows: 5'-UAAUUUCUACUAAGUGUAGAUUAACUGUAGAGGCUUCUCUGG-3'.

6. The method according to claim 1 or 5, characterized in that: The fluorescent reporter probe described in step 3 is a single-stranded DNA probe, and its sequence is 5'-FAM-TTTATTT-BHQ1-3'.

7. The method according to claim 1, 5 or 6, characterized in that: Incubate the reaction in step 3 at 37°C for 15-20 minutes.

8. The method according to claim 1 or 5 or 6 or 7, characterized in that: The fluorescence signal detection method in step 4 is: detecting the presence of a fluorescence signal at an excitation wavelength of 492 nm. If a fluorescence signal is observed, it is determined that the W2027C mutation exists in the sample; if no fluorescence signal appears, it is determined that the W2027C mutation does not exist in the sample.

Images