Kit and method for identifying bulbus fritillariae cirrhosae

By designing a kit for Fritillaria kebayashi, the SNP sites in specific gene fragments were detected, and the accurate identification of Fritillaria kebayashi plants was achieved, the problem of confusion in the market was solved, and the quality control of medicinal materials and the rational development and utilization of resources were improved.

CN120099226AActive Publication Date: 2025-06-06CHENGDU UNIV OF TRADITIONAL CHINESE MEDICINE
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510558263.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-29
Publication Date
2025-06-06
Estimated Expiration
2045-04-29

AI Technical Summary

Technical Problem

There is a problem of confusion in the medicinal materials market for basal citrus, which leads to scarcity of resources and the proliferation of mixed products, affecting the efficacy of medicinal materials, medication safety and consumer interests.

Method used

A kit was designed to detect specific SNP sites in RPL17, CKX3 and ILA gene fragments in Fritillaria kebayashi, and identify them using the KASP method or restriction fragment length polymorphism method to achieve accurate identification of Fritillaria kebayashi plants.

Benefits of technology

This method can quickly and accurately distinguish six types of basal plants of Fritillaria citrus, solve the problem of basal confusion in the market, and improve the quality control of medicinal materials and the rational development and utilization of resources.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120099226A_ABST
    Figure CN120099226A_ABST
Patent Text Reader

Abstract

The invention belongs to the field of SNP (Single Nucleotide Polymorphism) detection, and particularly provides a kit and a method for identifying bulbus fritillariae cirrhosae. The kit comprises a reagent for detecting the 228th SNP site in an RPL17 gene segment 1855 (2) of bulbus fritillariae cirrhosae, the 122th SNP site in a CKX3 gene segment 1642 (1), the 112th SNP site in a CKX3 gene segment 1642 (3) and the 213th SNP site in an ILA gene segment 14943 (3). According to the invention, the relationship between one SNP site on a section of sequence in the RPL17 gene, two SNP sites on a section of sequence in the CKX3 gene and one SNP site on a section of sequence in the ILA gene and the primordial of the bulbus fritillariae cirrhosae is discovered, and primordial identification of the bulbus fritillariae cirrhosae can be realized through any reagent or equipment for detecting the basic groups of any one or more SNP sites on the basis of the relationship between the primordial of the bulbus fritillariae cirrhosae, two SNP sites on a section of sequence in the RPL17 gene, two SNP sites on a section of sequence in the CKX3 gene and one SNP site on a section of sequence in the ILA gene and the primordial of the bulbus fritillariae cirrhosae.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The invention belongs to the technical field of SNP, and particularly relates to a kit and a method for identifying Fritillaria cirrhosa. Background Art

[0002] Liliaceae Liliaceae Fritillaria Fritillaria The dried bulbs of some medicinal plants, whose original plants are included in the 2020 edition of the "Pharmacopoeia of the People's Republic of China", include Fritillaria cirrhosa, Fritillaria dasyphylla, Fritillaria gansuensis, Fritillaria thunbergii, Fritillaria wabuensis and Fritillaria taibaiensis. As a representative and precious medicinal material, Fritillaria chuanxiong has a long history of medicinal use and has the effects of clearing heat and moistening the lungs, resolving phlegm and relieving cough. Although the dried bulbs of the six original plants are all Fritillaria chuanxiong medicinal materials, they can be divided into "Songbei", "Qingbei", "Lubei" and "cultivated products" according to their different properties, and the market prices vary. Among them, "Songbei" is mainly derived from dark purple Fritillaria, and its market price is the highest among Fritillaria chuanxiong medicinal materials, which can reach 5,000 yuan / kg in recent years; "Qingbei" is mainly derived from Fritillaria cirrhosa, "Lubei" is mainly derived from Fritillaria thunbergii, and "cultivated products" are mainly the dried bulbs of Fritillaria wabuensis and Fritillaria taibaiensis. Due to the increase in clinical demand in recent years, excessive mining and long growth cycle of the original plant, the resources of Fritillaria cirrhosa are on the verge of scarcity. There is a phenomenon of "cultivated products", "lubei" and even other counterfeit products impersonating "songbei" or "qingbei" in the market, which directly affects the efficacy of medicinal materials, the safety of medication and the economic interests of consumers. Therefore, in view of the confusion of the origin of Fritillaria cirrhosa in the market circulation, it is of great significance to develop an efficient and simple method for the identification of the origin species for clinical medication, quality control and the rational development and utilization of Fritillaria resources.

[0003] Molecular marker technology is a genetic marker based on the variation of species nucleotide sequences. It can directly reflect the genetic diversity of species at the DNA level and is widely used in the construction of genetic diversity and genetic maps, variety identification, gene fine positioning, molecular marker-assisted breeding and other research. At present, some scholars have used random amplified polymorphic DNA markers (RAPD), simple sequence repeat interval diversity (ISSR), restriction fragment length polymorphism (RFLP), amplified fragment length polymorphism (AFLP), and related sequence amplification polymorphism (SRAP) to identify Fritillaria cirrhosa and its mixed products. The results show that the use of related molecular marker technology can better separate Fritillaria cirrhosa from Fritillaria thunbergii and Fritillaria irifolium, but it is not effective in distinguishing the six original plants under Fritillaria cirrhosa at the same time. Single nucleotide polymorphism (SNP) and insertion and deletion (InDel) markers are the third generation of single nucleotide markers developed in recent years. They have the advantages of wide distribution in the genome, high density, large number, good repeatability, and accurate and reliable results. However, existing studies are limited to designing markers based on chloroplast genome sequence differences, such as patent CN118440943 B, and there are no reports on transcriptome analysis of alkaloid synthesis pathways using SNP markers and InDel markers. SNP / InDel markers can be used to screen enzyme genes closely related to steroidal alkaloid synthesis through transcriptome data analysis. Therefore, using SNP molecular markers of the transcriptome of the alkaloid synthesis pathway of Fritillaria cirrhosa to identify the origin of Fritillaria cirrhosa is more conducive to the quality control of Fritillaria cirrhosa. However, there are currently no reports on the identification of the origin of Fritillaria cirrhosa based on SNP molecular markers of genes related to steroidal alkaloid synthesis of Fritillaria cirrhosa. Summary of the invention

[0004] The object of the present invention is to provide a kit for identifying Fritillaria cirrhosa, which comprises reagents for detecting any one or more of the SNP sites of RPL17 gene segment 1855②, CKX3 gene segment 1642①, CKX3 gene segment 1642③, and ILA gene segment 14943③ of Fritillaria cirrhosa; The nucleotide sequence of the RPL17 gene fragment 1855② is shown in SEQ NO:19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ NO:20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ NO:21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ NO:22.

[0005] Furthermore, the SNP site is located at position 228 in the RPL17 gene fragment 1855②, and its polymorphism is T / C; located at position 122 in the CKX3 gene fragment 1642①, and its polymorphism is A / G; located at position 112 in the CKX3 gene fragment 1642③, and its polymorphism is T / G; located at position 213 in the ILA gene fragment 14943③, and its polymorphism is G / A.

[0006] Furthermore, the reagents are reagents for sequencing, reagents for the KASP method or reagents for the restriction fragment length polymorphism method.

[0007] Furthermore, the KASP method reagents include any one or more of the following KASP primer sets: A KASP primer set for detecting the 1855②SNP site of the RPL17 gene segment, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9; A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; A KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13-15; The KASP primer set for detecting the ILA gene fragment 14943③ SNP site has a nucleotide sequence shown in SEQ ID NOs. 16-18.

[0008] Further, it also includes reagents for amplifying the sequence of the RPL17 gene fragment, the CKX3 gene fragment and / or the ILA gene fragment; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ NOs: 1-2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 3-4; and the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 5-6.

[0009] The present invention also provides a use of the above-mentioned kit in identifying Fritillaria cirrhosa.

[0010] The present invention finally provides a method for identifying Fritillaria cirrhosae, comprising the following steps: (1) Extracting total genomic DNA from Fritillaria cirrhosa samples; (2) Detect the 228th SNP site in the RPL17 gene segment 1855②, the 122nd SNP site in the CKX3 gene segment 1642①, the 112th SNP site in the CKX3 gene segment 1642③, and the 213th SNP site in the ILA gene segment 14943③, and analyze them; The nucleotide sequence of the RPL17 gene fragment 1855② is shown in SEQ NO:19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ NO:20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ NO:21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ NO:22.

[0011] Furthermore, the detection steps in step (2) are as follows: Using the total genomic DNA extracted in step (1) as a template, using an amplification reagent to perform PCR amplification to obtain an amplification product; taking the amplification product and using a reagent to detect it using the KASP method, and determining the origin of Fritillaria cirrhosa based on the fluorescence result; The amplification reagents include reagents for amplifying RPL17 gene fragments, CKX3 gene fragments and / or ILA gene fragment sequences; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ NOs: 1-2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 3-4; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 5-6; In the amplified product, the RPL17 gene fragment sequence is 296 bp long, the CKX3 gene fragment sequence is 369 bp long, and the ILA gene fragment sequence is 294 bp long; The KASP method reagents include any one or more of the following KASP primer sets: A KASP primer set for detecting the 1855②SNP site of the RPL17 gene segment, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9; A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; A KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13 to 15; The KASP primer set for detecting the 14943③ SNP site of the ILA gene fragment has a nucleotide sequence as shown in SEQ ID NOs. 16-18.

[0012] Furthermore, when amplification was performed using the KASP primer set that detects the SNP site 1855② of the RPL17 gene segment, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosae was Fritillaria wabuensis; When amplification was performed using the KASP primer set that detected the SNP site at 1855② of the RPL17 gene segment, red fluorescence was produced, and when amplification was performed using the KASP primer set that detected the SNP site at 1642① of the CKX3 gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosae is Fritillaria taibaiensis. When the KASP primers for detecting the 1855②SNP site of the RPL17 gene segment and the KASP primers for detecting the 1642①SNP site of the CKX3 gene segment were used for amplification, red fluorescence was produced, indicating that the origin of Fritillaria cirrhosa was Fritillaria thunbergii. When the KASP primers for detecting the 1855②SNP site of the RPL17 gene segment and the KASP primers for detecting the 1642③SNP site of the CKX3 gene segment were used for amplification, both produced green fluorescence, indicating that the origin of Sichuan Fritillaria is Gansu Fritillaria; When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene segment, green fluorescence was generated; when amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene segment, red fluorescence was generated; when amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene segment, blue fluorescence was generated. The origin of Sichuan Fritillaria is dark purple Fritillaria; When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene fragment, green fluorescence was produced. When amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene fragment, red fluorescence was produced. When amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene fragment, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.

[0013] Furthermore, the genotype of the SNP site at position 228 of the RPL17 gene segment 1855② of the Fritillaria wabuensis is TT; The genotype of Taibai Fritillaria at position 228 of RPL17 gene segment 1855② is CC, and the genotype of CKX3 gene segment 1642① at position 122 is AA; The genotype of Fritillaria thunbergii at position 228 of the RPL17 gene segment 1855② is CC, and the genotype of the 122nd position of the CKX3 gene segment 1642① is GG; The genotype of Gansu Fritillaria at position 228 of RPL17 gene segment 1855② is TC, and the genotype of CKX3 gene segment 1642③ is TG; The genotype of dark purple Fritillaria at position 228 of RPL17 gene segment 1855② is TC, the genotype of CKX3 gene segment 1642③ is GG, and the genotype of ILA gene segment 14943③ is GG; The genotype of Fritillaria cirrhosa at position 228 in the RPL17 gene segment 1855② is TC, the genotype of the genotype of the CKX3 gene segment 1642③ is GG, and the genotype of the genotype of the genotype of the genotype of the genotype of the genotype of the genotype of the DNA segment 14943③ is GA.

[0014] The "KASP method" described in the present invention utilizes allele-specific primers for PCR amplification and realizes genotyping through fluorescence signal detection. It is a genotyping technology based on single nucleotide polymorphism (SNP), and is mainly used to detect SNP and insertion / deletion polymorphism (InDel) in the genome.

[0015] The present invention designs SNP / InDel markers based on the RPL17 (1855), CKX3 (1642), and ILA (14943) gene sequences in the synthesis pathway of steroidal alkaloids of Fritillaria cirrhosa, and uses SNP / InDel markers to identify the original plant of Fritillaria cirrhosa, providing a reference for the identification of the traditional Chinese medicine Fritillaria cirrhosa at the molecular level, and also providing a theoretical basis for the germplasm utilization and protection of Fritillaria cirrhosa plants.

[0016] The key point of the present invention is the discovery of the relationship between a SNP site on a sequence in the RPL17 gene, a gene of the steroidal alkaloid synthesis pathway of Fritillaria cirrhosa, two SNP sites on a sequence in the CKX3 gene, and a SNP site on a sequence in the ILA gene and the origin of Fritillaria cirrhosa. On this basis, the origin of Fritillaria cirrhosa can be identified by any reagent or equipment that detects the bases of any one or more of the above-mentioned SNP sites.

[0017] Specifically, the embodiment of the present invention provides an example of using KASP technology to detect SNP sites. The primers for amplifying gene fragments of the present invention have good specificity. When using them for PCR, non-specific amplification with DNA fragments other than the target is not generated; the target gene is amplified through KASP primers and KASP probes with good specificity, which achieves high specificity and high sensitivity detection of SNP / InDel sites, and can quickly and accurately identify the origin of Fritillaria cirrhosa. The present invention also provides a segment of RPL17 gene sequence, two segments of CKX3 gene sequence, and one segment of ILA gene sequence, which can assist in determining the location of Fritillaria cirrhosa-specific SNP sites in these gene fragments, and facilitate the determination of the genotype of the SNP site.

[0018] Obviously, according to the above contents of the present invention, in accordance with common technical knowledge and customary means in the art, without departing from the above basic technical ideas of the present invention, other various forms of modification, replacement or change may be made.

[0019] The above contents of the present invention are further described in detail below through specific implementation methods in the form of embodiments. However, this should not be understood as the scope of the above subject matter of the present invention being limited to the following examples. All technologies realized based on the above contents of the present invention belong to the scope of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1 is a diagram of the RPL17 (1855) PCR product; Figure 2 is a diagram of the ILA (14943) PCR product; Figure 3 is a diagram of the CKX3 (1642) PCR product; Figure 4 is a diagram of the Sanger sequencing validation results of RPL17 (1855); Figure 5 This is a diagram of the Sanger sequencing validation results of ILA (14943); Figure 6 is a diagram of the Sanger sequencing validation results of CKX3 (1642); Figure 7 is a graph of KASP typing results (a: the result of detection using the KASP primer set for SNP typing of the RPL17 gene segment, b: the result of detection using the first group of KASP primers for SNP typing of the CKX3 gene segment; c: the result of detection using the second group of KASP primers for SNP typing of the CKX3 gene segment; d: the result of detection using the KASP primer set for SNP typing of the ILA gene segment); Figure 8 This is a diagram showing the differences between the six types of Fritillaria cirrhosa; Fig. 9 This is a diagram of the Sanger sequencing verification results of RPL17 (1855②); Fig.10 This is a diagram of the Sanger sequencing verification results of the CKX3 gene (1642①); Fig.11 This is a diagram of the Sanger sequencing verification results of the CKX3 gene (1642③); Fig.12 This is a diagram of the Sanger sequencing verification results of the ILA gene fragment (14943③). DETAILED DESCRIPTION

[0021] In order to more clearly understand the present invention, the present invention will be further described with reference to the following examples and drawings.

[0022] The experimental methods without specific conditions in the examples are conventional methods and conventional conditions well known in the art, or according to the conditions recommended by the manufacturer; the various chemical reagents used in the examples are commercially available, and the primers used are commissioned for synthesis.

[0023] Example 1 Kit for identifying Fritillaria cirrhosae of the present invention The components of the kit of the present invention include: (1) PCR amplification reagents: including primers for gene fragment amplification; The primers used for gene fragment amplification are: (2) Reagents for the KASP method: including KASP primer sets for SNP typing; KASP primer set for SNP typing: Note: The underlined sequences in SEQ ID NO.7, SEQ ID NO.10, SEQ ID NO.13 and SEQ ID NO.16 are FAM tag sequences; the underlined sequences in SEQ ID NO.8, SEQ ID NO.11, SEQ ID NO.14 and SEQ ID NO.17 are HEX tag sequences.

[0024] Example 2 Method for identifying Fritillaria cirrhosae of the present invention a) Using a plant genomic DNA extraction kit, extracting the total genomic DNA from the dried bulbs of Fritillaria cirrhosa; b) using the total genomic DNA obtained in step a) as a template, and using the primers for gene fragment amplification in the kit of Example 1 to perform PCR reactions respectively, the reaction system is 25 μL, pre-denaturation at 95°C for 4 min, one cycle; denaturation at 95°C for 30 s; annealing at 55-58°C for 30 s, 35 cycles; extension at 72°C for 1 min; final extension at 72°C for 5 min, one cycle; c) The PCR products obtained in step b) were subjected to 1.5% agarose gel electrophoresis, and bright bands of 296 bp, 369 bp, and 294 bp were observed respectively; d) recovering and purifying the band obtained in step c), and then detecting it with the SNP typing KASP primer set in the kit of Example 1, and determining the origin of Fritillaria cirrhosa based on the fluorescence result; The results are as follows: When the KASP primer set shown in SEQ ID NO. 7-9 was used to perform PCR amplification on the 296 bp band, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosae was Fritillaria wabuensis; When the KASP primer set shown in SEQ ID NO.7-9 was used to perform PCR amplification on the 296 bp band, red fluorescence was generated; when the KASP primer set shown in SEQ ID NO.10-12 was used to perform PCR amplification on the 369 bp band, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosae is Fritillaria taibaiensis. When the KASP primer set shown in SEQ ID NO.7-9 was used to perform PCR amplification on the 296 bp band; when the KASP primer set shown in SEQ ID NO.10-12 was used to perform PCR amplification on the 369 bp band, red fluorescence was generated, indicating that the origin of Fritillaria cirrhosae was Fritillaria thunbergii. When the KASP primer set shown in SEQ ID NO.7-9 was used to perform PCR amplification on the 296 bp band; when the KASP primer set shown in SEQ ID NO.13-15 was used to perform PCR amplification on the 369 bp band, green fluorescence was produced, indicating that the origin of Fritillaria cirrhosa was Fritillaria gansuensis. When the KASP primer set shown in SEQ ID NO.7-9 was used to PCR amplify the 296bp band, green fluorescence was generated; when the KASP primer set shown in SEQ ID NO.13-15 was used to PCR amplify the 369bp band, red fluorescence was generated; when the KASP primer set shown in SEQ ID NO.16-18 was used to PCR amplify the 294bp band, blue fluorescence was generated. The origin of Sichuan Fritillaria is dark purple Fritillaria; When the KASP primer set shown in SEQ ID NOs. 7 to 9 was used to perform PCR amplification on the 296 bp band, green fluorescence was generated, and when the KASP primer set shown in SEQ ID NOs. 13 to 15 was used to perform PCR amplification on the 369 bp band, red fluorescence was generated; when the KASP primer set shown in SEQ ID NOs. 16 to 18 was used to perform PCR amplification on the 294 bp band, green fluorescence was generated, and the origin of Fritillaria cirrhosa is Fritillaria curlifolia.

[0025] The beneficial effects of the present invention are further illustrated by test examples below: Test Example 1, Identification of Fritillaria cirrhosae of the present invention 1. Experimental Methods 1. Obtaining gene fragments for identification of Fritillaria cirrhosa 100 mg of dried bulbs of 6 species of Fritillaria (Fritillaria wabuensis, Fritillaria gansuensis, Fritillaria purpurae, Fritillaria curlifolia, Fritillaria taibaiensis and Fritillaria thunbergii) were collected and washed with 75% alcohol and then with sterile water. After the samples were wiped dry, they were put into a mortar precooled with liquid nitrogen and ground into extremely fine powder while adding liquid nitrogen. According to the instructions of the plant genomic DNA extraction kit, the DNA of each Fritillaria sample was extracted, and the DNA concentration of the extracted samples was detected using a multi-function microplate reader (Bio-Tek, USA).

[0026] The extracted genomic DNA was used as a template and PCR amplification was performed using the following three pairs of primers: Primer ①: 1855-F (SEQ NO: 1): AAGCTCGCCACTCAAATGGT 1855-R (SEQ NO:2):ACTCACGGTTGATTCGCCC Primer ②: 1642-F (SEQ NO: 3): GAGGAGAGTCTGAGGAGGCAAGG 1642-R (SEQ NO:4):TCTGCTGAAGGAGTGCGTCTAGG Primer ③: 14943-F (SEQ NO: 5): TCGTTGGCGTTACTGGTTCCTATTG 14943-R (SEQ NO: 6): CCTCACTTAATCCTTGGGCAGCAC.

[0027] The reaction system for PCR amplification was: 1 μL 50 ng / μL DNA, 12.5 μL Mix (PCR HeroTM (With Dye): 2× Fast and Efficient PCR Reaction Premix System (With Dye) from Chengdu Fuji Biotechnology Co., Ltd.), 10.5 μL ddHO 2 O and 0.5 μL of forward and reverse primers for a total volume of 25 μL.

[0028] PCR reaction parameters: The PCR products were detected by 1.5% agarose gel electrophoresis, and the results were observed in a gel imager. The clear and bright bands without tailing were selected ( Figures 1 to 3 ), an agarose gel recovery kit (Beijing Tiangen Biochemical Technology Co., Ltd.) was used for recovery and purification, and the purified target fragment was sent to Sangon Biotechnology (Shanghai) Co., Ltd. for sequencing.

[0029] The sequenced nucleotide sequences were compared with those in GenBank ( Figures 4 to 6 ), confirming that the target fragment amplified by primer ① is a segment of the RPL17 gene encoding the L17 protein in the 60S ribosomal large subunit, totaling 296 bp; the target fragment amplified by primer ② is a segment of the CKX3 gene encoding cytokinin oxidase / dehydrogenase 3, totaling 369 bp; the target fragment amplified by primer ③ is a segment of the ILA gene encoding the ILITYHIA protein, totaling 294 bp.

[0030] 2. SNP typing Referring to the instructions for use of the AQP genotyping system, the KASP primer set was used to detect the fragments in the RPL17 gene, CKX3 gene, and ILA gene, and SNP typing was achieved based on the fluorescence results.

[0031] KASP primer set for SNP typing of RPL17 gene segment: There are two sets of KASP primers for SNP typing of CKX3 gene fragments, namely: The KASP primer set used for SNP typing of ILA gene fragment is: The reaction system is: 4-50 ng DNA, primer mix (upstream typing primer 1, upstream typing primer 2 and shared downstream primer mixed): 0.14 μL (primer mix volume can be excluded from the PCR system), HiGeno2×Probe Mix A (Jiacheng KASP reagent): 5 μL, ddH 2 O: Make up to 10 μL.

[0032] PCR reaction parameters: The fluorescence data was read using a qPCR instrument, and KASP typing was performed on the fragments amplified by the KASP primer set according to the distribution of fluorescence signals. The results are shown in Figure 7 a~ Figure 7 d. Schematic diagram of the differentiation of KASP typing results Figure 8 .from Figure 7~Figure 8 It can be seen that when the KASP primer set for SNP typing of the RPL17 gene segment was used for detection, blue fluorescence was produced, and the origin of Fritillaria cirrhosa was Fritillaria wabuensis; When the KASP primer set for SNP typing of the RPL17 gene segment was used for detection, red fluorescence was generated; when the KASP primer set 1 for SNP typing of the CKX3 gene segment was used for detection, blue fluorescence was generated. The origin of Fritillaria cirrhosae is Fritillaria taibaiensis. When the KASP primer set for SNP typing of RPL17 gene segment and the first group of KASP primer set for SNP typing of CKX3 gene segment were used for detection, both produced red fluorescence, indicating that the origin of Fritillaria cirrhosae was Fritillaria thunbergii. When the KASP primer set for SNP typing of RPL17 gene segment and the second KASP primer set for SNP typing of CKX3 gene segment were used for detection, both produced green fluorescence, indicating that the origin of Fritillaria cirrhosae was Fritillaria gansuensis. When the KASP primer set for SNP typing of the RPL17 gene segment was used for detection, green fluorescence was generated; when the KASP primer set for SNP typing of the CKX3 gene segment was used for detection, red fluorescence was generated; when the KASP primer set for SNP typing of the ILA gene segment was used for detection, blue fluorescence was generated. The origin of Sichuan Fritillaria is dark purple Fritillaria; When the KASP primer set for SNP typing of the RPL17 gene segment was used for detection, green fluorescence was generated, and when the second set of KASP primer set for SNP typing of the CKX3 gene segment was used for detection, red fluorescence was generated; when the KASP primer set for SNP typing of the ILA gene segment was used for detection, green fluorescence was generated. The origin of Fritillaria cirrhosa is Fritillaria curlifolia.

[0033] The fragments obtained by KASP detection were subjected to Sanger sequencing to verify the accuracy of the KASP typing results. The results are shown in Figures 9 to 12 .from Figures 9 to 12 It can be seen that when performing SNP typing on the RPL17 gene fragment, the DNA fragment (No. 1855②) amplified using the KASP primer set has a SNP site at position 228, and its polymorphism is T / C, and the corresponding polymorphism on the complementary strand is A / G; the nucleotide sequence of the single strand is as follows (SEQ NO: 19): GGGGAGGTCTGACGCTTTGCTTCTGAGCCTGATTCACTTGAATATGAGATATAGTAGAGGGCATCAACATCCAAGCCTTTCATCTAACAAAAAGAAGCCAACCAAGATTCACTTAAACATGAGATATGTAGAGGGCGTCAACATCCGAA ACAATCTAAATACAAGCCAAACATAAATAATAACAAAGGACATACATCAGCATTACTCTCAGCATTCTTTAGCAAATCT / CAGAATGAACTTTGCAGACTTCATAGGCCAGCGACCCTGACCATTTGAGTGGCGAGCTTAAAAGAAGGC When performing SNP typing on the CKX3 gene fragment, the DNA fragment (No. 1642①) amplified using the first set of KASP primers had a SNP site at position 122, and its polymorphism was A / G, as shown below (SEQ NO: 20): CCCGTAGCATGCTATCCATGGCTGACTTGTTTGTGCCCAGGGTTCAAATAGGGAGGTTCAAAGACCTCCTCCTTCGAACAATCTCAGCAGAGGCCTTTGGTGGGACGATCATAATATACCCA / GACTTTCATGCAGACGTACGCTGTCCTGCGCACAGGCTTTGTTTTTCTTCAAATTGACTTTT AAATGTATTTGCTAAAATCTAAAGGATGAAGTAGTCTAATATATAAACTTCACCTTCCAGATGGGATCCAAAAATGTCTAGCGTGCTGCCACAAGATGATTCTGGTCATGGTATCATGTATGTCGCAAGTGTTCTACGTGCCGCCCCATTGTTCTGCACAAGCGGCGCACCGTGCCTAGACGCCCC When performing SNP typing on the CKX3 gene fragment, a SNP site was found at position 112 of the DNA fragment (No. 1642③) amplified using the second set of KASP primers, and its polymorphism was T / G, as shown below (SEQ NO: 21): TCCCCCCCCCGCCTTCACTCATCGTATCTGCTAGTTTGTGCCCAGGGTTCAAATAGGGAGGTTCAAAGACCTCCTCCTTCTTACAATCTCAGCAGAGGCCTTTTGGTGGGACT / GATCATAATATACCCGACTTTCATGCAGACGTACGCTGTCCTGCGCACAGGCTTTGTTTTTCTTCAAATTGACTTTTAAAT ATAATTGCTCAAATCTAAAGGATGAAGTAGTCTAATATATAAACTTCACCTTTCAGATGGGATCCAAAAATGTCTAGCGTGCTGCCACAAGATGATTCTGGTCATGGTATCATGTATGTCGCAAGTGTTCTACGTGCCGCCCCATTGTCCTGCACAAGCGGCACACCGTGCCTAGACGCACTCCTTTCAGCAGAA When performing SNP typing on the ILA gene fragment, the DNA fragment (No. 14943③) amplified using the KASP primer set contained a SNP site at position 213, and its polymorphism was G / A, as shown below (SEQ NO: 22): ACAGAGAAGAGAGAGGAGTGCTGATACTAAATAGAAGCATGCTC.AATTGTTGGAAATATGTGCTCTTTAGTAACAGAACCGAAGGATATGATTCCATATATTGAGTTGCTACTTCCTGAAGTAAAGAAGGCCCTTGTAGACCCAATT CCCGAAGTTCGTTCTGTTGCAGCATGAGCTCTTGGGTCTCTTATCAAAGGAATGGGTGAAGAGCG / AATTTCCAGATCTTGTCTCATGGTTACTTGATACACTTAAGTCTGACAACAGTAACGTCGAGAGATCTGGTGCTGCCCAAGA Combining the KASP typing results with the Sanger sequencing verification results, it can be seen that by detecting the SNP sites of RPL17 gene fragment 1855②, CKX3 gene fragment 1642①, CKX3 gene fragment 1642③ and ILA gene fragment 14943③ and determining the genotypes of these sites, the origin of Fritillaria cirrhosa can be accurately identified. Among them, the genotype of the SNP site at position 228 of RPL17 gene fragment 1855② (SEQ NO:19) is TT, and the origin of Fritillaria cirrhosa is Fritillaria wabuensis; The genotype at position 228 of the RPL17 gene segment 1855② (SEQ NO: 19) is CC, the genotype at position 122 of the CKX3 gene segment 1642① (SEQ NO: 20) is AA, and the origin of Fritillaria cirrhosa is Fritillaria taibaiensis; The genotype at position 228 of the RPL17 gene segment 1855② (SEQ NO: 19) is CC, the genotype at position 122 of the CKX3 gene segment 1642① (SEQ NO: 20) is GG, and the origin of Fritillaria cirrhosa is Fritillaria thunbergii. The genotype at position 228 of the RPL17 gene segment 1855② (SEQ NO: 19) was TC, and the genotype at position 112 of the CKX3 gene segment 1642③ (SEQ NO: 21) was TG, Fritillaria gansuensis; The genotype at position 228 of the RPL17 gene segment 1855② (SEQ NO: 19) is TC, the genotype at position 112 of the CKX3 gene segment 1642③ (SEQ NO: 21) is GG, the genotype at position 213 of the ILA gene segment 14943③ (SEQ NO: 21) is GG, and the origin of Fritillaria cirrhosa is Fritillaria thunbergii; The genotype at position 228 of RPL17 gene fragment 1855② (SEQ NO: 19) is TC, the genotype at position 112 of CKX3 gene fragment 1642③ (SEQ NO: 21) is GG, the genotype at position 213 in the sequence of DNA fragment 14943③ (SEQ NO: 21) is GA, and the origin of Fritillaria cirrhosa is Fritillaria thunbergii.

[0034] In summary, the present invention discovered the relationship between a SNP site on a sequence in the RPL17 gene, a gene of the steroidal alkaloid synthesis pathway of Fritillaria cirrhosa, two SNP sites on a sequence in the CKX3 gene, and a SNP site on a sequence in the ILA gene and the origin of Fritillaria cirrhosa. On this basis, the origin of Fritillaria cirrhosa can be identified by any reagent or equipment that detects the bases of any one or more of the above SNP sites.

Claims

1. A kit for identifying Fritillaria cirrhosa, characterized in that: The method comprises a reagent for detecting any one or more of the SNP sites of the RPL17 gene segment 1855②, the CKX3 gene segment 1642①, the CKX3 gene segment 1642③, and the ILA gene segment 14943③ of Fritillaria cirrhosa; The nucleotide sequence of the RPL17 gene fragment 1855② is shown in SEQ NO:19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ NO:20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ NO:21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ NO:

22.

2. The kit according to claim 1, characterized in that: The SNP site is located at position 228 in the RPL17 gene fragment 1855②, and its polymorphism is T / C; located at position 122 in the CKX3 gene fragment 1642①, and its polymorphism is A / G; located at position 112 in the CKX3 gene fragment 1642③, and its polymorphism is T / G; located at position 213 in the ILA gene fragment 14943③, and its polymorphism is G / A.

3. The kit according to claim 1, characterized in that The reagents are: reagents for sequencing, reagents for the KASP method or reagents for the restriction fragment length polymorphism method.

4. The kit according to claim 3, characterized in that The KASP method reagents include any one or more of the following KASP primer sets: A KASP primer set for detecting the 1855②SNP site of the RPL17 gene segment, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9; A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; A KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13-15; The KASP primer set for detecting the ILA gene fragment 14943③ SNP site has a nucleotide sequence shown in SEQ ID NOs. 16-18.

5. The kit according to claim 1, characterized in that It also includes reagents for amplifying the sequence of the RPL17 gene fragment, the CKX3 gene fragment and / or the ILA gene fragment; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ NOs: 1-2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 3-4; and the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 5-6.

6. Use of the kit according to any one of claims 1 to 5 in identifying Fritillaria cirrhosa.

7. A method for identifying Fritillaria cirrhosa, characterized in that: The steps include: (1) Extracting total genomic DNA from Fritillaria cirrhosa samples; (2) Detect the 228th SNP site in the RPL17 gene segment 1855②, the 122nd SNP site in the CKX3 gene segment 1642①, the 112th SNP site in the CKX3 gene segment 1642③, and the 213th SNP site in the ILA gene segment 14943③, and analyze them; The nucleotide sequence of the RPL17 gene fragment 1855② is shown in SEQ NO:19; The nucleotide sequence of the CKX3 gene fragment 1642① is shown in SEQ NO:20; The nucleotide sequence of the CKX3 gene fragment 1642③ is shown in SEQ NO:21; The nucleotide sequence of the ILA gene fragment 14943③ is shown in SEQ NO:

22.

8. The method according to claim 7, characterized in that Steps of the detection described in step (2) as follows: Using the total genomic DNA extracted in step (1) as a template, using an amplification reagent to perform PCR amplification to obtain an amplification product; taking the amplification product and using a reagent to detect it using the KASP method, and determining the origin of Fritillaria cirrhosa based on the fluorescence result; The amplification reagents include reagents for amplifying RPL17 gene fragments, CKX3 gene fragments and / or ILA gene fragment sequences; The reagents for amplifying the RPL17 gene fragment sequence include the primer pairs shown in SEQ NOs: 1-2; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 3-4; the reagents for amplifying the CKX3 gene fragment sequence include the primer pairs shown in SEQ NOs: 5-6; In the amplified product, the RPL17 gene fragment sequence is 296 bp long, the CKX3 gene fragment sequence is 369 bp long, and the ILA gene fragment sequence is 294 bp long; The KASP method reagents include any one or more of the following KASP primer sets: A KASP primer set for detecting the 1855②SNP site of the RPL17 gene segment, the nucleotide sequences of which are shown in SEQ ID NOs. 7 to 9; A KASP primer set for detecting the CKX3 gene segment 1642① SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 10-12; A KASP primer set for detecting the CKX3 gene segment 1642③ SNP site, the nucleotide sequences of which are shown in SEQ ID NOs. 13 to 15; The KASP primer set for detecting the 14943③ SNP site of the ILA gene fragment has a nucleotide sequence as shown in SEQ ID NOs. 16-18.

9. The method according to claim 8, characterized in that When the KASP primer set for detecting the SNP site 1855② of the RPL17 gene segment was used for amplification, blue fluorescence was generated, indicating that the origin of Fritillaria cirrhosae was Fritillaria wabuensis. When amplification was performed using the KASP primer set that detected the SNP site at 1855② of the RPL17 gene segment, red fluorescence was produced, and when amplification was performed using the KASP primer set that detected the SNP site at 1642① of the CKX3 gene segment, blue fluorescence was produced. The origin of Fritillaria cirrhosae is Fritillaria taibaiensis. When the KASP primers for detecting the 1855②SNP site of the RPL17 gene segment and the KASP primers for detecting the 1642①SNP site of the CKX3 gene segment were used for amplification, red fluorescence was produced, indicating that the origin of Fritillaria cirrhosa was Fritillaria thunbergii. When the KASP primers for detecting the 1855②SNP site of the RPL17 gene segment and the KASP primers for detecting the 1642③SNP site of the CKX3 gene segment were used for amplification, both produced green fluorescence, indicating that the origin of Sichuan Fritillaria is Gansu Fritillaria; When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene segment, green fluorescence was generated; when amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene segment, red fluorescence was generated; when amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene segment, blue fluorescence was generated. The origin of Sichuan Fritillaria is dark purple Fritillaria; When amplification was performed using the KASP primer set that detected the 1855②SNP site of the RPL17 gene fragment, green fluorescence was produced. When amplification was performed using the KASP primer set that detected the 1642③SNP site of the CKX3 gene fragment, red fluorescence was produced. When amplification was performed using the KASP primer set that detected the 14943③SNP site of the ILA gene fragment, green fluorescence was produced. The origin of Fritillaria cirrhosa is Fritillaria thunbergii.

10. The method according to claim 9, characterized in that The genotype of the SNP site at position 228 of the RPL17 gene segment 1855② of the Fritillaria wabuensis is TT; The genotype of Taibai Fritillaria at position 228 of RPL17 gene segment 1855② is CC, and the genotype of CKX3 gene segment 1642① at position 122 is AA; The genotype of Fritillaria thunbergii at position 228 of the RPL17 gene segment 1855② is CC, and the genotype of the 122nd position of the CKX3 gene segment 1642① is GG; The genotype of Gansu Fritillaria at position 228 of RPL17 gene segment 1855② is TC, and the genotype of CKX3 gene segment 1642③ is TG; The genotype of dark purple Fritillaria at position 228 of RPL17 gene segment 1855② is TC, the genotype of CKX3 gene segment 1642③ is GG, and the genotype of ILA gene segment 14943③ is GG; The genotype of Fritillaria cirrhosa at position 228 in the RPL17 gene segment 1855② is TC, the genotype of the genotype of the CKX3 gene segment 1642③ is GG, and the genotype of the genotype of the genotype of the genotype of the genotype of the genotype of the genotype of the DNA segment 14943③ is GA.

Citation Information

Patent Citations

  • Method for identifying Fritillaria cirrhosa, Fritillaria cirrhosa and Fritillaria pallidiflora

    CN114457188A

  • SNP marker for identifying bulbus fritillariae cirrhosae medicinal material base stock and application thereof

    CN118547095A

  • SNP (Single Nucleotide Polymorphism) molecular marker for identifying species of fritillaria wangsiensis and application thereof

    CN119799969A