Dual microfluidic fluorescent PCR (polymerase chain reaction) detection kit for avian influenza virus H3N2 subtype

Abstract

The invention relates to the technical field of virus detection, and particularly discloses an avian influenza virus H3N2 subtype dual microfluidic fluorescent PCR detection kit which comprises a sample lysis extracting solution, a sample washing solution I, a sample washing solution II and a reaction premixed solution which are used for detecting an H3N2 subtype avian influenza virus, the reaction premixed liquid contains three groups of specific sequence combinations: an H3 specific sequence combination, an N2 specific sequence combination and an endogenous reference gene specific sequence combination. According to the application, the specific primers and probes are designed, optimized and screened, so that the H3 subtype AIV and the N2 subtype AIV can be simultaneously identified in one reaction, the amplification reactions of the two target genes have no interference, the specificity is strong, the sensitivity is high, the repeatability is good, the virus infection condition can be accurately diagnosed, and the application prospect is wide. The important application value is realized on the prevention and control of the avian influenza epidemic situation.

Description

Technical Field

[0001] The present application relates to the technical field of virus detection, and more specifically, to a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype. Background Art

[0002] Influenza virus belongs to the family of RNA viruses, Orthomyxoviridae, and is divided into three types: A, B, and C. Among them, influenza A virus is more common in poultry, and avian influenza virus (AIV) belongs to influenza A virus. Avian influenza virus can be divided into highly pathogenic avian influenza (H5, H7 subtypes) and low pathogenic avian influenza (H9 subtype) according to pathogenicity. Highly pathogenic avian influenza spreads quickly and has a high mortality rate. It is a type I animal epidemic disease and is also a type I epidemic disease stipulated by WOAH. Low pathogenic avian influenza is a type III animal epidemic disease. H3 subtype AIV belongs to low pathogenic avian influenza virus. Although its pathogenicity is low, its harm is long-lasting, it can exist in poultry for a long time, and the infection range is wide; N2 subtype AIV is a common NA subtype that infects poultry (H9N2) and can cause disease. Gene exchange often occurs between different subtypes of AIV. Due to the rapid mutation rate of AIV, traditional detection technology has limitations in the detection of mixed infection AIV, which also poses a great obstacle to the prevention and control of avian influenza.

[0003] Real-time fluorescence quantitative PCR (qPCR) is a technology developed from polymerase chain reaction (PCR). This technology is fast, sensitive, more specific, can be monitored in real time, and can be repeatedly and accurately quantified. Magnetic bead-mediated integrated polymerase amplification (MAOPA) technology integrates nucleic acid extraction and nucleic acid amplification, and has the characteristics of full-process closed, high sensitivity, strong stability, intelligent result output, and remote monitoring visualization. Combining real-time fluorescence quantitative PCR technology with MAOPA technology to develop an avian influenza virus microfluidic fluorescence PCR detection kit based on MAOPA technology can provide a more efficient detection method for the prevention and control of AIV. Based on the above statements, this application proposes a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype. Summary of the invention

[0004] In order to solve the problem that traditional detection technology has limitations in detecting mixed infection AIV, the present application provides a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype.

[0005] In a first aspect, the present application provides a dual microfluidic fluorescence PCR detection kit for H3N2 subtype avian influenza virus, comprising a sample lysis extract, a sample washing solution I, a sample washing solution II, and a reaction premix for detecting H3N2 subtype avian influenza virus.

[0006] Preferably, the sample lysis extraction solution has a volume of 1200 μL and includes the following components: guanidine hydrochloride, guanidine isothiocyanate, NaCl, isopropanol, Tween20, Triton-X10, EDTA and Tris-HCl.

[0007] Preferably, the sample lysis extract comprises the following components: 2M guanidine hydrochloride, 1M guanidine isothiocyanate, 0.5M NaCl, 30% isopropanol, 2% Tween20, 1% Triton-X10, 0.5mM EDTA, and 12mM Tris-HCl.

[0008] Preferably, the volume of the sample washing solution I is 150 μL, and comprises the following components: guanidine hydrochloride, Tris-HCl, EDTA, NaCl, Tween 20 and ethanol.

[0009] Preferably, the sample washing solution I comprises the following components: 1M guanidine hydrochloride, 10mM Tris-HCl, 1mM EDTA, 0.2M NaCl, 3% Tween20 and 50% ethanol.

[0010] Preferably, the volume of the sample washing solution II is 150 μL, and includes the following components: ethanol and Tween20.

[0011] Preferably, the sample washing solution II comprises the following components: 60% ethanol and 2% Tween20.

[0012] Preferably, the reaction premix has a volume of 40 μL, including an H3-specific sequence combination, an N2-specific sequence combination, an internal standard gene-specific sequence combination, an RNA-direct realtime PCR master mix, and an Mn 2+ .

[0013] Preferably, the H3-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: H3-F: AAAGACCAGAAGGCAGCTAAG (SEQ ID NO. 1); H3-R: TTGTTCAGTGCCTCATCTCG (SEQ ID NO. 2); H3-probe: TCCCGTTCCTAATTGATTCTATGCAGGC (SEQ ID NO. 3); The fluorescence reporter group of the H3-probe is FAM, and the fluorescence quencher group of the H3-probe is BHQ1.

[0014] Preferably, the N2-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: N2-F: GGCTTCACGTTTGTGTTACTG (SEQ ID NO.4); N2-R: GACGCATTCTGACTCCTGAG (SEQ ID NO.5); N2-probe: ACCCCATTATAAATGAAACTGGCGGTCG (SEQ ID NO. 6); The fluorescence reporter group of the N2-probe is VIC, and the fluorescence quencher group of the N2-probe is BHQ2.

[0015] Preferably, the internal standard gene-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: 18S-F: ACGGACAGGATTGACAGATTG (SEQ ID NO. 7); 18S-R: ACCAACTAAGAACGGCCATG (SEQ ID NO. 8); 18S-probe: CACCCACGGAATCGAGAAAGAGCTA (SEQ ID NO. 9); The fluorescence reporter group of the 18S-probe is ROX, and the fluorescence quencher group of the 18S-probe is BHQ3.

[0016] Preferably, the reaction premix includes H3-F 0.3 μM, H3-R 0.3 μM, H3-probe 0.2 μM, N2-F 0.3 μM, N2-R 0.3 μM, N2-probe 0.2 μM, 18S-F 0.3 μM, 18S-R 0.3 μM, 18S-probe 0.2 μM, 1× RNA-directrealtime PCR master mix and 2.5 mM Mn 2+ .

[0017] In the second aspect, the present application provides an integrated detection method of a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype, which specifically includes the following steps: S1, store the sample lysis extract in the first small chamber of the integrated detection reagent card (from top to bottom); store the sample washing solution I in the second small chamber of the integrated detection reagent card; store the sample washing solution II in the third small chamber of the integrated detection reagent card; store the reaction premix in the fourth small chamber of the integrated detection reagent card; S2. Add 600 μL of the sample to be tested and 10 μL of magnetic beads to the integrated detection reagent card, cover the card, and gradually carry out the following reactions in the integrated detection reagent card: (1) The sample to be tested is lysed, and the magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA; (2) The magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA for directional movement, and then wash to remove impurities, proteins, and other non-nucleic acid samples on the magnetic beads; (3) The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and the RNA is reverse transcribed into the corresponding cDNA under the action of reverse transcriptase, and a dual fluorescence quantitative PCR reaction is performed; (4) Analyze whether the sample is infected with the H3N2 subtype avian influenza virus based on the fluorescence curve.

[0018] In summary, this application has the following beneficial effects: 1. The present application realizes differential diagnosis of H3 subtype AIV and N2 subtype AIV in one reaction, which can not only confirm whether the patient is infected with avian influenza virus, but also reveal whether the patient is infected with single or double infection, which is more efficient and time-saving than single gene detection. The best designed specific primers and probes are designed through optimization and screening, which have the advantages of high sensitivity, strong specificity and good repeatability.

[0019] 2. The dual microfluidic fluorescence PCR detection kit for the H3N2 subtype of avian influenza virus of the present application does not produce obvious amplification curves for other subtypes of avian influenza viruses and common poultry pathogens (H5N1 subtype AIV, H4N5 subtype AIV, infectious bronchitis virus, Marek's virus, new goose plague virus, avian reovirus, duck parvovirus, duck astrovirus, avian adenovirus, goose parvovirus), indicating that the kit of the present application has strong specificity.

[0020] 3. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype of the present application uses the integrated nucleic acid detection technology of MAOPA. After extraction, the nucleic acid of the virus sample can all enter the reaction solution. Therefore, compared with conventional fluorescence PCR detection reagents, the analytical sensitivity is greatly improved. The detection limit of the kit of the present application for H3 subtype AIV and N2 subtype AIV is 10 copies / mL, which can detect trace amounts of virus in the early stage of infection, and can timely discover and control the epidemic.

[0021] 4. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype of the present application has good repeatability, and the coefficient of variation within and between groups is less than 5%.

[0022] 5. The dual microfluidic fluorescence PCR detection kit for the H3N2 subtype of avian influenza virus of the present application is used in combination with the MAOPA integrated detection technology to achieve a fully closed, pollution-free, integrated reaction, which minimizes the risk of cross-contamination of samples during the detection process, reduces the false positive rate, and greatly reduces labor costs, time costs, and the impact of human operational errors, effectively improving the accuracy of the test results. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 The specific detection results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype in Example 2. (1: H3 subtype AIV; 2: N2 subtype AIV; 3-12: other subtypes of AIV and common poultry pathogens; 13-24: internal standard genes).

[0024] Figure 2 The sensitivity test results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype in Example 3. (1-5: 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of H3 subtype AIV pseudovirus standard; 6-10: 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of N2 subtype AIV pseudovirus standard; 11-15: 1×10 3 copies / mL of internal standard gene pseudovirus standard).

[0025] Figure 3 The sensitivity test results of conventional RT-qPCR reagents for H3 and N2 subtype avian influenza viruses in Example 3. (Figure A: 1-5 is 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 Copies / mL of H3 subtype AIV pseudovirus standard; Figure B: 6-10 is 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×106 copies / mL of N2 subtype AIV pseudovirus standard). DETAILED DESCRIPTION

[0026] The present application is further described in detail below in conjunction with embodiments.

[0027] Example 1 1. Design of pathogen primers and probes The published HA gene sequences of H3 subtype avian influenza and NA gene of N2 subtype avian influenza were searched from Genbank, and the conserved regions were identified by multiple sequence alignment. According to the design principles of fluorescent quantitative PCR primers and probes, multiple pairs of primers and probes were designed. Through analysis and comparison, the primers and probes with the best detection effect were determined after screening, as shown in Table 1. The optimal primers were used to amplify the nucleic acid of H3 subtype and N2 subtype positive samples, and the amplified products were connected to the pET-32a-MS2 plasmid, and finally the H3 subtype AIV positive pseudovirus standard and the N2 subtype AIV positive pseudovirus standard were prepared.

[0028] Table 1

[0029] 2. Design of internal standard primers and probes 18S rRNA is a conserved sequence widely present in many species, distributed in different tissues and cells, and is quite conservative and stable. It is an ideal internal standard. 18S rRNA can also be detected in trace tissue samples clinically. Therefore, the published full-length 18S rRNA sequences of mammals and birds were searched from Genbank, and a conserved region was selected for primer and probe design through multiple sequence alignment analysis to determine a set of optimal combinations, as shown in Table 2. The optimal primers were amplified, and the amplified fragments were connected to the pET-32a-MS2 plasmid to prepare the internal standard gene positive pseudovirus standard.

[0030] Table 2

[0031] 3. Steps for using the test reagent card Open the lid of the detection reagent card, then open the sealing film, and add 10μL of magnetic beads, 20μL of internal standard gene pseudovirus standard, and 600μL of the sample to be tested in order, and beat with a pipette to mix well, and finally close the lid.

[0032] 4. Reaction system and reaction conditions The optimal reaction system was: H3-F 0.3μM, H3-R 0.3μM, H3-probe 0.2μM, N2-F 0.3μM, N2-R 0.3μM, N2-probe 0.2μM, 18S-F 0.3μM, 18S-R 0.3μM, 18S-probe 0.2μM, 1× RNA-direct realtimePCR master mix and 2.5mM Mn 2+ .

[0033] The optimal reaction conditions were: 90℃ 30s, 60℃ 20min, 95℃ 1min; 95℃ 15s, 60℃ 30s, 40 cycles.

[0034] 5. Result determination After the detection program is completed, the applicable instrument automatically reports the detection results of H3 subtype AIV (FAM), N2 subtype AIV (VIC), and internal standard gene (ROX).

[0035] If the results of H3 subtype AIV (FAM) and N2 subtype AIV (VIC) show an obvious S-shaped amplification curve (including an S curve with an obvious exponential phase but not reaching the plateau phase) and Ct≤38, it is judged as a corresponding positive result; the internal standard gene ROX fluorescence channel detection result should show an obvious S-shaped amplification curve (including an S curve with an obvious exponential phase but not reaching the plateau phase). If both fluorescence (FAM, VIC) show negative and the internal standard gene (ROX) Ct≤38, the experimental results are valid. Otherwise, re-sampling is required for testing.

[0036] Example 2 Specificity detection of avian influenza virus H3N2 subtype dual microfluidic fluorescence PCR detection kit.

[0037] Using H3 subtype AIV pseudovirus standard, N2 subtype AIV pseudovirus standard, H5N1 subtype AIV virus nucleic acid, H4N5 subtype AIV virus nucleic acid, infectious bronchitis virus nucleic acid, chicken Marek's virus nucleic acid, new goose plague virus nucleic acid, avian reovirus nucleic acid, duck parvovirus nucleic acid, duck astrovirus nucleic acid, avian adenovirus nucleic acid, goose parvovirus nucleic acid (corresponding to 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, and 12, respectively) as templates, and internal standard gene pseudovirus standards (internal standard genes 13-24 correspond to positive pathogen nucleic acids 1-12, respectively) are added to each reagent card as internal quality control, and fluorescent quantitative PCR amplification reaction is carried out according to the optimal reaction system and conditions described in Example 1.

[0038] Test results such as Figure 1As shown in the figure, the H3 subtype AIV pseudovirus standard and the N2 subtype AIV pseudovirus standard both have obvious amplification curves, and the internal standard gene pseudovirus standard also has obvious amplification curves, which means that the quality control of the reaction is good; while other subtype AIV and common poultry pathogen nucleic acid standards do not produce obvious amplification curves. This shows that the avian influenza virus H3N2 subtype dual microfluidic fluorescence PCR detection kit has high specificity.

[0039] Example 3 Comparison of sensitivity between dual microfluidic fluorescence PCR detection kit and conventional RT-qPCR reagents for avian influenza virus H3N2 subtype.

[0040] The H3 subtype AIV pseudovirus standard was diluted in 10-fold gradient (concentration of 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 copies / mL, corresponding to 1-5, respectively), N2 subtype AIV pseudovirus standard diluted 10 times (concentration 1×10 1 copies / mL, 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 copies / mL, 1×10 6 copies / mL, corresponding to 6-10) and a concentration of 1×10 3 The internal standard gene pseudovirus standard (corresponding to 11-15) with a copy / mL was used as a template, and fluorescence quantitative PCR detection was performed according to the optimal reaction system and conditions described in Example 1.

[0041] The test results of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype are as follows Figure 2 As shown in Figure 2, the detection sensitivity of H3 subtype AIV and N2 subtype AIV pseudovirus standards is 10 copies / mL; the detection results of conventional RT-qPCR reagents are shown in Figure 2. Figure 3 As shown in Figure 2, the detection sensitivity of H3 subtype and N2 subtype AIV pseudovirus standards was 1×10 3 Copies / mL; This indicates that the test kit in this application has high sensitivity and can detect trace amounts of virus in the early stages of infection, allowing for timely discovery and control of the epidemic.

[0042] Example 4 Repeatability testing of a dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype.

[0043] The concentration is 1×10 2copies / mL, 1×10 3 copies / mL, 1×10 4 The H3 subtype AIV and N2 subtype AIV pseudovirus standards with 100 copies / mL were subjected to intra-batch repeatability experiments, and three parallel replicates were set for each sample. Dual fluorescence quantitative PCR detection was performed according to the optimal reaction system and conditions described in Example 1. The average Ct value, standard deviation and coefficient of variation of the reaction results were calculated, and the results are shown in Table 3.

[0044] Table 3

[0045] The concentration is 1×10 2 copies / mL, 1×10 3 copies / mL, 1×10 4 The H3 subtype AIV and N2 subtype AIV pseudovirus standards with 100 copies / mL were subjected to batch reproducibility experiments. Three parallel replicates were set for each sample. Dual fluorescence quantitative PCR detection was performed according to the optimal reaction system and conditions described in Example 1. Repeated experiments were performed at two different time points. The average Ct value, standard deviation and coefficient of variation of the reaction results were calculated, and the results are shown in Table 4.

[0046] Table 4

[0047] According to Tables 3 and 4, the coefficients of variation within and between groups were less than 5%, the coefficient of variation within the group ranged from 0.87% to 2.87%, and the coefficient of variation between the groups ranged from 1.24% to 3.33%, indicating good repeatability both within and between groups.

[0048] This specific embodiment is merely an explanation of the present application and is not a limitation of the present application. After reading this specification, those skilled in the art may make modifications to the present embodiment without any creative contribution as needed, but such modifications are protected by the patent law as long as they are within the scope of the claims of the present application.

[0049] <110> Taizhou Leiling Biotech Co., Ltd. <120> Avian influenza virus H3N2 subtype dual microfluidic fluorescence PCR detection kit <160> 9 <170> SIPO SequenceListing 1.0 <210> 1 <211> twenty one <212> DNA <213> Artificial Sequence <400> 1 aaagaccaga aggcagctaa g 21 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 ttgttcagtg cctcatctcg 20 <210> 3 <211> 28 <212> DNA <213> Artificial Sequence <400> 3 tcccgttcct aattgattct atgcaggc 28 <210> 4 <211> twenty one <212> DNA <213> Artificial Sequence <400> 4 ggcttcacgt ttgtgttact g 21 <210> 5 <211> 20 <212> DNA <213> Artificial Sequence <400> 5 gacgcattct gactcctgag 20 <210> 6 <211> 28 <212> DNA <213> Artificial Sequence <400> 6 accccattat aaatgaaact ggcggtcg 28 <210> 7 <211> twenty one <212> DNA <213> Artificial Sequence <400> 7 acggacagga ttgacagatt g 21 <210> 8 <211> 20 <212> DNA <213> Artificial Sequence <400> 8 accaactaag aacggccatg20 <210> 9 <211> 25 <212> DNA <213> Artificial Sequence <400> 9 cacccacgga atcgagaaag agcta 25.

Claims

1. A dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype, characterized in that: It comprises a sample lysis extract solution, a sample washing solution I, a sample washing solution II, and a reaction premix solution for detecting H3N2 subtype avian influenza virus; The reaction premix includes an H3 specific sequence combination, an N2 specific sequence combination, an internal standard gene specific sequence combination, an RNA-direct realtime PCR master mix and an Mn 2+ ; The H3 specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: H3-F: AAAGACCAGAAGGCAGCTAAG (SEQ ID NO. 1); H3-R: TTGTTCAGTGCCTCATCTCG (SEQ ID NO. 2); H3-probe: TCCCGTTCCTAATTGATTCTATGCAGGC (SEQ ID NO. 3); The fluorescence reporter group of the H3-probe is FAM, and the fluorescence quencher group of the H3-probe is BHQ1; The N2-specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: N2-F: GGCTTCACGTTTGTGTTACTG (SEQ ID NO.4); N2-R: GACGCATTCTGACTCCTGAG (SEQ ID NO.5); N2-probe: ACCCCATTATAAATGAAACTGGCGGTCG (SEQ ID NO. 6); The fluorescence reporter group of the N2-probe is VIC, and the fluorescence quencher group of the N2-probe is BHQ2.

2. The avian influenza virus H3N2 subtype dual microfluidic fluorescence PCR detection kit according to claim 1, characterized in that: The sample lysis extraction solution comprises the following components: guanidine hydrochloride, guanidine isothiocyanate, NaCl, isopropanol, Tween20, Triton-X10, EDTA and Tris-HCl.

3. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The sample washing solution I comprises the following components: guanidine hydrochloride, Tris-HCl, EDTA, NaCl, Tween 20 and ethanol.

4. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The sample washing solution II includes the following components: ethanol and Tween20.

5. The dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to claim 1, characterized in that: The internal standard gene specific sequence combination includes a forward F primer, a reverse R primer and a probe, and the nucleotide sequences thereof are: 18S-F: ACGGACAGGATTGACAGATTG (SEQ ID NO. 7); 18S-R: ACCAACTAAGAACGGCCATG (SEQ ID NO. 8); 18S-probe: CACCCACGGAATCGAGAAAGAGCTA (SEQ ID NO. 9); The fluorescence reporter group of the 18S-probe is ROX, and the fluorescence quencher group of the 18S-probe is BHQ3.

6. A detection method of the dual microfluidic fluorescence PCR detection kit for avian influenza virus H3N2 subtype according to any one of claims 1 to 5, characterized in that: The specific steps include the following: S1, storing the sample lysis extract in the first small chamber of the integrated detection reagent card; storing the sample washing solution I in the second small chamber of the integrated detection reagent card; The sample washing solution II is stored in the third chamber of the integrated detection reagent card; the reaction premix solution is stored in the fourth chamber of the integrated detection reagent card; S2. Add the sample to be tested to the integrated detection reagent card, cover the card, and gradually carry out the following reactions in the integrated detection reagent card: (1) The sample to be tested is lysed, and the magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA; (2) The magnetic beads adsorb H3 subtype avian influenza virus RNA, N2 subtype avian influenza virus RNA, and internal standard gene RNA for directional movement, and the non-nucleic acid samples on the magnetic beads are washed away; (3) The magnetic beads enter the molecular amplification reaction area, the viral RNA dissociates from the magnetic beads, and the RNA is reverse transcribed into the corresponding cDNA under the action of reverse transcriptase, and a dual fluorescence quantitative PCR reaction is performed; (4) Analyze whether the sample is infected with the H3N2 subtype avian influenza virus based on the fluorescence curve.

Images