Implant loaded with antibacterial coating and coating preparation method
Through electrochemical deposition and layer-by-layer self-assembly technology, the UiO-66 mineralized collagen coating loaded with carvacrol was prepared, which solved the problem of early infection of dental implants, achieved the long-lasting antibacterial properties on the surface of the implant, reduced the risk of infection and improved clinical effect.
Patent Information
- Application Number
- CN202510266027.3
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-07
- Publication Date
- 2025-06-06
- Estimated Expiration
- Not applicable · inactive patent
AI Technical Summary
The tissue around the dental implant has weak resistance to bacterial invasion, which leads to the implant being easily infected and lost in the early stage, and the long-lasting antibacterial properties on the surface of the implant are urgently needed.
Through electrochemical deposition and layer-by-layer self-assembly technology, a UiO-66 mineralized collagen coating with carvacrol loading is prepared to enhance the surface osseous binding capacity and antibacterial ability of titanium-based materials.
It significantly improves the antibacterial effect on the surface of the implant, especially has a strong inhibitory effect on E. coli and Staphylococcus aureus, reduces the risk of infection around the implant, and improves initial stability and clinical efficacy.
Smart Images

Figure CN120099523A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of dental implants, in particular to an implant loaded with an antibacterial coating and a method for preparing the coating. Background Art
[0002] Titanium is a bioinert material and does not have biological functions. However, by adjusting the physical and chemical properties of the titanium implant surface (such as chemical composition, surface roughness and wettability, etc.), the attachment, migration, proliferation and differentiation of cells, as well as the response of pathogenic microorganisms and the formation of biofilms can be significantly affected.
[0003] Titanium implants are widely used in the field of stomatology due to their excellent biocompatibility and biomechanical properties. However, peri-implantitis is still one of the main causes of implant failure, and its occurrence is usually closely related to bacterial infection and bone tissue destruction. The tissues around dental implants are different from natural periodontal tissues, and their ability to resist bacterial invasion is relatively weak, especially in unhealthy microecological environments, such as periodontitis, maxillofacial defects, and alveolar socket infections. This is more likely to occur in patients with peri-implant infection. The first 4 weeks after implant placement is the peak period of infection. Since the bone integration interface has not yet been formed and the antibacterial and anti-infection ability of this interface is relatively weak, it may lead to early loss of the implant before the upper structure is repaired. Therefore, there is an urgent need for long-lasting antibacterial properties on the implant surface to prevent infection until the bone integration interface is fully formed. Summary of the invention
[0004] To this end, the technical problem to be solved by the present invention is to provide an implant loaded with an antibacterial coating and a method for preparing the coating, and to prepare a UiO-66 mineralized collagen coating loaded with carvacrol by using electrochemical deposition and layer-by-layer self-assembly technology, so as to improve the bone bonding ability of the titanium-based material surface and give it surface antibacterial ability, reduce peri-implant infection, and improve initial stability and clinical efficacy.
[0005] In order to solve the above technical problems, the present invention provides the following technical solutions:
[0006] 1. A method for preparing a coating loaded with an antibacterial coating, comprising the following steps:
[0007] S1, titanium sheet pretreatment, ultrasonic cleaning of the titanium sheet with ethanol, acetone and distilled water and then alkaline heat treatment;
[0008] S2, preparing an electrolyte, dissolving type I collagen with acetic acid to obtain a collagen solution, and mixing the collagen solution and a monocalcium phosphate solution in a volume ratio of 4:1 to obtain an electrolyte;
[0009] S3, preparing a titanium sheet loaded with type I collagen, using the titanium sheet treated with alkali heat in S1 as a cathode and a platinum electrode as an anode, placing the cathode and the anode in an electrolyte for electrochemical deposition by a constant voltage method, taking out the titanium sheet after the electrochemical deposition, washing the coating surface with deionized water, and drying naturally to obtain Ti@col-I;
[0010] S4, preparing carvacrol-loaded UiO-66 mineralized collagen, mixing carvacrol and UiO-66 in a ratio of 10:1 and stirring the mixture under magnetic stirring at room temperature for 6 hours to obtain a Car@UiO-66 solution;
[0011] S5, preparing a UiO-66 mineralized collagen coating loaded with carvacrol, immersing Ti@col-I in a Car@UiO-66 solution for 48 h to obtain a Ti@col-I@Car@UiO-66 coating;
[0012] S6. Alternately soak chitosan and hyaluronic acid into the Ti@col-I@Car@UiO-66 coating, soaking for 30 minutes each time, for a total of 5 cycles, and finally obtain Ti@col-I@Car@UiO-66@LBL.
[0013] 2. According to the coating preparation method described in 1 above, in step S1, the alkaline heat treatment process of the cleaned titanium sheet is:
[0014] A1. Soak the cleaned titanium sheet in a 60°C, 5 mol / L NaOH aqueous solution. After 24 hours, take out the specimen, rinse with deionized water and dry it.
[0015] A2. Place the titanium sheet treated with A1 into a muffle furnace with a temperature rise of 5°C per minute, heat at 600°C for 1 hour, cool naturally in the furnace, and ultrasonically wash in deionized water for 15 minutes.
[0016] 3. According to the coating preparation method described in 1 above, in step S2, the mixing volume ratio of the collagen solution and the calcium dihydrogen phosphate solution is 4:1, the concentration of the collagen solution in the electrolyte is 0.4 mg / ml, and the concentration of the calcium dihydrogen phosphate solution is 4 mM.
[0017] 4. According to the coating preparation method described in 1 above, in step S3, the deposition temperature of the electrochemical deposition is 37° C., the voltage is 2.5 V, and the deposition time is 30 min.
[0018] 5. According to the coating preparation method described in 1 above, in step S4, the preparation process of UiO-66 is as follows:
[0019] B1. Add dimethyl amide and acetic acid to the polytetrafluoroethylene reactor and stir, then slowly add ZrCl 4, 2,5-dihydroxyterephthalic acid and stirred for 5 minutes, and the reactor was placed in a muffle furnace at 120°C for 24 hours to obtain crude UiO-66 crystals;
[0020] B2. After the reaction solution in the reactor is cooled to room temperature, the blend is separated by centrifugation, the precipitate is collected and washed three times with a mixed solution of methanol and dimethylformamide, and the precipitate is dispersed and soaked in dichloromethane overnight;
[0021] B3. The precipitate after soaking was washed three times with dichloromethane and centrifuged repeatedly. The product after centrifugal separation was placed in a vacuum drying oven and dried at 120° C. for 12 h under vacuum conditions to obtain UiO-66.
[0022] 6. An implant loaded with an antibacterial coating, wherein the material of the implant is metallic titanium or titanium alloy, and the surface of the material of the implant has an antibacterial coating prepared by the coating preparation method described in any one of items 1 to 4 above.
[0023] The technical solution of the present invention achieves the following beneficial technical effects:
[0024] The present invention discloses an implant loaded with an antibacterial coating and a method for preparing the coating. UiO-66 is synthesized by a hydrothermal method, carvacrol is loaded onto UiO-66 nanoparticles, the carvacrol-loaded nanoparticles are loaded onto a collagen-modified titanium substrate by an immersion method, sodium hyaluronate and chitosan are alternately immersed in the modified titanium coating by a layer-by-layer self-assembly technique, a Ti@col-I@Car@UiO-66@LBL composite coating is prepared, and its hydrophilicity is enhanced. The coating exhibits a significant antibacterial effect through the release of carvacrol, and has a strong inhibitory effect on Escherichia coli and Staphylococcus aureus, thereby providing a new idea for developing a multifunctional titanium implant with strong antibacterial property and bone formation promoting function, and has a potential application prospect for preventing peri-implantitis. BRIEF DESCRIPTION OF THE DRAWINGS
[0025] Figure 1 A schematic diagram of the field emission scanning electron microscope structure of an implant loaded with an antibacterial coating and a method for preparing the coating according to the present invention;
[0026] A is the SEM image of the pure Ti group; B is the SEM image of the Ti@col-I group; C is the SEM image of the Ti@col-I@Car group; D is the SEM image of the Ti@col-I@Car@UiO-66 group; E is the SEM image of the Ti@col-1@Car@UiO-66@LBL group;
[0027] Figure 2 Schematic diagram of X-ray electron spectroscopy analysis of the present invention;
[0028] A is the main spectrum of each group of samples; B is the titanium element analysis diagram; C is the calcium element analysis diagram; D is the zirconium element analysis diagram; E is the phosphorus element analysis diagram; F is the sodium element analysis diagram;
[0029] Figure 3 Schematic diagram of X-ray diffraction analysis of the present invention;
[0030] Figure 4 Schematic diagram of water contact angle of the present invention;
[0031] Figure 5 Schematic diagram of live and dead cell staining results of the present invention;
[0032] Living cells: green; dead cells: red; scale bar: 250 μm;
[0033] Figure 6 The cell adhesion and spreading of the present invention are intended to show;
[0034] A is the cytoskeleton structure of each group. In the figure, blue represents the cell nucleus stained with DAPI after 24 hours of culture, and red represents the cell filamentous actin stained with rhodamine-phalloidin after 24 hours of culture; B is the comparison of the number of adherent cells in each group; C is the spreading area of each group;
[0035] Figure 7 Schematic diagram of cell viability of osteoblasts of the present invention;
[0036] *p<0.05, **p<0.01 in the figures;
[0037] Figure 8 Schematic diagram of the antibacterial test results of the present invention;
[0038] Where A is the plate count of Escherichia coli, B is the plate count of Staphylococcus aureus, C is the antibacterial rate of each sample group against Escherichia coli, and D is the antibacterial rate of each sample group against Staphylococcus aureus;
[0039] Fig. 9 Schematic diagram of evaluating osteogenic differentiation ability of the present invention;
[0040] A is the ALP activity at 7 days, and B is the ALP activity at 14 days;
[0041] Fig.10 Schematic diagram of the alizarin red staining results of the present invention;
[0042] A is the results of alizarin red staining of each group, and B is the quantitative analysis of alizarin red staining of each group;
[0043] Fig.11 Schematic diagram of the mRNA expression level of osteogenesis-related genes of the present invention;
[0044] In the figure, *p<0.05, **p<0.01, where A is the mRNA expression level of OPN gene in osteoblasts cultured for 7 days, B is the mRNA expression level of OCN gene in osteoblasts cultured for 7 days, C is the mRNA expression level of Col I gene in osteoblasts cultured for 7 days, D is the mRNA expression level of OPN gene in osteoblasts cultured for 14 days, E is the mRNA expression level of OCN gene in osteoblasts cultured for 14 days, and F is the mRNA expression level of Col I gene in osteoblasts cultured for 14 days. DETAILED DESCRIPTION
[0045] Example 1
[0046] The present invention provides a method for preparing a coating loaded with an antibacterial coating, comprising the following steps:
[0047] 1) Titanium sheet pretreatment: Use ethanol, acetone and distilled water to ultrasonically clean the titanium sheet for 15 minutes to obtain a clean surface, soak the treated titanium sheet in a 60°C, 5mol / L NaOH aqueous solution, take it out after 24 hours, rinse it with deionized water and dry it, and put the titanium sheet treated with NaOH into a resistance furnace (muffle furnace) with a temperature rise of 5°C per minute without overlapping, and heat it at 600°C for 1 hour, cool it naturally with the furnace, ultrasonically rinse it in deionized water for 15 minutes, and dry it at room temperature for use;
[0048] 2) Preparation of electrolyte: dissolving type I collagen with acetic acid to a final concentration of 0.5 mg / mL to obtain a collagen solution;
[0049] 0.084 mol / l Ca(NO 3 ) 2 , 0.05mol / lNH 4 H 2 PO 4 The calcium dihydrogen phosphate solution was obtained by mixing the solution in a volume ratio of 1:5 as a deposition solution, and the collagen solution and the calcium dihydrogen phosphate solution were mixed in a volume ratio of 4:1 to obtain an electrolyte solution. The concentration of the collagen solution in the electrolyte was 0.4 mg / ml, and the Ca(H 2 PO 4 ) 2 The concentration of the electrolyte was 4 mM, and then the pH value of the electrolyte was adjusted to 4.5 with NaOH (the pH of the electrolyte was adjusted with 0.05 mol / l NaOH solution and 0.05 mol / l HCL solution).
[0050] 3) Preparation of titanium sheet loaded with type I collagen: The titanium sheet treated with alkali heat was used as the cathode of the circuit, and the platinum electrode was used as the anode of the circuit. Electrodeposition was performed using a constant voltage method at a deposition temperature of 37°C, a voltage of 2.5V, and a deposition time of 30min. After the electrochemical deposition was completed, the titanium sheet was taken out, the coating surface was rinsed with deionized water, and naturally dried to obtain Ti@col-I;
[0051] 4) Preparation of UiO-66 mineralized collagen loaded with carvacrol:
[0052] ① Add 50 mL of dimethylformamide (DMF) and 1 mL of acetic acid to the polytetrafluoroethylene reactor, start stirring, and add the pre-weighed ZrCl 4 200 mg was slowly added into the stirred reactor, followed by the slow addition of 170 mg of 2,5-dihydroxyterephthalic acid, stirred at room temperature for 5 min, and then the reactor was placed in a muffle furnace at 120 °C for 24 h to obtain UiO-66 crude crystals;
[0053] ② After the reaction solution is cooled to room temperature, the blend is centrifuged, the precipitate is collected, and then washed three times with a mixed solution of methanol (MeOH) and DMF (V / V=1 / 4). Subsequently, the precipitate is dispersed and soaked in dichloromethane (DCM) overnight. The crude crystals are washed three times with DCM and repeatedly centrifuged. The product after centrifugation is placed in a vacuum drying oven and dried at 120°C for 12 hours under vacuum conditions to obtain UiO-66;
[0054] ③ After 20 mg / ml carvacrol and high temperature activated UiO-66 were mixed in a ratio of 10:1, the mixture was stirred at room temperature for 6 h using a magnetic stirrer to obtain Car@UiO-66;
[0055] 5) preparing a UiO-66 mineralized collagen coating loaded with carvacrol, by simply immersing Ti@col-I into Car@UiO-66 for 48 h to obtain a UiO-66 mineralized collagen Ti@col-I@Car@UiO-66 loaded with carvacrol;
[0056] 6) Using LBL technology, the pre-prepared 5 mg / mL chitosan and 5 mg / mL hyaluronic acid were alternately immersed on the Ti@col-I@Car@UiO-66 substrate, each immersion was 30 minutes, and a total of 5 cycles were performed to finally obtain the UIO-66 mineralized collagen coating Ti@col-I@Car@UiO-66@LBL loaded with carvacrol.
[0057] The complex of calcium-phosphorus compounds and type I collagen is closer to the physiological bone tissue structure. The calcium and phosphorus ions produced by calcium phosphate are deposited in collagen, which is beneficial to the stability of calcium phosphate. In the subsequent osteogenesis induction process, collagen provides a nucleation environment for the transformation of calcium phosphate to hydroxyapatite. Calcium phosphate can enhance the stability of collagen, so that after the calcium phosphate is completely converted into the apatite phase, the collagen can continue to maintain its osteogenesis induction activity. The mineralized collagen coating has good cell compatibility, which can not only enhance the bonding force between the metal oxide and the collagen layer, thereby slowing down enzyme degradation, but also promote the attachment and proliferation of osteoblasts.
[0058] Nanosheet coatings with excellent osteogenic and angiogenic activities can be constructed on titanium (Ti) surfaces by electrochemical deposition, which holds great promise in biomedical applications.
[0059] Metal-organic framework (MOF) has become an ideal drug carrier material due to its excellent high porosity, excellent thermal stability and large specific surface area. UiO-66 is a zirconium ion (Zr 4+ ) has a metal-organic framework with high specific surface area and weak coordination bonds, which enables it to have high drug loading capacity and good biodegradability. In addition to its low cytotoxicity, UiO-66(Zr) can be used as an effective drug carrier system and is widely used in anti-cancer, anti-inflammatory and antibacterial therapeutic fields.
[0060] Carvacrol is a natural active ingredient widely found in the essential oils of various aromatic plants. Carvacrol has a variety of therapeutic properties, including antioxidant, anti-cancer, diabetes prevention, cardioprotection, anti-obesity, liver protection, reproductive health promotion, anti-aging, antibacterial and immunomodulatory effects. Carvacrol has been found to exhibit significant antibacterial effects against pathogens such as Staphylococcus aureus, Pseudomonas aeruginosa, and Escherichia coli. UiO-66(Zr) can achieve continuous controlled release of carvacrol, and has good antibacterial effects and biocompatibility.
[0061] Layer-by-Layer self-assembly (LBL) technology is a green and environmentally friendly drug controlled release system. It is based on the electrostatic attraction between positively charged and negatively charged materials, and forms an ordered polyelectrolyte composite film through periodic deposition. It is easy to operate and highly repeatable. The preparation process of LBL coating is relatively simple. Through repeated immersion and coating, positively and negatively charged molecules can be deposited on the surface of the substrate in sequence. In addition, the process is usually carried out at room temperature, with relatively stable preparation conditions, and can effectively maintain the stability of the active substance.
[0062] Chitosan (CS), as a positively charged alkaline macromolecular polysaccharide, is widely present in nature and has good biocompatibility and degradability. Compared with inorganic materials, CS can provide more bioactive attachment sites, improve cell adhesion, and accelerate tissue repair. It also has hemostatic and antibacterial functions, so it has wide applications in many fields. Hyaluronic acid (HA) has a similar structure to chitosan. As a macromolecular linear polysaccharide, it is abundant in organisms and contains a large number of carboxyl and hydroxyl groups. It is often used in drug carriers and tissue engineering. Because hyaluronic acid has weak negative charge, it can be adsorbed with positively charged chitosan through LBL technology to form a composite film.
[0063] The present invention synthesizes UiO-66 by a hydrothermal method, and loads carvacrol onto UiO-66 nanoparticles; secondly, the carvacrol-loaded nanoparticles are loaded onto a collagen-modified titanium substrate by an immersion method; finally, sodium hyaluronate (HA) and chitosan (CS) are alternately immersed in the modified titanium coating by a layer-by-layer self-assembly technique, thereby preparing a Ti@col-I@Car@UiO-66@LBL composite coating, which enhances its hydrophilicity and has significant cell attachment, proliferation, osteogenic differentiation and mineralization promotion effects. The coating also exhibits significant antibacterial effects through the release of carvacrol, especially having a strong inhibitory effect on Escherichia coli and Staphylococcus aureus. An antibacterial and osteogenic coating is constructed on the surface of an alkali-heat-modified titanium (Ti) implant, thereby reducing the risk of peri-implantitis. The present application provides a new idea for developing a multifunctional titanium implant with strong antibacterial properties and bone formation promotion functions, and has a potential application prospect for preventing peri-implantitis.
[0064] The present invention utilizes electrochemical deposition and layer-by-layer self-assembly technology to prepare a UiO-66 mineralized collagen coating loaded with carvacrol, successfully covers a Ti implant with a Ti@col-I@Car@UiO-66@LBL composite coating, and utilizes electrochemical deposition and LBL technology to prepare a coating on a pure titanium surface, thereby improving cell compatibility and osteogenic differentiation of cells. A metal organic framework is utilized as a drug delivery system, and Ti-based implants enhance the antibacterial effect of natural drugs. The Ti@col-I@Car@UiO-66@LBL surface shows great potential in the application of preventing peri-implantitis.
[0065] Example 2
[0066] Prior to the in vitro and in vivo experiments, the samples prepared in Example 1 were sterilized by exposure to ultraviolet radiation, and the samples were divided into the following five groups:
[0067] ① Pure titanium group (pure Ti), that is, the titanium sheet is subjected to alkali heat pretreatment according to step 1);
[0068] ② Alkaline-heat collagen group (Ti@col-I), i.e., Ti@col-I obtained through steps 1)-3);
[0069] ③ Alkaline-heat collagen group loaded with carvacrol without UiO-66 (Ti@col-I@Car), that is, Ti@col-I obtained in steps 1)-3) was directly immersed in 20 mg / ml carvacrol for 48 h to obtain Ti@col-I@Car;
[0070] ④ Alkaline-heated collagen group loaded with carvacrol containing UiO-66 (Ti@col-I@Car@UiO-66), prepared by steps 1)-5);
[0071] ⑤ The alkaline-thermal collagen group loaded with carvacrol containing UiO-66 (Ti@col-I@Car@UiO-66@LBL) using LBL technology is prepared through steps 1)-6).
[0072] 1. Characterization of the organic metal stent coating loaded with the natural antibacterial product carvacrol
[0073] 1. Field emission scanning electron microscope (SEM)
[0074] The microstructure of each group of samples was observed using a field emission scanning electron microscope (FE-SEM, ZEISS Sigma 300, Germany). The samples were dried before SEM observation and then observed using a scanning electron microscope. The sample surface was sprayed with gold before observation.
[0075] The results are as follows Figure 1 As shown, the surface morphology of titanium-based samples with various coatings was detected using FE-SEM, and it can be seen that: Figure 1 As shown in A, the original pure titanium surface after grinding pretreatment shows surface grinding marks with relatively neat directions and a smooth surface; while after alkali heat treatment and the addition of collagen coating ( Figure 1 B), which is significantly different from the original pure titanium, is characterized by a uniform micro-nanoscale porous mesh structure on the surface and a three-dimensional network structure composed of collagen fibers, which are surrounded by uniform CaP aggregates. This structure has a certain depth and the number of scratches is reduced.
[0076] Figure 1 C After carvacrol was added to the surface of HA / collagen coating treated with alkali heat Figure 1 Compared with B, no obvious changes were observed, and the surface still had a porous structure; while the carvacrol ( Figure 1D), a regular octahedral structure appeared, indicating that UIO-66 was successfully loaded, and the pores became significantly smaller, which was due to the fact that more Car@UIO-66 was loaded on the surface, covering the pores; finally, after further layer-by-layer self-assembly of chitosan and sodium hyaluronate ( Figure 1 E), the regular octahedral structure is still visible, the pores have basically disappeared, and the surface is relatively smooth. Importantly, it was found that the introduction of carvacrol into UIO-66 nanocrystals does not destroy the crystalline structure of UIO-66 nanoparticles. Even after subsequent multi-layer coating of HA / collagen, chitosan and sodium hyaluronate, the representative UIO-66 structure is maintained.
[0077] 2. X-ray Electron Spectroscopy (XPS)
[0078] X-ray photoelectron spectrometer (Thermo Scientific K-Alpha, USA) was used to detect the elemental composition of each group of samples. Monochromated Al Kα was used as the radiation source of XPS. The full spectrum scanning energy was 150 eV, and the step length was 1 eV; the narrow spectrum scanning energy was 50 eV, and the step length was 0.1 eV. The full element spectrum of the coating surface was first obtained by wide spectrum scanning, and then the fine spectrum of Ti and other elements was obtained by high-resolution scanning. Thermo Avantage 4.51 software was used to analyze and process the data obtained by XPS, and C1s = 284.8 eV was used as the reference peak for binding energy correction.
[0079] The results are as follows Figure 2 As shown, XPS data show that ( Figure 2 A and 2B): The pure Ti group element components are mainly amorphous inert titanium dioxide and some nitrogen and carbon elements. C and N mainly come from the contamination of the sample surface. Figure 2 C and Figure 2 E shows that the other four groups all contain Ca and P elements, indicating the successful loading of HA / collagen coating. Figure 2 D indicates that both Ti@col-I@Car@UIO-66 and Ti@col-I@Car@UIO-66@LBL groups have Zr elements, indicating that Car@UIO-66 is successfully loaded. Figure 2 A and Figure 2 F shows that the Ti@col-I@Car@uio-66@LBL group contains C, N, O, and Na elements, indicating the successful preparation of the LBL coating.
[0080] 3. X-ray diffraction analysis (XRD)
[0081] The material phase identification of each group of samples was analyzed using an X-ray diffractometer (Rigaku Miniflex 600, Japan). The instrument used a copper potassium radiation light source (=0.15406 nm), an operating voltage of 40 kV, a current of 35 mA, 10-80 degrees, and 2 degrees / minute.
[0082] The results are as follows Figure 3 As shown, typical peaks of UIO-66, calcium phosphate compounds, and carvacrol were observed, indicating the successful preparation of each coating. The X-ray diffraction (XRD) patterns of the Ti@col-I@Car@UIO-66 group and the Ti@col-I@Car@uio-66@LBL group showed high crystallinity and sharp diffraction peaks, which are similar to the observations reported previously, indicating the successful preparation of UIO-66 and Car@uio-66 nanoparticles.
[0083] 4. Hydrophilicity analysis
[0084] The water contact angle (WCA) was measured using a contact angle meter (SDC-200S, Sindin, China) to measure the static water contact angle of different groups of sample surfaces. 5 μL of deionized water was dropped on the surfaces of different groups of titanium materials, and the projection images of the droplets on the material surfaces were collected. The projection images of the droplets were automatically analyzed by the software, and all tests were repeated at three different locations of the samples.
[0085] The results are as follows Figure 4 As shown in the figure, the wettability of the titanium surface after different chemical modification steps was measured by the water contact angle method (WCA). The physical and chemical properties of the surface The wettability of the surface directly affects biological reactions, such as bacterial adhesion, cell attachment and proliferation. Therefore, the water contact angle (WCA) of the substrate was determined. The results showed that the surface of the pure titanium group exhibited the highest hydrophobicity (91.05±3.39°). The HA / collagen coating group treated with alkali heat had a WCA (47.44±1.32°) that was greatly enhanced compared with the untreated pure titanium due to the increased surface roughness and higher hydroxyl content. The WCA (36.64±5.53) of the alkali-heated collagen group loaded with natural drugs (Ti@col-I@Car) without UIO-66 was lower than that of the alkali-heated collagen group (Ti@col-I). Subsequently, the WCA (41.43±2.18°) of the alkali-heated collagen group loaded with natural drugs (Ti@col-I@Car@UIO-66) containing UIO-66 was also slightly lower than that of the alkali-heat treated collagen coating. Finally, the WCA (66.68±1.85°) of the alkali-heated collagen group loaded with natural drugs (Ti@col-I@Car@uio-66@LBL) containing UIO-66 using LBL technology was obtained. These data indicate that the surface of the MOF-modified samples is more hydrophilic than the surface of the natural Ti substrate.
[0086] 2. In vitro cell experiments
[0087] Cell culture and passage: Mouse embryonic osteoblast-like MC3T3-E1 cells were used in the in vitro experiments. Well-growing cells were cultured in a culture dish with an appropriate culture medium. The cells were placed at 37°C and 5% CO 2 In the cell culture incubator, change the medium every 3 days and subculture once a week.
[0088] 1. Biological toxicity testing
[0089] After the cells grew on the material for 1 day, live and dead cell staining was performed to detect the biocompatibility of the material. Each group of samples was placed in a 24-well plate under sterile conditions, washed twice with PBS, and the cell concentration was adjusted to 3×104cell / ml. After being inoculated on the material for 1 day, the culture plate was removed and washed twice with PBS. The Calcein-AM / PI live cell / dead cell double staining kit was used for reaction at room temperature in the dark for 30 minutes, and the cells were immediately observed and photographed under an inverted fluorescence microscope.
[0090] The results are as follows Figure 5 As shown in the figure, live / dead and immunofluorescence staining were used to study the state of osteoblasts on natural and modified titanium substrates and to judge cytotoxicity. CalceinAM and propidium iodide (PI) were used to judge the state of cells in this experiment: CalceinAM is a fluorescent dye that can penetrate the membrane of living cells. After hydrolysis in cells, it emits green fluorescence, indicating the activity of cells. Propidium iodide (PI) is a fluorescent dye that can only penetrate the membrane of dead cells. After binding to intracellular DNA, it emits red fluorescence. Compared with other groups, the percentage of dead osteoblasts in the Ti@col-I@Car group was statistically higher than that in other groups, indicating that carvacrol had a negative effect on the viability of osteoblasts; the number of dead osteoblasts in the Ti@col-I@Car@UIO-66 group was lower than that in Ti@col-I@Car, indicating that the introduction of carvacrol into UIO-66 has excellent cell compatibility. Compared with the pure titanium group, there was no significant difference in the number of live osteoblasts in each group.
[0091] 2. Cell adhesion and spreading
[0092] After 1 day of inoculation, the adhesion and spreading of cells on the material were detected. The samples of each group were placed in a 24-well plate, washed twice with PBS, and the cells were inoculated on the samples at a density of 3×104cell / ml and 1ml per well for culture. The cells were taken out 1 day after inoculation, washed twice with PBS, fixed with 4% paraformaldehyde for 30 minutes, and permeabilized with 0.4% TritonX-100 for 30 minutes; the cells were washed twice with PBS, and stained with TRITCPhalloidin rhodamine-labeled phalloidin at room temperature for 30 minutes; the cell nucleus was stained with DAPI, and the results were immediately observed under an inverted fluorescence microscope, and quantitative analysis was performed using ImageJ software.
[0093] The results are as follows Figure 6 As shown in the figure, the filamentous actin (F-actin) in MC3T3-E1 cells was stained with rhodamine-phalloidin and showed red fluorescence under blue light excitation, while the cell nucleus was stained with DAPI and showed blue fluorescence under ultraviolet light excitation. After one day of co-culture of cells and materials, the MC3T3-E1 cells in each group of samples had a typical polygonal cytoskeleton structure ( Figure 6 A), MC3T3-E1 actin was greatly activated, resulting in significant expansion of the cytoskeleton. Despite the changes in the surface materials of the materials bound to the cells, similar cell spreading behaviors were obtained because all of these materials had good biocompatibility or rough surface structures that facilitated cell spreading. Fluorescence images stained with actin filaments demonstrated that the cell area was significantly larger, and cell protrusions and cytoskeleton development began on the Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group, and Ti@col-I@Car@uio-66@LBL group coatings, while the cells on the Ti substrate remained smaller and rounded.
[0094] In order to more intuitively study the behavior of MC3T3-E1 cells on different coatings on titanium surfaces, the spreading area was quantitatively analyzed. The number of cells growing on the coating surface was detected by counting the DAPI-stained cell nuclei to reflect the cytotoxicity of the coating to MC3T3-E1 cells.
[0095] Figure 6 As shown in B, there was no significant difference in the number of adherent cells among the pure Ti group, Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group, and Ti@col-I@Car@uio-66@LBL group (p>0.05), and the number of cells in the Ti@col-I group was less than that in the other groups (p<0.05). Figure 6As shown in Figure C, compared with other samples, the spreading area of MC3T3-E1 cells on the Ti@col-I@Car group and Ti@col-I@Car@UIO-66 group samples was reduced, and the cell morphology showed less actin cytoskeleton, indicating that the coating containing carvacrol had an adverse effect on cell adhesion, while the spreading area of the Ti@col-I@Car@uio-66@LBL group increased, with no significant difference from pure Ti, indicating that the coating formed by chitosan and sodium hyaluronate is conducive to cell adhesion.
[0096] 3. Biocompatibility evaluation
[0097] The cell viability was measured using the CCK-8 kit after 1d, 3d, 5d, and 7d of culture. The five groups of sterilized samples were placed in a 48-well plate, and 500 μL of the cells were taken at a cell density of 3×10 4 The MC3T3-E1 cell suspension of cells / well was inoculated on the sample in the well plate, and the well plate was placed in a cell culture incubator for culture. After 1d, 3d, 5d, and 7d, 300μL of fresh cell culture medium was replaced, and 30μL of CCK-8 solution was added to the wall. The well plate was placed in a cell culture incubator for incubation for 1h. 100μL of supernatant was transferred from each well to a 96-well plate, and the optical density (OD) value was detected by a microplate reader at a wavelength of 450nm.
[0098] In order to evaluate the effect of different titanium surface coating materials on cell proliferation ability, CCK-8 biocompatibility evaluation was performed. The results are as follows Figure 7 This is also the most commonly used method for evaluating the performance of biomaterials in experiments. The CCK-8 cell activity detection kit was used to measure the viability of cells after 1, 3, 5 and 7 days of culture. Figure 7 In the figure, after 1 day, there was no significant change in the cell viability of the samples in the pure Ti group, Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group, and Ti@col-I@Car@uio-66@LBL group, which was consistent with the results of cell adhesion ( Figure 6 B); As the culture time increased from 1d to 7d, the cell proliferation of the Ti@col-I@Car@uio-66@LBL group samples increased most significantly (p<0.01). The Ti@col-I@Car group and Ti@col-I@Car@UIO-66 group samples were also able to promote cell proliferation, but the increase was relatively small; the pure Ti group samples were almost unable to promote cell proliferation, and the cell activity remained basically unchanged.
[0099] 4. Antibacterial test
[0100] Bacterial culture and antibacterial evaluation were performed by plate count: Escherichia coli (ATCC25922) and Staphylococcus aureus (ATCC12600) were cultured in Luria-Bertani Broth (LB) medium, cultured overnight under mild shaking conditions (120 rpm / min), and harvested during the exponential growth phase before the experiment. The concentration of the bacterial suspension was adjusted to 1×10 using sterile LB medium. 6 CFU / mL. In order to conduct antibacterial evaluation, 100 μL of bacterial suspension and 400 μL of LB liquid culture medium were taken respectively, and cultured with the prepared samples at 37°C for 12 h. The co-cultured bacterial solution was taken out, spread on NA plate nutrient agar medium after gradient dilution, and cultured at 37°C for 18 h. Finally, the number of colonies was counted 44. The experiment was repeated 3 times for each group. The antibacterial effect was calculated as: Antibacterial rate (%) = (Ic-Is) / Ic×100%, where Is is the number of colonies in the test sample and Ic is the total number of colonies in the control group.
[0101] Imparting antibacterial properties to implants is the key to preventing postoperative bacterial infection of peri-implantitis. In order to study the antibacterial properties of layered composite coating modified titanium materials, a colony forming unit (CFU) test was conducted. The results are as follows Figure 8 As shown, the surface of the solid culture medium ( Figure 8 A, 8B), after adding HA / collagen to the Ti sample, the number of bacterial colonies did not change significantly. The Ti@col-I@Car@uio-66@LBL group had the least CFU, followed by the Ti@col-I@Car group and the Ti@col-I@Car@UIO-66 group. The pure Ti group and Ti@col-I had the largest number of CFUs, and the number of CFUs of different types of bacteria showed a similar change trend among the groups, which indicates that the titanium surface modified coating material has different degrees of broad-spectrum antibacterial properties.
[0102] In order to better understand the effects of various coatings on the antibacterial ability of Ti-based samples, the antibacterial rate was calculated by counting the number of bacterial CFU according to the antibacterial rate calculation formula, as shown in Figure 8 As shown in Figures C and 8D, the antibacterial rate of the Ti@col-I@Car@uio-66@LBL group against Escherichia coli was 78.33%, and the antibacterial rate against Staphylococcus aureus was 82.67%, both of which were significantly higher than those of the samples in the other groups (p<0.05). This result shows that the addition of LBL has a significant inhibitory effect on bacterial growth. In addition, the antibacterial rate of the samples in the Ti@col-I@Car@UIO-66 group was higher than that in the Ti@col-I@Car group, indicating that UIO-66 can indeed enhance the drug loading rate of carvacrol.
[0103] 5. Evaluation of osteoblast differentiation
[0104] Alkaline phosphatase (ALP) assay: ALP staining technique was used to measure the ALP activity of each group, and quantitative analysis was performed after 7 and 14 days of culture. First, the cells were cultured and plated using a six-well plate when the cells grew to 80%-90%. 5×10 4 cell / ml, the medium was changed every 3 days, and the samples and culture medium in each well were removed after 7 days and 14 days of culture, and then the cells were gently washed twice with sterilized PBS, fixed with 4% paraformaldehyde for 30 minutes, and washed twice with PBS. The cell lysate was placed on ice for 30 minutes, transferred to a centrifuge tube, centrifuged at low temperature and high speed at 4 degrees for 15 minutes, and the supernatant was taken as a sample, and stained with P0321S ALP alkaline phosphatase detection staining kit for 30 minutes, and the OD value was measured by microplate reader at a wavelength of 520nm to calculate the ALP activity.
[0105] For quantitative analysis, 25 μL of cell lysate was taken and the total cell protein concentration (g pro / mL) was measured using a BCA protein concentration assay kit. The ALP activity was divided by the total cell protein concentration and normalized to calculate the relative ALP activity per gram of protein (king unit / g pro).
[0106] ALP is a recognized key biochemical marker for osteogenic differentiation and new bone formation. The higher the ALP activity of osteoblasts, the higher the degree of osteoblast differentiation and osteogenic mineralization ability. By studying the effects of each group of samples on the ALP activity of mouse preosteoblasts MC3T3-E1, the in vitro osteogenic differentiation ability of the hierarchical coating modified titanium implant developed in this study was explored. Fig. 9 As shown, Fig. 9 A and 9B show the cellular ALP activity on samples of the pure Ti group, Ti@col-I group, Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group, and Ti@col-I@Car@uio-66@LBL group 7d and 14d after cell inoculation on the sample surface.
[0107] The results at 7d and 14d showed that the expression level of ALP on the samples covered by the Ti@col-I group coating was significantly higher than that of the other four groups of samples. Compared with the Ti@col-I group, the ALP activity of the Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group and Ti@col-I@Car@uio-66@LBL group decreased. Among the coatings loaded with HA / collagen, the activity of the Ti@col-I@Car@uio-66@LBL group was relatively the lowest, which may be due to the fact that its surface was covered with more products. The ALP activity of all groups increased in a time-dependent manner from the 7th day to the 14th day.
[0108] 6. Alizarin red staining
[0109] 8×10 per well 4 The medium was changed every 3 days. After 21 days, the medium was removed and the cells were gently rinsed twice with PBS. The cells were fixed with 4% paraformaldehyde for 20 minutes and then washed with ddH 2 Wash with 5% EDTA O for 3-5 minutes, and then wash 3 times. Add appropriate amount of alizarin red dye to each well to cover the cell plate, incubate in dark for 30 minutes, remove the dye, and add ddHO. 2 O was used to wash twice to terminate the color development, and finally the cells were observed and photographed under an inverted fluorescence microscope, and the number of nodes and connections was measured using ImageJ software. Control group: No treatment was performed on the cells, and fresh culture medium was replaced every 3 days.
[0110] Alizarin red staining was used to examine the expression of osteocalcin, a marker of late osteoblast differentiation. Fig.10 As shown, the staining results showed that ( Fig.10 A), after 21 days of culture, compared with the pure Ti group, the calcium nodule staining area in the Ti@col-I@Car@uio-66@LBL group was the largest, and the osteocalcin expression levels in the Ti@col-I group and the Ti@col-I@Car@uio-66@LBL group were significantly increased (p<0.01); the osteocalcin expression levels in the Ti@col-I@Car group and the Ti@col-I@Car@UIO-66 group were also higher than those in the pureTi group (p<0.05). Compared with the quantitative analysis results of ALP mentioned above, the osteocalcin expression level in the Ti@col-I@Car@uio-66@LBL group increased in the third week. The above results indicate that the Ti@col-I group, the Ti@col-I@Car group, the Ti@col-I@Car@UIO-66 group, and the Ti@col-I@Car@uio-66@LBL group are all beneficial to enhancing the osteogenic differentiation of osteoblasts.
[0111] 7. RT-qPCR detection of mRNA expression of osteogenesis-related genes
[0112] Each group of samples was cultured with preosteoblasts (MC3T3-E1) (the number of cells in each sample was 5x104 per sample). The transcription levels of osteoblast-related genes COL-I, OCN and OPN were detected at 7 and 14 days of culture. On the 7th and 14th days after inoculation, RNA was purified using SteadyPure RNAKit, and total cell RNA was extracted using Trizol one-step method. 1000 ng RNA was reverse transcribed using 20 μL system, and cDNA was synthesized using 5× PrimeScript RT MasterMix. Quantitative Reverse Transcription PCR reaction of COL-I, OCN and OPN osteoblast-related genes was performed using SYBR Green Pro TaqHS qPCR kit. The expression level of each gene was relative to the expression level of the internal reference gene GAPDH, and the primers were designed as follows:
[0113] Internal reference gene Gene expression GAPDH-F TGTGTCCGTCGTGGATCTGA GAPDH-R TTGCTGTTGAAGTCGCAGGAG OPN-F TCTCCTGGCTGAATTCTGAGG OPN-R GATCTGGGTGCAGGCTGTAAA OCN-F CATGAGGACCATCTTTCTGCTCA OCN-R TGTTCACTACCTTATTGCCCTCC ALP-F AAGGCTCTCTTCACTCCAAGATG ALP-R CGTTAATTGACGTTCCGATCCTG Coll-F CTCTTAAATCACAGCCCAGGGAA Col-lR ATACACTTGCTTCTCAGTCACCT
[0114] In order to further reveal the effects of each group of material surfaces on osteoblast differentiation at the genetic level, qRT-PCR was used to detect the mRNA expression levels of osteoblast-related genes, including Col I, OPN, and OCN, after 7 and 14 days of osteoblast culture. Studies have confirmed the leading transcription factors of Runx2 and Osterix, which regulate the osteogenesis process. In addition, they regulate the expression levels of downstream osteogenic genes, such as Col I, OPN, and OCN.
[0115] The results are as follows Fig.11 As shown in Figure 2, the expression of the three osteoblast-related genes detected was basically the same. The gene expression level of OCN in osteoblasts grown on the surface of the Ti@col-I group was higher than that in other groups within 7 days (p<0.05) ( Fig.11 A), OPN and COL-I expressions also showed similar trends ( Fig.11 B. Fig.11 C) 14d study results ( Fig.11 D) showed that the expression of OPN in osteoblasts in the Ti@col-I group was significantly higher than that in other groups (p<0.01), and the expression levels of OCN and COL-I showed the same trend as OPN ( Fig.11 E, 11F); there was no significant difference between the Ti@col-I@Car group, Ti@col-I@Car@UIO-66 group, and Ti@col-I@Car@uio-66@LBL group and the pure Ti group within 7 days (P>0.05), but they were all higher than the pure Ti group. After 14 days, the three groups were all higher than the pure Ti group (p<0.05), which was consistent with the ALP test results.
[0116] Combined with the above test results, the present application performed alkaline heat treatment on the titanium surface to prepare a UIO-66 mineralized collagen coating loaded with carvacrol. The antibacterial property test showed that the modified titanium coating had good antibacterial properties. Compared with the Ti@col-I group and the pure Ti group, the presence of carvacrol in the coatings of the Ti@col-I@Car group, the Ti@col-I@Car@UIO-66 group, and the Ti@col-I@Car@uio-66@LBL group could achieve better antibacterial activity. The antibacterial rates of the Ti@col-I@Car@uio-66@LBL group against Escherichia coli and Staphylococcus aureus were both above 75%. The results of cell assays showed that the Ti@col-I@Car@uio-66@LBL group significantly improved the adhesion, proliferation and differentiation of osteoblasts. In addition, the Ti@col-I@Car@uio-66@LBL group stimulated the expression of osteoblast-related genes (OCN, OPN and COL-I) in osteoblasts.
[0117] Therefore, the multifunctionality of Ti@col-I@Car@uio-66@LBL provides an alternative and promising strategy for the prevention of peri-implantitis.
[0118] Obviously, the above embodiments are merely examples for the purpose of clear explanation, and are not intended to limit the implementation methods. For those skilled in the art, other different forms of changes or modifications can be made based on the above description. It is not necessary and impossible to list all the implementation methods here. The obvious changes or modifications derived therefrom are still within the scope of protection of the claims of this patent application.
Claims
1. A method for preparing a coating loaded with an antibacterial coating, characterized in that: The steps include: S1, titanium sheet pretreatment, ultrasonic cleaning of the titanium sheet with ethanol, acetone and distilled water and then alkaline heat treatment; S2, preparing an electrolyte, dissolving type I collagen with acetic acid to obtain a collagen solution, and mixing the collagen solution and a monocalcium phosphate solution in a volume ratio of 4:1 to obtain an electrolyte; S3, preparing a titanium sheet loaded with type I collagen, using the titanium sheet treated with alkali heat in S1 as a cathode and a platinum electrode as an anode, placing the cathode and the anode in an electrolyte for electrochemical deposition by a constant voltage method, taking out the titanium sheet after the electrochemical deposition, washing the coating surface with deionized water, and drying naturally to obtain Ti@col-I; S4, preparing carvacrol-loaded UiO-66 mineralized collagen, mixing carvacrol and UiO-66 in a ratio of 10:1 and stirring the mixture under magnetic stirring at room temperature for 6 hours to obtain a Car@UiO-66 solution; S5, preparing a UiO-66 mineralized collagen coating loaded with carvacrol, immersing Ti@col-I in a Car@UiO-66 solution for 48 h to obtain a Ti@col-I@Car@UiO-66 coating; S6. Alternately soak chitosan and hyaluronic acid into the Ti@col-I@Car@UiO-66 coating, soaking for 30 minutes each time, for a total of 5 cycles, and finally obtain Ti@col-I@Car@UiO-66@LBL.
2. The coating preparation method according to claim 1, characterized in that: In step S1, the alkali heat treatment process of the cleaned titanium sheet is as follows: A1. Soak the cleaned titanium sheet in a 60°C, 5 mol / L NaOH aqueous solution. After 24 hours, take out the specimen, rinse with deionized water and dry it. A2. Place the titanium sheet treated with A1 into a muffle furnace with a temperature rise of 5°C per minute, heat at 600°C for 1 hour, cool naturally in the furnace, and ultrasonically wash in deionized water for 15 minutes.
3. The coating preparation method according to claim 1, characterized in that: In step S2, the mixing volume ratio of the collagen solution and the calcium dihydrogen phosphate solution is 4:1, the concentration of the collagen solution in the electrolyte is 0.4 mg / ml, and the concentration of the calcium dihydrogen phosphate solution is 4 mM.
4. The coating preparation method according to claim 1, characterized in that: In step S3, the deposition temperature of the electrochemical deposition is 37° C., the voltage is 2.5 V, and the deposition time is 30 min.
5. The coating preparation method according to claim 1, characterized in that: In step S4, the preparation process of UiO-66 is as follows: B1. Add dimethyl amide and acetic acid into a polytetrafluoroethylene reactor and stir, then slowly add ZrCl4 and 2,5-dihydroxyterephthalic acid into the reactor in sequence and stir for 5 minutes, place the reactor in a muffle furnace at 120°C and react for 24 hours to obtain crude UiO-66 crystals; B2. After the reaction solution in the reactor is cooled to room temperature, the blend is separated by centrifugation, the precipitate is collected and washed three times with a mixed solution of methanol and dimethylformamide, and the precipitate is dispersed and soaked in dichloromethane overnight; B3. The precipitate after soaking was washed three times with dichloromethane and centrifuged repeatedly. The product after centrifugal separation was placed in a vacuum drying oven and dried at 120° C. for 12 h under vacuum conditions to obtain UiO-66.
6. An implant loaded with an antibacterial coating, characterized in that: The material of the implant is metallic titanium or titanium alloy, and the surface of the material of the implant has an antibacterial coating prepared by the coating preparation method according to any one of claims 1 to 4.
Citation Information
Cited By
Electrospinning patch for oral mucosa wound surface and preparation method and application thereof
CN121927097A
A composite wound dressing and a method of making the same
CN122665170A