Portable near-infrared thermal control dPCR equipment and digital PCR method

Abstract

The invention discloses portable near-infrared thermal control dPCR equipment. The equipment comprises an equipment shell, a pull type placement groove, a near-infrared heating system, an imaging system and an operating system, a rectangular opening is formed in the front side of the lower part of the equipment shell, and the drawing type placement groove is horizontally moved into the inner space of the equipment shell through the rectangular opening to form a vacuum chamber; a chip or a reaction chamber filled with liquid drops is placed in the drawing type placing groove; the near-infrared heating system is installed at the bottom of the vacuum chamber and located under the pull-out type containing groove, and the near-infrared heating system comprises a box-shaped shell, a metal heat conduction plate, a near-infrared optical fiber and an exhaust fan. And the imaging system is arranged at the upper part of the vacuum chamber and is used for shooting an image of the chip or the reaction chamber in the drawing type placing groove. According to the invention, the problem that a user needs to transfer the micro-reaction chamber containing nucleic acid from the PCR thermal cycler to the fluorescent display equipment is solved, the tedious operation process is optimized, and the possibility of sample pollution is also reduced.

Description

Technical Field

[0001] The present invention relates to the technical field of biotechnology and molecular biology, and in particular to a portable near-infrared thermal-controlled dPCR device and a digital PCR method. Background Art

[0002] Digital PCR is the third generation of PCR technology after the first generation of ordinary PCR and the second generation of fluorescent quantitative PCR. Its principle is to fully dilute a sample and distribute it to different reaction units. Each unit contains less than or equal to one copy of the target molecule (DNA template). A separate and parallel PCR reaction is performed in each reaction unit. After the amplification, the fluorescent signal of each reaction unit is statistically analyzed to achieve absolute quantification and detection of rare alleles. The detection process of digital PCR includes system configuration, micro-reaction unit preparation, PCR amplification, and result analysis.

[0003] Compared with conventional PCR methods, digital PCR has the following advantages: 1. Absolute quantification: Conventional PCR quantification requires the development of a standard DNA curve with a known copy number. However, since the sample to be tested and the standard curve are not in the same system, there will be differences in conditions. In addition, the difference in PCR amplification efficiency affects the accuracy of the quantitative results. Digital PCR is not affected by the standard curve and amplification kinetics and can be absolutely quantified. 2. Low sample demand: Suitable for precious samples or samples with severe nucleic acid degradation 3. High sensitivity: Digital PCR divides the traditional PCR reaction system into tens of thousands of independent PCR reactions, which can accurately detect very small differences in target fragments, single copies, and even low-concentration mixed samples. And it can avoid the formation of non-homologous heteroduplexes. 4. High tolerance: Since the target sequence is distributed to multiple independent reaction systems, the interference of background signals and inhibitors on the reaction is significantly reduced, and the amplification matrix effect is greatly reduced.

[0004] However, dPCR also has some disadvantages, such as the high cost of digital PCR systems, limited throughput, and cumbersome operations.

[0005] Recently, a digital PCR method has been used to accurately quantify toxin nucleic acid molecules. However, most digital PCR methods involve cumbersome manual preparation or multiple expensive instruments and occupy a large area, so some researchers use a method that integrates a temperature control system with a fluorescent imaging system for the study of digital reaction kinetics and quality control of digital amplification results. However, a portable integrated digital PCR system with a simple workflow for accurate quantification of target nucleic acids has not yet been developed. Summary of the invention

[0006] The purpose of the present invention is to propose a portable near-infrared thermal control dPCR device and digital PCR method, which can realize convenient and accurate digital PCR operation. The device solves the problem that users need to transfer the micro-reaction chamber containing nucleic acids from the PCR thermal cycler to the fluorescent display device, optimizes the cumbersome operation process, greatly improves the user experience, and reduces the possibility of sample contamination.

[0007] In order to achieve the above technical objectives, the technical solution adopted by the present invention is:

[0008] In a first aspect, the present invention discloses a portable near-infrared thermally controlled dPCR device, the device comprising a device housing, a pull-out placement slot, a near-infrared heating system, an imaging system, and an operating system;

[0009] A rectangular opening is provided on the front side of the lower part of the device housing, and the pull-out placement groove is horizontally moved into the inner space of the device housing through the rectangular opening to form a vacuum chamber; a chip or a reaction chamber containing droplets is placed in the pull-out placement groove;

[0010] The near-infrared heating system is installed at the bottom of the vacuum chamber, directly below the pull-out placement slot, and includes a box-shaped shell, a metal heat-conducting plate, a near-infrared optical fiber, and an exhaust fan; the metal heat-conducting plate is embedded in the upper surface of the box-shaped shell to heat the pull-out placement slot; the near-infrared optical fiber is arranged outside the metal heat-conducting plate to detect the temperature of the metal heat-conducting plate; the exhaust fan is installed on the side of the box-shaped shell;

[0011] The imaging system is installed on the upper part of the vacuum chamber to take images of the chip or reaction chamber in the pull-out placement slot;

[0012] The operating system couples various systems into a whole through circuits, including a display touch screen, an external power supply and a USB interface; the display screen is used for users to set dPCR programs and obtain fluorescent images, and the USB interface is used for software upgrades and acquisition of experimental data.

[0013] Further, the imaging system includes an excitation light source, a high-resolution camera, an adjustable focus lens, an excitation filter, and an emission filter;

[0014] The excitation light sources are located on both sides of the upper part of the vacuum chamber, at an angle of 30° to the surface of the chip or reaction chamber, and are two green LEDs; the wavelength of the excitation filter is 480nm, and the wavelength of the emission filter is 520nm;

[0015] The high-resolution camera and the adjustable focus lens are used to capture images of the chip or reaction chamber.

[0016] Furthermore, the metal heat conducting plate is made of metal platinum sheet.

[0017] Furthermore, the heating area of ​​the metal heat conducting plate is 6×6 cm 2 .

[0018] Furthermore, an infrared thermal imager is installed in the vacuum chamber to measure the real-time temperature in the vacuum chamber.

[0019] Furthermore, the operating system includes WiFi and Bluetooth wireless transmission modules.

[0020] In a second aspect, the present invention discloses a digital PCR method based on a portable near-infrared thermal control dPCR device, the method comprising the following steps:

[0021] Dilute the nucleic acid sample to be tested to a preset concentration and prepare a reaction system with other PCR reagents;

[0022] Using a droplet generation chip or reaction chamber to distribute the reaction system into uniform droplets for subsequent nucleic acid amplification;

[0023] The chip or reaction chamber containing the droplets is placed in a pull-out placement slot, and then moved horizontally into the inner space of the device shell through a rectangular opening to form a vacuum chamber, so that the droplets can undergo digital PCR amplification in the vacuum chamber. During amplification, the droplet temperature is controlled in real time and fluorescent images are taken to analyze DNA abundance to obtain digital quantification results.

[0024] Compared with the prior art, the present invention has the following beneficial effects:

[0025] First, the portable near-infrared thermal control dPCR device and digital PCR method of the present invention, which consists of a near-infrared heating system, an imaging system and an operating system, can realize convenient and accurate digital PCR operation. The device solves the problem that users need to transfer the micro-reaction chamber containing nucleic acids from the PCR thermal cycler to the fluorescent display device, optimizes the cumbersome operation process, greatly improves the user experience, and reduces the possibility of sample contamination.

[0026] Second, the portable near-infrared thermal-controlled dPCR device and digital PCR method of the present invention have simple components, small size, and easy operation. It is expected to quickly achieve industrial large-scale mass production and be put into use in digital PCR amplification. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] Figure 1 It is a schematic diagram of the structure of the portable near-infrared thermal control dPCR device of the present invention;

[0028] Figure 2 Schematic diagram of near-infrared heating simulation amplification temperature.

[0029] The reference numerals are as follows: 1-device housing, 2-display touch screen, 3-pull-out slot, 4-metal heat conducting plate, 5-box-type housing, 6-shooting camera, 7-illumination light source. DETAILED DESCRIPTION

[0030] The embodiments of the present invention are further described in detail below in conjunction with the accompanying drawings.

[0031] The present invention discloses a portable near-infrared thermal control dPCR device, which includes a device housing 1, a pull-out placement slot 3, a near-infrared heating system, an imaging system and an operating system;

[0032] A rectangular opening is provided on the front side of the lower part of the device housing 1, and the pull-out placement slot 3 is horizontally moved into the inner space of the device housing through the rectangular opening to form a vacuum chamber; a chip or a reaction chamber containing droplets is placed in the pull-out placement slot 3;

[0033] The near-infrared heating system is installed at the bottom of the vacuum chamber, directly below the pull-out placement slot 3, and includes a box-shaped shell 5, a metal heat-conducting plate 4, a near-infrared optical fiber and an exhaust fan; the metal heat-conducting plate 4 is embedded in the upper surface of the box-shaped shell to heat the pull-out placement slot 3; the near-infrared optical fiber is arranged on the outside of the metal heat-conducting plate 4 to detect the temperature of the metal heat-conducting plate 4; the exhaust fan is installed on the side of the box-shaped shell 5;

[0034] The imaging system is installed on the upper part of the vacuum chamber to take images of the chip or reaction chamber in the pull-out placement slot 3;

[0035] The operating system couples various systems into a whole through circuits, including a display touch screen 2, an external power supply and a USB interface; the display touch screen 2 is used by the user to set the dPCR program and obtain fluorescent images, and the USB interface is used for software upgrades and acquisition of experimental data.

[0036] The present invention provides a portable near-infrared thermal control dPCR device, such as Figure 1 As shown, it includes the following components:

[0037] (1) Near-infrared heating system: It consists of a box-shaped housing 5, a metal heat-conducting plate 4, a near-infrared optical fiber, a vacuum chamber, and an exhaust fan. The heating area is 6×6 cm 2 . An infrared thermal imager is also embedded to measure the temperature in real time and provide feedback;

[0038] (2) Imaging system: It includes two excitation light sources, a high-resolution camera, an adjustable focus lens and an emission filter. The resolution of the camera 6 is 4384×3288 pixels, the illumination light source 7 is two green LEDs, the wavelength of the excitation filter is 480nm, and the wavelength of the emission filter is 520nm;

[0039] (3) Operating system: The various systems are coupled into a whole through circuits, including a display touch screen 2, a pull-out placement slot 3, an external power supply, and a USB interface. The display touch screen 2 is used by the user to set the dPCR program and obtain fluorescent images, and the USB interface can be used for software upgrades and acquisition of experimental data.

[0040] Among them, the near-infrared heating system has good thermal control stability, can provide fast and uniform temperature control, and can complete 40 cycles within 120 minutes.

[0041] Wherein, the metal heat conducting plate 4 in the near-infrared heating system is a metal platinum sheet.

[0042] The imaging system can provide uniform illumination and fluorescence images for the entire functional area. The illumination light source 7 is designed to be at an angle of 30° to the device surface to minimize the reflected light entering the camera 6.

[0043] Among other things, the operating system allows for wireless data transmission via WiFi and Bluetooth, enabling further integration into the electronic data management and analysis grid.

[0044] The present invention also protects a method for using the portable near-infrared thermal control dPCR device, comprising the following steps:

[0045] (1) First, the nucleic acid sample to be tested is diluted to an appropriate concentration, and a reaction system is prepared with other PCR reagents. Then, a droplet generation chip is used to distribute the reaction system into a large number of uniform droplets for subsequent nucleic acid amplification.

[0046] (2) placing the chip or reaction chamber containing the droplets in a near-infrared thermally controlled dPCR instrument through a pull-out placement slot for digital PCR amplification;

[0047] (3) The droplet temperature can be controlled in real time during amplification, and after amplification, fluorescent images can be taken to analyze DNA abundance and obtain digital quantification results.

[0048] Example: Droplet-based digital PCR for detecting nucleic acid fragments of wheat light bunt

[0049] This study provides an application of droplet digital PCR technology to detect nucleic acid fragments of wheat light stinking smut. Before PCR amplification, the sample is dropletized, that is, the reaction system containing nucleic acid molecules is divided into thousands of nanoliter droplets, each of which either does not contain the gene to be tested or contains one gene. After PCR amplification, each droplet is tested for fluorescence signals. Droplets with fluorescent signals are read as 1, and droplets without fluorescent signals are read as 0. The starting copy number or concentration of the gene to be tested can be obtained based on the Poisson distribution principle and the number and ratio of positive droplets. The following is the specific experimental process:

[0050] First, a droplet generation microfluidic chip is designed to generate droplets of 40 to 90 microns.

[0051] Then, primers were designed based on the nucleic acid sequence of the wheat light bunt gene fragment:

[0052] Upstream primer: TCCGTAGGTGAACCTGCGG

[0053] Downstream primer: TCCTCCGCTTATTGATATGC

[0054] A suitable PCR system was configured, and the feasibility was verified by in vitro amplification using a PCR instrument. The SDS gel electrophoresis diagram showed that the wheat light bunt gene fragment was successfully amplified. A modified TaqMan probe was added for fluorescent labeling.

[0055] The chip containing the nucleic acid droplets of wheat light stinking smut gene acid fragments was placed into the near-infrared thermal control dPCR device through a pull-out placement slot, and the droplets containing the nucleic acid of wheat light stinking smut gene fragments were amplified by near-infrared dPCR. The near-infrared power and cycle number were set using the software on the display screen, and the temperature was monitored in real time using an infrared thermal imager (FLIR) to achieve the temperature experience process. The programmed near-infrared illumination process was: 95℃ 3min, (95℃ 15s, 50℃ 15s, 72℃ 5min)*30 cycles, cooling to 4℃ ( Figure 2 ).

[0056] The designed TaqMan specific probe made the droplets containing the nucleic acid fragments of wheat light stinky smut fluoresce through irradiation with excitation light. The fluorescence images were taken by the imaging system and the nucleic acid abundance was analyzed. It was concluded that with the increase of the molecular concentration of the gene fragment of wheat light stinky smut, the proportion of statistical fluorescent microspheres increased, and finally agreed with the theoretical value of the nucleic acid molecules in the sample.

[0057] Although the preferred embodiments of the present application have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications falling within the scope of the present application.

[0058] Obviously, those skilled in the art can make various changes and modifications to the present application without departing from the spirit and scope of the present application. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A portable near-infrared thermal control dPCR device, characterized in that: The device comprises a device housing, a pull-out placement slot, a near-infrared heating system, an imaging system and an operating system; A rectangular opening is provided on the front side of the lower part of the device housing, and the pull-out placement groove is horizontally moved into the inner space of the device housing through the rectangular opening to form a vacuum chamber; a chip or a reaction chamber containing droplets is placed in the pull-out placement groove; The near-infrared heating system is installed at the bottom of the vacuum chamber, directly below the pull-out placement slot, and includes a box-shaped housing, a metal heat-conducting plate, a near-infrared optical fiber, and an exhaust fan; The metal heat-conducting plate is embedded in the upper surface of the box-shaped shell to heat the pull-out placement slot; the near-infrared optical fiber is arranged on the outside of the metal heat-conducting plate to detect the temperature of the metal heat-conducting plate; the exhaust fan is installed on the side of the box-shaped shell; The imaging system is installed on the upper part of the vacuum chamber to take images of the chip or reaction chamber in the pull-out placement slot; The operating system couples various systems into a whole through circuits, including a display touch screen, an external power supply and a USB interface; the display screen is used for users to set dPCR programs and obtain fluorescent images, and the USB interface is used for software upgrades and acquisition of experimental data.

2. The portable near-infrared thermal control dPCR device according to claim 1, characterized in that: The imaging system includes an excitation light source, a high-resolution camera, an adjustable focus lens, an excitation filter, and an emission filter; The excitation light sources are located on both sides of the upper part of the vacuum chamber, at an angle of 30° to the surface of the chip or reaction chamber, and are two green LEDs; the wavelength of the excitation filter is 480nm, and the wavelength of the emission filter is 520nm; The high-resolution camera and the adjustable focus lens are used to capture images of the chip or reaction chamber.

3. The portable near-infrared thermal control dPCR device according to claim 1, characterized in that: The metal heat conducting plate is made of metal platinum sheet.

4. The portable near-infrared thermal control dPCR device according to claim 1, characterized in that: The heating area of ​​the metal heat conducting plate is 6×6 cm 2 .

5. The portable near-infrared thermal control dPCR device according to claim 1, characterized in that: An infrared thermal imager is installed in the vacuum chamber to measure the real-time temperature in the vacuum chamber.

6. The portable near-infrared thermal control dPCR device according to claim 1, characterized in that: The operating system includes WiFi and Bluetooth wireless transmission modules.

7. A digital PCR method based on a portable near-infrared thermal control dPCR device, characterized in that: The method comprises the following steps: Dilute the nucleic acid sample to be tested to a preset concentration and prepare a reaction system with other PCR reagents; Using a droplet generation chip or reaction chamber to distribute the reaction system into uniform droplets for subsequent nucleic acid amplification; The chip or reaction chamber containing the droplets is placed in a pull-out placement slot, and then moved horizontally into the inner space of the device shell through a rectangular opening to form a vacuum chamber, so that the droplets can undergo digital PCR amplification in the vacuum chamber. During amplification, the droplet temperature is controlled in real time and fluorescent images are taken to analyze DNA abundance to obtain digital quantification results.

Images