Robinia pseudoacacia rejuvenation, cuttage propagation and rejuvenation effect evaluation method and system
By flattening the mother tree of the locust tree and using the rooting strips of that year for cuttings, the problems of the influence of juvenile and age effects in the existing technology were solved, and the rooting effect and juvenile degree were significantly improved, and the rejuvenation and cutting expansion of the locust tree were achieved.
Patent Information
- Application Number
- CN202510254863.X
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-05
- Publication Date
- 2025-06-06
AI Technical Summary
The existing locust cutting and tissue culture techniques fail to effectively consider the juvenile nature and age effects of the propagation materials, resulting in problems such as long rooting period, low rooting rate, and short seedlings, which affects the cultivation of asexual timber forests.
By flattening the mature locust tree, the rooting strips produced after flattening are taken for cuttings, and the effect is evaluated in combination with indicators such as the expression of young genes.
The rooting rate, average root length, average root number, rooting index and juvenile gene expression of cutting seedlings have been significantly improved, and the rejuvenation and cutting expansion of locust trees have been achieved, providing technical support for the cultivation of good varieties and large-scale production.
Smart Images

Figure CN120104946A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biological forest tree breeding, and in particular, relates to a method and system for evaluating the rejuvenation, cutting propagation and rejuvenation effects of Robinia pseudoacacia. Background Art
[0002] Asexual reproduction refers to a method of reproduction that does not require the sexual reproduction process of zygote formation and development, but directly produces offspring from a part of the biological mother's organs, tissues or cells, also known as vegetative reproduction. Commonly used asexual seedling cultivation methods include cuttings, grafting, root sprouting, tissue culture, etc.
[0003] Cutting technology is easy to obtain materials, has a short seedling raising cycle, and a large-scale reproduction. It has become the main means of asexual reproduction and seedling raising. Compared with asexual reproduction methods such as grafting, root sprouting, and tissue culture, cutting seedling raising has the advantages of low cost, high efficiency, good benefits, and convenient material acquisition; compared with traditional plant seed propagation, the improved method of cutting propagation can maintain the dominant traits of the mother tree, and the propagated seedlings have a higher genetic gain. It has gradually become the current development trend and has gradually entered a new era of directional breeding, directional cultivation, and directional utilization. The cutting material comes from a certain part of the mother plant and will be affected by the physiological age of the mother plant to a certain extent, showing age effect and position effect. If the mother plant is too old, it will show the characteristics of too long rooting period, low rooting rate, short new seedlings, early flowering and fruiting, and oblique growth in cuttings, which will cause huge economic losses to forestry production, especially timber forest production, and restrict the promotion and application of asexual forestry. Therefore, how to select propagation materials with lower physiological age, stronger juvenility and better rooting activity is the key to solving this technical problem.
[0004] Robinia pseudoacacia L. is a perennial deciduous broad-leaved tree of the genus Robinia in the Leguminosae family. It is native to southeastern North America and was introduced to Shandong, my country in the 19th century. It is an important introduced timber species in my country. Robinia pseudoacacia grows well under excellent site conditions, matures quickly, and has good wood properties and good toughness. It is also resistant to moisture and decay, and has long wood fibers. It is also used to make solid wood furniture. In recent years, the import volume of hard broadwood has dropped sharply. Robinia pseudoacacia medium and large diameter timber is in great demand in the construction market and is the raw material for high-quality solid wood flooring. Therefore, the cultivation of Robinia pseudoacacia large and medium diameter timber forests has broad prospects. In addition, Robinia pseudoacacia has a strong ability to sprout. After being pruned or stimulated, it can produce a large number of root sprouts and stake sprouts. It has been used as firewood and charcoal forests in many areas. Robinia pseudoacacia has also been included in the national science and technology support special research plan with the "Cultivation Technology of Robinia pseudoacacia and other Energy Forests". In addition, the research of Zhang Zijie and others has proved that RpTOE1 can be used as a marker gene for the juvenility of Robinia pseudoacacia. The expression level of RpTOE1 increases with the increase of the juvenility of the tissue, which lays a theoretical foundation for the breeding of high-quality Robinia pseudoacacia varieties.
[0005] However, current asexual propagation techniques such as Robinia pseudoacacia cuttings and tissue culture are mostly focused on promoting the rooting of materials, without considering the juvenility of the propagation materials and the effects of age effects. For example, patents with publication numbers CN118104485A and CN117502005A all use semi-lignified branches of Robinia pseudoacacia grown in the current year, without paying attention to the age of the mother plant for cuttings and the juvenility of the cuttings. This will create great technical difficulties and impacts on the cultivation of Robinia pseudoacacia asexual timber forests.
[0006] Some scholars have also proposed to use the method of flat cutting to take the newly sprouted branches on the felled pile for the rejuvenation of forest trees. For example, the patent with publication number CN113502349A cuts the mother plant to promote sprouting and repeatedly prunes it to form a "short pile platform" plant type, harvesting a large number of uniform, moderately thick and suitable cutting rejuvenation pile sprouts. However, the embodiments of the invention are the rejuvenation of tree species such as ginkgo, Chinese pine, and American poplar, and no research is conducted on Robinia pseudoacacia. The inventors of the present application found that the method could not achieve a good rejuvenation effect, and the rooting rate, rooting index, and growth status of the cutting seedlings were all lower than those of the mother tree before flat cutting. Therefore, it is necessary to use different breeding materials to improve the asexual reproduction technology of Robinia pseudoacacia. Summary of the invention
[0007] In order to solve the deficiencies in the prior art, the present invention provides a method and system for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia. Mature Robinia pseudoacacia mother trees are cut flat, and the root sprouts of Robinia pseudoacacia produced after the cutting are taken for cutting. The obtained cutting seedlings have significantly improved rooting rate, average root length, average root number, rooting index and rejuvenation gene expression compared with the cutting seedlings obtained without cutting. The invention solves the difficult problems of rejuvenation of adult Robinia pseudoacacia mother trees and cutting propagation, and provides technical support for the breeding and large-scale production of Robinia pseudoacacia varieties.
[0008] The present invention adopts the following technical solution.
[0009] The first aspect of the present invention discloses a method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia, comprising the following steps:
[0010] Cutting and rejuvenation: within the set cutting time, select the mother locust tree for cutting, obtain the stump, and apply healing agent on the cutting wound;
[0011] Selection of cutting young materials: within the set sampling time, select the root sprouts of Robinia pseudoacacia grown in the current year from the stumps, and carry out cutting in the greenhouse;
[0012] Rooting index statistics: After cutting, the rooting index of the cutting seedlings is counted and the rooting index is calculated;
[0013] Evaluation of rejuvenation effect: After the cutting seedlings have grown for a set period of time, the growth indexes and the expression of age marker genes are statistically analyzed, and combined with the rooting indexes, the rejuvenation effect evaluation is obtained.
[0014] Preferably, the trunk cutting time is before the tree buds sprout in spring, the Robinia pseudoacacia mother tree is a mature Robinia pseudoacacia mother tree of 30-40 years old, and the stump retention height is 8-20 cm when the trunk is cut.
[0015] Preferably, when selecting cuttings for young plants, root sprouts within 3 m of the stump are selected for cuttings.
[0016] Preferably, the set sampling time is the period of vigorous tree growth in the summer of that year.
[0017] Preferably, a full-day spraying device is used in the greenhouse and the relative humidity is maintained above 75%.
[0018] Preferably, the rooting indicators are rooting rate, average root length, average root number and new shoot length.
[0019] Preferably, the growth indicators are leaflet length, leaflet width, rachis length, new shoot length and shoot thickness.
[0020] Preferably, the age marker gene expression condition is obtained by taking young leaves to measure the expression level of Robinia pseudoacacia juvenility gene RpTOE1.
[0021] Preferably, the set growth time of the cutting seedlings is more than 4 months.
[0022] The second aspect of the present invention discloses a system for evaluating the effects of rejuvenating, propagating and rejuvenating Robinia pseudoacacia, based on the method for evaluating the effects of rejuvenating, propagating and rejuvenating Robinia pseudoacacia, comprising a rejuvenating module, a cutting module and an evaluation module;
[0023] The rejuvenation module is used to perform stem cutting and stubble treatment on Robinia pseudoacacia;
[0024] The cutting module is used to carry out cuttings on the rejuvenated Robinia pseudoacacia;
[0025] The evaluation module is used for collecting, processing and evaluating data of Robinia pseudoacacia after cutting.
[0026] Compared with the prior art, the beneficial effects of the present invention include at least:
[0027] The present invention systematically and accurately determines the rejuvenation level of seedlings from the perspective of phenotype and molecular biology, and uses multiple evidences such as the expression level of rejuvenation genes, rooting effect, and new shoot growth to prove the rejuvenation effect of propagation materials, making large-scale propagation more accurate.
[0028] The breeding method of the present invention overcomes the influence of age effect and position effect in asexual reproduction of trees, and can improve the survival rate of cuttings while retaining the genetic gain of the mother tree. It has the advantages of simple operation, low cost, high seedling raising efficiency, etc., and has extremely high promotion value. BRIEF DESCRIPTION OF THE DRAWINGS
[0029] Figure 1 is the growth condition of Example 1;
[0030] Figure 2 This is the growth condition of Comparative Example 1;
[0031] Figure 3 This is the growth condition of Comparative Example 2;
[0032] Figure 4 The relative expression level of RpTOE1 gene in stumped and unstumped cuttings seedlings. DETAILED DESCRIPTION
[0033] In order to make the purpose, technical scheme and advantages of the present invention clearer, the technical scheme of the present invention will be clearly and completely described below in conjunction with the drawings in the embodiments of the present invention. The embodiments described in this application are only embodiments of a part of the present invention, rather than all embodiments. Based on the spirit of the present invention, all other embodiments obtained by ordinary technicians in this field without making creative work belong to the protection scope of the present invention.
[0034] The present invention provides a method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia, comprising the following steps:
[0035] (1) Pruning and rejuvenation: Before the buds of trees sprout in spring, select mature Robinia pseudoacacia trees that are 30-40 years old for pruning and apply healing agents to the wounds to prevent infection by pathogens.
[0036] In a preferred but non-limiting embodiment of the present invention, the trunk cutting time of step (1) is generally carried out in early February to early March, and the remaining height of the stump is 8-20 cm, preferably about 10 cm.
[0037] (2) Selection of young cutting materials: In July of the same year, when trees are growing vigorously, select healthy and strong Robinia pseudoacacia root sprouts from the sample plot and carry out cuttings in the greenhouse.
[0038] In the step (2), root sprouts within 3m of the stump are selected for cuttings; a full-day spray device is used in the greenhouse to keep the relative humidity above 75%.
[0039] (3) Rooting index statistics: After the main root of the cuttings matures or 48 days after cutting, the rooting rate, average root length, average number of roots, and new shoot length of the cuttings are counted to calculate the rooting index.
[0040] (4) Evaluation of rejuvenation effect: When collecting root sprouts, select the tender branches of 30-40-year-old Robinia pseudoacacia mother trees that have not been pruned for cuttings. The cutting treatment and data statistics are the same as above.
[0041] While collecting root sprouts in the same year, we selected the stump sprouts grown on the stumps for cuttings. The cutting processing and data statistics were the same as above.
[0042] After the cuttings had grown for 4 months, the growth indexes and expression of age marker genes were statistically analyzed, and the rejuvenation effect was evaluated in combination with the rooting situation.
[0043] According to the research of Zhang Zijie and others, RpTOE1 can be used as a marker gene for the juvenility of Robinia pseudoacacia. The expression of RpTOE1 increases with the degree of juvenility of tissues, which lays a theoretical foundation for the breeding of Robinia pseudoacacia. Therefore, by measuring the expression of the Robinia pseudoacacia juvenility gene RpTOE1, the juvenility effect can be evaluated.
[0044] Specifically, the young branches of the Robinia pseudoacacia mother tree used in step (4) are the lowest branches of the Robinia pseudoacacia mother tree; the growth indicators are leaflet length, leaflet width, leaf axis length, new shoot length, and shoot thickness, and young leaves are taken to measure the relative expression of the Robinia pseudoacacia juvenility gene RpTOE1. The nucleotide sequence of the Robinia pseudoacacia juvenility marker gene RpTOE1 is as follows:
[0045] atgttagatcttaatctgaatgccgattcgactcagaacgatgactcgctcgtcgtgttggataagtttccagaagcatcttctg
[0046] gaacctccaattcctccatcgtgaatgctgaggggtcaagtaacgaggactcgtgttccacacgcgccggggacgcgttca
[0047] cctacaattttggtatccttaaggtggaaggagggaacggcgtcgttgcaaccaaggagcttttcccggtgcagccttcaac
[0048] gtcttcgattttggcaaggaagagcttggtggatctctcgctggatcatcatcatcgaggccaaaacgacgacgttaatttggt
[0049] tcaggttcagcaacaacagcctcaggcgaagaagagtaggaggtccaaggtctcggagttctcagtagaggatgaggatca
[0050] cctttatagaagaactggaagatgggaatcgcatatctgggattgcgggaaacaagtctatttgggtggatttgacactgct
[0051] catgccgctgctagagcctatgatcgagctgctatcaagttcaggggacttgatgctgacatcaatttcaatctcgttgattatg
[0052] aggaggatatgaaacagatgacaaatctttccaaggaggaattcgtgcacatactacgtcgccacagtaccggtttctcaag
[0053] ggggagctcaaaataccgaggagtgacacttcacaaatgtggccgttgggaagctcgaatgggacaattccttggcaaaa
[0054] aggcttatgacaaggcagctatcaagtgcaatggagaagaggcagtgactaacttcgagccaagtacatatgaaagcgag
[0055] atgaaaccggaagctattaatgaaggtagcagtcacaatcttgacctcaatttgggcatagcaaccccaggagacatggtccaa
[0056] aagaaaacaggggcatcttcagttccagtccgtcccttacaacttgcaccctggaagaagttcaaggatggagactaatgt
[0057] taattcagttatcggtgatccatctttgaaaaggctcgttgtaactgaagagcgtccttctgtatggaatgccacgtattccagtt
[0058] tctttcccagtgaggaaagagcagagagaatgggcatagatccttcggaaggactccgcaactgggcgtggcaaacacat
[0059] ggccaggtcactgctaccccagttccaccgttctctagtgcagcatcatcaggattctcaatttcagctacctttccatccactg
[0060] ccatctttccaacaaaatctacgaactcaattccccagagcatctgtttcacttcatccagtgcatctggtaacaatgcagctcaatacttctaccaggtgaagtccccgcaagcaccaccctag (SEQ ID NO.1)
[0061] Example 1
[0062] The present invention provides a method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia, comprising the following steps:
[0063] (1) Pruning and rejuvenation: In March 2024, 10 30-year-old adult Robinia pseudoacacia mother trees with good growth and similar breast diameter were selected from Xishan Forest Farm in Beijing for pruning, retaining the trunk height of 10-15 cm. Healing agent was applied to the wound to prevent infection by pathogens, and the wound was marked.
[0064] (2) Selection of young cutting materials: In July 2024, select healthy root sprouts within 3m of the previously cut stumps, collect them along the base with pruning shears, cut off some leaves, and immediately go to the greenhouse for cuttings.
[0065] (3) Cutting and seedling management: The cutting experiment was conducted in the No. 3 research greenhouse of Beijing Academy of Landscape Architecture and Greening Sciences. The collected different types of tender branches of the current year were first soaked in clean water for 10 minutes. Then the cuttings were taken out and cut into cuttings with a length of 10-15 cm and a thickness of 0.4-1.0 cm. The upper end of the cutting was cut flat, about 1 cm away from the upper bud, and the lower end was cut at a 45° angle, leaving 1-2 bud sites. Soaked in 1000 times carbendazim solution for 10 minutes, and then soaked in 500 mg / L naphthaleneacetic acid for 30 minutes. The cutting matrix was vermiculite:perlite at a ratio of 2:1, disinfected with carbendazim and potassium permanganate, and 3 plug trays were treated each time, with 21 plants in each plug tray, three replicates, and a total of 63 plants. After cutting, the plug trays were placed under a 24-hour fully automated spray device for growth, with a spray frequency of 4 times per hour, each for 10 seconds. The main management measures are to prevent high temperature hazards exceeding 35°C, control the relative humidity at above 75%, promptly remove rotten and infected cuttings, and disinfect with carbendazim every week.
[0066] (4) Rooting index statistics: 48 days after cutting, the rooting rate, average root length, average number of roots, and new shoot length of the cuttings were counted, the rooting index was calculated, and the cuttings were transplanted into pots filled with peat soil.
[0067] (5) Evaluation of the rejuvenation effect: 4 months after cutting, the growth indexes were counted and fresh leaves were collected to measure the expression of the age marker gene RpTOE1. The relative expression of RpTOE1 was measured by Beijing Ruiboxing Biotechnology Co., Ltd. using fluorescent quantitative PCR. The rejuvenation effect was evaluated in combination with the rooting situation.
[0068] Comparative Example 1
[0069] The present invention provides a method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia, comprising the following steps:
[0070] (1) Selection of cutting materials: In July 2024, in the same sample plot as in Example 1, select 30-year-old mature mother trees of Robinia pseudoacacia that have not been pruned, use high-branch shears to collect the tender branches of the current year at the bottom of the tree, cut off some leaves, and immediately go to the greenhouse for cuttings after collection.
[0071] (2) Cutting and seedling management: the same as in Example 1.
[0072] (3) Rooting index statistics: the same as in Example 1.
[0073] (4) Evaluation of the rejuvenation effect: Same as in Example 1.
[0074] Comparative Example 2
[0075] The present invention provides a method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia, comprising the following steps:
[0076] (1) Selection of cutting materials: In July 2024, in the same sample plot as in Example 1, select healthy sprouts from the previously cut stumps, cut off some leaves, and immediately go to the greenhouse for cuttings after collection.
[0077] (2) Cutting and seedling management: the same as in Example 1.
[0078] (3) Rooting index statistics: the same as in Example 1.
[0079] (4) Evaluation of the rejuvenation effect: Same as in Example 1.
[0080] The cutting rooting statistics of the embodiments and comparative examples are shown in Table 1.
[0081] Table 1 Statistics of rooting of cuttings
[0082]
[0083] Note: Duncan multiple comparison was used. Different letters indicate significant differences at the 0.05 level.
[0084] It can be seen from Table 1 that after using root sprouts for cuttings, the rooting rate, average shoot length, average number of roots, average root length, and rooting index of the cuttings were significantly improved. Compared with Comparative Example 1, the rooting rate of Example 1 increased by 42.87%, the average shoot length increased by 74.9%, the average number of roots increased by 47.5%, the average root length increased by 1.9 times, and the rooting index increased by 5.11 times, which were extremely significant. Compared with Comparative Example 2, the rooting rate of Example 1 increased by 2.81 times, the average shoot length increased by 71.21%, the average number of roots increased by 34.1%, the average root length increased by 83.93 times, and the rooting index increased by 8.37 times, which were extremely significant.
[0085] The morphological index statistics of the embodiments and comparative examples after 4 months of growth are shown in Table 2.
[0086] Table 2 Statistics of morphological indicators after 4 months of growth
[0087]
[0088] Note: Duncan multiple comparison was used. Different letters indicate significant differences at the 0.05 level.
[0089] As shown in Table 2, after using the root sprouts for cutting, the length of the new shoot, the thickness of the tip, the length of the leaflets, the width of the leaflets, and the length of the rachis of the cutting seedlings are all improved. Compared with Comparative Example 1, the length of the new shoot in Example 1 is increased by 66.76%, the thickness of the tip is increased by 31.15%, the length of the leaflets is increased by 29.63%, the width of the leaflets is increased by 16.67%, and the length of the rachis is increased by 35.04%. Compared with Comparative Example 2, the length of the new shoot in Example 1 is increased by 62.3%, the thickness of the tip is increased by 14.29%, the length of the leaflets is increased by 33.59%, and the length of the rachis is increased by 22%.
[0090] contrast Figure 1-3 It can be seen that after 4 months of growth, the root growth, taproot number and taproot length of the seedlings using root sprouts for cuttings were better than those of the seedlings without pruning treatment and the seedlings using stake sprouts for cuttings. Figure 4 It can be seen that the relative expression level of the seedling rejuvenation gene RpTOE1 in Example 1 is greater than that in the seedlings of Comparative Examples 1 and 2.
[0091] In summary, the rooting effect, growth condition and juvenility degree of Robinia pseudoacacia cuttings obtained by the method are significantly improved, and the method and evaluation indexes adopted by the present invention have high promotion value.
[0092] The present invention also provides a system for evaluating the effects of rejuvenating, propagating and rejuvenating Robinia pseudoacacia, based on the method for evaluating the effects of rejuvenating, propagating and rejuvenating Robinia pseudoacacia, comprising a rejuvenating module, a cutting module and an evaluation module;
[0093] The rejuvenation module is used to perform stem cutting and stubble treatment on Robinia pseudoacacia;
[0094] The cutting module is used to collect root sprouts from the rejuvenated Robinia pseudoacacia for cutting;
[0095] The evaluation module is used for collecting, processing and evaluating data of Robinia pseudoacacia after cutting.
[0096] Compared with the prior art, the beneficial effects of the present invention include at least:
[0097] The present invention systematically and accurately determines the rejuvenation level of seedlings from the perspective of phenotype and molecular biology, and uses multiple evidences such as the expression level of rejuvenation genes, rooting effect, and new shoot growth to prove the rejuvenation effect of propagation materials, making large-scale propagation more accurate.
[0098] The breeding method of the present invention overcomes the influence of age effect and position effect in asexual reproduction of trees, and can improve the survival rate of cuttings while retaining the genetic gain of the mother tree. It has the advantages of simple operation, low cost, high seedling raising efficiency, etc., and has extremely high promotion value.
[0099] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention rather than to limit it. Although the present invention has been described in detail with reference to the above embodiments, ordinary technicians in the relevant field should understand that the specific implementation methods of the present invention can still be modified or replaced by equivalents, and any modifications or equivalent replacements that do not depart from the spirit and scope of the present invention should be covered within the scope of protection of the claims of the present invention.
Claims
1. A method for evaluating the effects of rejuvenating, propagating and rejuvenating Robinia pseudoacacia, characterized in that: The steps include: Cutting and rejuvenation: within the set cutting time, select the mother locust tree for cutting, obtain the stump, and apply healing agent on the cutting wound; Selection of cutting young materials: within the set sampling time, select the root sprouts of Robinia pseudoacacia grown in the current year from the stumps, and carry out cutting in the greenhouse; Rooting index statistics: After cutting, the rooting index of the cutting seedlings is counted and the rooting index is calculated; Evaluation of rejuvenation effect: After the cutting seedlings have grown for a set period of time, the growth indexes and the expression of age marker genes are statistically analyzed, and combined with the rooting indexes, the rejuvenation effect evaluation is obtained.
2. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The trunk cutting time is before the tree buds sprout in spring, the Robinia pseudoacacia mother tree is a mature Robinia pseudoacacia mother tree of 30-40 years old, and the stump retention height is 8-20 cm when the trunk is cut.
3. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: When selecting cuttings for rejuvenation, choose root sprouts within 3m of the felled stump for cuttings.
4. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The sampling time is set to be the period of vigorous tree growth in the summer of that year.
5. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: A full-day spray device is used in the greenhouse, and the relative humidity is maintained above 75%.
6. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The rooting indexes are rooting rate, average root length, average root number and new shoot length.
7. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The growth indicators are leaflet length, leaflet width, rachis length, new shoot length and shoot thickness.
8. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The age marker gene expression condition is to take young leaves to measure the expression level of Robinia pseudoacacia juvenility gene RpTOE1.
9. The method for evaluating the rejuvenation, cutting propagation and rejuvenation effect of Robinia pseudoacacia according to claim 1, characterized in that: The set growth time of the cutting seedlings is more than 4 months.
10. A system for evaluating the effects of rejuvenation, cutting propagation and rejuvenation of Robinia pseudoacacia, based on a method for evaluating the effects of rejuvenation, cutting propagation and rejuvenation of Robinia pseudoacacia according to any one of claims 1 to 9, characterized in that: Including replanting module, cutting module and evaluation module; The rejuvenation module is used to perform stem cutting and stubble treatment on Robinia pseudoacacia; The cutting module is used to carry out cuttings on the rejuvenated Robinia pseudoacacia; The evaluation module is used for collecting, processing and evaluating data of Robinia pseudoacacia after cutting.
Citation Information
Patent Citations
Tree aging space-time pattern identification, stumping and rejuvenation and cuttage large-scale breeding method
CN113502349A
Robinia pseudoacacia semi-yellow twig cutting seedling method
CN117502005A
Facility cutting seedling raising method for new robinia pseudoacacia variety
CN118104485A