Seed production method of high-yield laying duck auto-sexing commercial line

Abstract

The invention discloses a seed production method of a high-yield laying duck auto-sexing commercial line. The accuracy of the method is close to 100% and is obviously higher than that of artificial anal turning for male and female identification; the speed is high, and the production efficiency can be improved by 5-10 times; the labor intensity is low, and fatigue of hands, eyes and the like is avoided; the technical requirement is low; and disease transmission is avoided. According to the seed production method provided by the invention, the low heritability character heterosis is fully utilized, the egg laying performance is high, and the egg yield of 66 weeks old is close to 300; eggshells are green shells and accord with consumption preferences of Chinese people; the feather color of the adult female duck is light brown yellow, slaughtering and processing are facilitated, and the value of the obsolete duck is improved; the mode is suitable for large-scale popularization and application.

Description

Technical Field

[0001] The present invention relates to a method for breeding a high - egg - producing duck self - sexing matching line, belonging to the field of duck breeding. Background Art

[0002] In the production of egg - type poultry, early sex identification is crucial. Identifying male poultry that cannot lay eggs at an early stage not only helps save breeding space but also effectively reduces unnecessary feed waste and lowers breeding costs. In the production of laying hens, feather color and sex - linked genetic traits of feather color are commonly used for self - sexing. However, in the production of laying ducks, gender identification still mainly relies on the manual eversion of the cloaca technique. Manual eversion of the cloaca for gender identification is a labor - intensive technique with extremely high technical requirements. A skilled gender identifier can identify 800 to 1200 newly hatched chicks per hour, with an accuracy rate of about 95%. The labor intensity of this process is extremely high, and at the same time, they are required to master delicate eversion techniques. Once the technique is not delicate enough, it may cause damage to the cloaca of the chicks, resulting in unnecessary losses. Moreover, eversion of the cloaca for identification is prone to cross - contamination of feces, thereby reducing the quality and survival rate of chick rearing. In contrast, the self - sexing techniques based on feather color and feather speed have low requirements for the identification personnel. With a little guidance, the gender identification work can be completed with high quality and quantity, and the identification accuracy rate is high, the speed is fast, and the labor intensity is small. However, so far, no feather color and feather speed traits that can be used for self - sexing have been found in laying ducks. In view of this, exploring sex - linked genetic traits of duckling feather color or feather speed and establishing a method for self - sexing laying ducks based on feather color are of great significance for replacing the labor - intensive and high - technical - requirement manual eversion of the cloaca for gender identification and meeting the needs of modern laying duck production. Summary of the Invention

[0003] Object of the Invention: The technical problem to be solved by the present invention is to provide a method for breeding a high - egg - producing duck self - sexing matching line, effectively breaking through the technical bottleneck of the existing manual eversion of the cloaca for gender identification in laying ducks, which has a large labor intensity, high technical requirements, and is prone to disease transmission.

[0004] Technical Solution: To solve the above - mentioned technical problem, the present invention provides a method for cultivating self - sexing ducks based on feather color, including the following steps: using a brown - yellow variety as the male parent; using a black - olive - colored duck variety as the female parent for cross - matching, and self - sexing male and female of the F 1 generation through feather color. The male ducklings of the F 1 generation show black - olive color, and the female ducklings of the F 1 generation show gray - yellow color.

[0005] Among them, the male parent includes brown - colored domestic ducks.

[0006] Among them, the female parent includes Jinding ducks.

[0007] The present invention also provides a method for improving the egg production of ducks, which includes the following steps: using a brownish-yellow variety as the male parent; using a dark olive-colored duck variety as the female parent for cross-matching, and differentiating the sexes of F 1 generation according to feather color, the male ducklings of F 1 generation show dark olive color, and the female ducklings of F 1 generation show grayish-yellow color; the offspring of male and female ducklings can obtain high egg production.

[0008] The present invention selects duck varieties with different feather colors (the feather colors of ducklings mainly include dark olive color, brownish-yellow color, grayish-yellow color, etc.), conducts complete diallel crosses, and finds that the reciprocal cross results of dark olive-colored ducklings and brownish-yellow ducklings are inconsistent. The sex-linked genetic traits of duckling feather color are excavated, and a method for breeding a high-yield egg duck sexing strain is proposed.

[0009] The present invention uses a method combining family and individual to conduct population sub-selection on traits such as the egg production of 66-week-old ducklings of duck varieties showing dark olive color and brownish-yellow color, so as to improve their egg production.

[0010] Beneficial effects: Compared with the prior art, the present invention has the following remarkable advantages:

[0011] (1) Compared with manual vent sexing, the accuracy of the present invention is close to 100%, which is significantly higher than that of manual vent sexing.

[0012] (2) Compared with manual vent sexing, the present invention is fast, and the production efficiency can be increased by 5-10 times; the labor intensity is small, avoiding fatigue of hands and eyes, etc.; the technical requirements are low and disease transmission will not be caused.

[0013] (3) The breeding method proposed by the invention makes full use of the heterosis of low heritability traits, has high egg production performance, and the egg production at 66 weeks of age is close to 300; the eggshell is blue, meeting the consumption preference of Chinese people; the feather color of adult female ducks is light brownish-yellow, which is conducive to slaughter and processing, improving the value of culled ducks; this mode is suitable for large-scale popularization and application. Description of the Drawings

[0014] Figure 1 It is a schematic diagram of the breeding method for a high-yield egg duck sexing strain;

[0015] Figure 2 It is the reciprocal cross result of dark olive-colored ducklings and brownish-yellow ducklings. Detailed Embodiments

[0016] The technical solution of the present invention will be further described below with reference to the drawings.

[0017] This embodiment provides a breeding method for a high-yield egg duck sexing strain, and the specific process is as follows:

[0018] (1) Exploration of sex-linked genetic traits in ducks: Classify and organize the down colors of duck breeds in China. Select duck breeds with different down colors (the down colors of ducklings mainly include black olive, brown yellow, gray yellow, etc.) (Table 1).

[0019] Table 1

[0020]

[0021] (1) Select ducks with yellow down and ducks with non-yellow down for hybridization. The results of reciprocal crosses are the same, and the F1 shows various types such as black feathers and gray feathers. Select ducks with gray-yellow down and ducks with brown-yellow down for hybridization. The results of reciprocal crosses are the same, and the F1 shows gray-yellow in both cases. None of the above multiple hybridization combinations can achieve sex identification of ducklings by down color.

[0022] (2) Select ducks with black olive and brown yellow down for hybridization. The results of reciprocal crosses are inconsistent. The orthogonal group shows light olive, and the reciprocal cross group shows gray yellow. According to the above genetic segregation phenomenon, it is considered that this phenomenon is controlled by two pairs of alleles. The black olive gene (E) shows incomplete dominant inheritance, and the plumage dilution gene (d) shows sex-linked recessive inheritance. This combination can achieve sex identification of ducklings by down color ( Figure 2 ).

[0023] (2) Select excellent laying duck breed materials with sex-linked inheritance of plumage color: Among many duck genetic resources in China, select the Jinding duck population carrying the black olive gene (EEZ D Z D , EEZ D W) and the brown Caiya duck population carrying the brown yellow gene (eeZ d Z d , eeZ d W) for ducklings.

[0024] (3) Breed and improve excellent laying duck breeds with sex-linked inheritance of plumage color: Use the method combining family and individual to carry out population sub-generation breeding on traits such as egg production at 66 weeks of age for Jinding ducks and brown Caiya ducks, improve their egg production, and the genetic progress is about 2 per generation.

[0025] (4) Hybrid matching production: Adopt the method of combining breeding and hybrid utilization. Use brown Caiya ducks as the male parent (eeZ d Z d ) and Jinding ducks as the female parent (EEZ D W) for hybrid matching. The F1 can identify the sex of ducklings by down color. Male ducklings show black olive, and female ducklings show gray yellow ( Figure 1 ).

[0026] (5) Offspring sex verification and performance determination: After sexual maturity, the accuracy of sex identification by feather color of the offspring of this combination was found to be 100%. PCR technology was used for identification (Primer F: TGCAGAAGCAATATTACAAGT; R: AATTCATTATCATCTGGTGG; PCR reaction system: 1 μg of genomic DNA extracted as template, 0.5 μl of primer F (10 μm), 0.5 μl of primer R (10 μm), 10 μl of 2× Taq PCR MasterMixⅡ, supplemented with ddH 2 O to 20 μl; PCR program: pre-denaturation at 94 °C for 3 min, then enter the cycle amplification stage: 94 °C for 30 s → 51 °C for 30 s → 72 °C for 30 s, cycle 35 times, and finally amplify at 72 °C for 5 min and store at 4 °C). The accuracy of sex identification by feather color of the offspring of this combination was 98.3%. The egg production of the offspring of this combination at 66 weeks of age was close to 300. The eggshell was green, and the feather color of adult female ducks was light brownish-yellow, which was beneficial for slaughter and processing and increased the value of culled ducks.

Claims

1. A method for breeding male and female ducks with different feather colors, characterized in that: The following steps are involved: The brown-yellow duck breed is used as the male parent, and the black-olive duck breed is used as the female parent for hybridization and matching. The male and female F1 generation are distinguished by feather color. The male F1 generation ducklings are black olive in color, and the female F1 generation ducklings are grayish yellow in color.

2. The cultivation method according to claim 1, characterized in that: The brown-yellow feathers are inherited as a sex-linked recessive trait.

3. The cultivation method according to claim 1, characterized in that: The black olive feathers are inherited in a sex-linked dominant manner.

4. The cultivation method according to claim 1, characterized in that: The male parent includes brown duck.

5. The cultivation method according to claim 1, characterized in that: The female parent includes Jinding duck.

6. A method for increasing egg production in ducks, characterized in that: The following steps are involved: The brown-yellow duck breed is used as the male parent, and the black-olive duck breed is used as the female parent for hybridization and matching. The male and female F1 generation are distinguished by feather color. The F1 generation male ducklings are black olive in color, and the F1 generation female ducklings are gray-yellow in color. The offspring of male and female ducklings can achieve high egg production.

7. The cultivation method according to claim 6, characterized in that: The male parent includes brown duck.

8. The cultivation method according to claim 6, characterized in that: The female parent includes Jinding duck.

Images