F protein mutant of respiratory syncytial virus as well as combination and application of F protein mutant

Abstract

The invention discloses an F protein mutant of a respiratory syncytial virus, and a combination and application thereof. The amino acid sequence of the F protein mutant comprises one or more mutations selected from the group consisting of disulfide bond mutations, cavity filling mutations, electrostatic mutations, proline mutations and N-linked glycosylation mutations relative to the amino acid sequence of the wild-type F protein of the respiratory syncytial virus. The invention also discloses nucleic acids encoding the F protein mutant or a combination containing the F protein mutant, and application of the F protein mutant or the combination containing the F protein mutant in preparation of drugs (such as mRNA vaccines) for preventing diseases caused by the respiratory syncytial virus. The stability of the conformation before F protein fusion is effectively improved, and the protective efficacy of the RSV vaccine is improved.

Description

Technical Field

[0001] The present invention belongs to the technical field of mRNA vaccines, and specifically relates to an F protein mutant of respiratory syncytial virus, a combination thereof, and applications thereof. Background Art

[0002] Respiratory syncytial virus (RSV) is one of the important respiratory virus infections globally and is the most important cause of acute lower respiratory tract infections (ALRIs) that cause hospital outpatient visits in infants and young children. From the development of formalin-inactivated whole virus RSV preparations (FI-RSV) in the 1960s to the approval and marketing of the first RSV vaccine, Arexvy (preF / monovalent / single immunization), developed by GlaxoSmithKline (GSK) in 2023 for the prevention of lower respiratory diseases caused by RSV in people aged 60 and above, the RSV vaccine has undergone a long R & D process. In the same year, the US FDA approved the marketing of Pfizer's RSV bivalent vaccine, Abrysvo (preF / bivalent / single immunization). The RSV vaccines of GSK and Pfizer are both subunit vaccines targeting the prefusion conformation of the RSV F protein antigen. Currently, the mature technology of RSV vaccines is mostly the recombinant protein vaccine technology route, and the fastest-progressing RSV mRNA vaccine is Moderna mRNA-1345 (mRNA preF / monovalent / single immunization), but its efficacy is worse than that of GSK's Arexvy (efficacy for more than 2 symptoms: 83.7% < 94.1%).

[0003] Currently, the existing RSV vaccines still have the following defects:

[0004] (1) The protective efficacy of RSV monovalent vaccines may be insufficient

[0005] The RSV F protein is relatively conserved among RSV strains. The amino acid homology of the F protein in the A serotype is 96.1% - 100%, in the B serotype is 97.9% - 100%, and between the A and B serotypes is 88.3% - 90.9%. Nucleic acid substitutions and nonsense mutations often occur in the F gene. Therefore, the F protein can induce cross - protective immunity and is most effective in inducing neutralizing antibodies. The commercially available or investigational GSK Arexvy and Moderna mRNA - 1345 vaccines are both monovalent RSV F protein vaccines (A2 strain). Although they provide protective immunity against B subtype strains, a study found (Michelle C. Crank et al., A proof of concept for structure - based vaccine design targeting RSV in humans. Science 365, 505 - 509 (2019). DOI: 10.1126 / science.aav9033) that compared with the A subtype, their protective immunity is about 4 - 5 times lower.

[0006] (2)There is still room for improvement in the pre - fusion conformation stabilization technology of the F protein

[0007] The F protein has two conformations - pre - fusion (Pre - F) and post - fusion (Post - F) states. Pre - F is a metastable structure. When the virus fuses with the cell, Pre - F transforms into the stable Post - F. This process can also occur spontaneously, and various influencing factors such as temperature and osmotic pressure can trigger the conformational change of Pre - F. According to research, 6 antigenic sites (Ø and I to V) have been identified in the pre - fusion and / or post - fusion F protein. Among them, epitopes II and IV are present in both pre - fusion and post - fusion F proteins, while V and Ø are specific antigenic sites of the pre - fusion F protein, and the post - fusion F protein does not have these two epitopes. Most RSV neutralizing activities in serum are only against the antigenic sites of the pre - fusion F protein. Therefore, to enhance the induction of potent antibodies, vaccine sequences are designed with soluble variants of RSV F that stably expose the antigenic site Ø. Commonly used conformation stabilization techniques include introducing new disulfide bond mutations, cavity - filling mutations, etc., such as DS - Cav1 (manufacturer: NIAID, subunit vaccine).

[0008] In 2016, researchers such as Zhang L and Flynn JA (Flynn JA, Durr E, Swoyer R, Cejas PJ, Horton MS, Galli JD, Cosmi SA, Espeseth AS, Bett AJ, Zhang L. Stability Characterization of a Vaccine Antigen Based on the Respiratory Syncytial Virus Fusion Glycoprotein. PLoS One. 2016 Oct 20;11(10):e0164789. doi:10.1371 / journal.pone.0164789.) evaluated the stability of DS-Cav1 using the D25 and 4D7 antibody detection methods. The research results showed that after long-term storage at 4°C (after 14 days or 102 days), DS-Cav1 underwent conformational changes, adopted an alternative structure, lost the site Ø epitope, and gained the ability to bind 4D7, indicating that the structural integrity of DS-Cav1 was impaired during storage at 4°C. Therefore, to enhance the stability of the F protein structure, further iterative structural optimization and improvement are required. Summary of the Invention

[0009] To solve the technical problems of insufficient protective efficacy of RSV vaccines and unstable pre-fusion conformation of the F protein in the prior art, the present invention provides an F protein mutant of respiratory syncytial virus, its combination, and its application.

[0010] The present invention effectively improves the stability of the pre-fusion conformation of the F protein through one or more combinations of disulfide bond mutations, cavity filling mutations, electrostatic mutations, proline mutations, and N-linked glycosylation mutations, as well as artificial modification techniques such as sequence truncation or sequence deletion.

[0011] The mRNA vaccine of respiratory syncytial virus provided by the present invention contains RNA encoding the F glycoprotein of respiratory syncytial virus or its variant, and the vaccine can prevent respiratory syncytial virus infection and its complications.

[0012] The present invention also provides a composition of RSV F protein or mRNA encoding it, which contains or encodes and expresses two RSV F protein variants with stabilized pre-fusion conformations, and can efficiently induce neutralizing antibody responses against RSV subtype A and subtype B. The two F proteins are from the globally dominant epidemic strains, strain A23, B6, or other A and B subtype strains.

[0013] To solve the above technical problems, the present invention provides the following technical solutions:

[0014] One of the technical solutions of the present invention: an F protein mutant of respiratory syncytial virus, the amino acid sequence of the F protein mutant contains one or more mutations selected from disulfide bond mutations, cavity filling mutations, electrostatic mutations, proline mutations, and N-linked glycosylation mutations relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus.

[0015] As used herein, mutant means that the sequence contains one or more of the following mutations relative to the wild-type F protein of respiratory syncytial virus: sequence truncation, site mutation; site mutation means that it can carry one or more amino acid mutations, such as deletion, insertion, or substitution, replacement, or permutation. Preferably, the mutation is a substitution.

[0016] In a specific embodiment of the present invention, the mutation is selected from:

[0017] a) Disulfide bond mutation;

[0018] b) Cavity filling mutation;

[0019] c) Electrostatic mutation;

[0020] d) Proline mutation;

[0021] e) N-linked glycosylation mutation;

[0022] f) A combination of at least one disulfide bond mutation, at least one cavity filling mutation, and at least one electrostatic mutation;

[0023] g) A combination of at least one disulfide bond mutation, at least one cavity filling mutation, and at least one proline mutation;

[0024] h) A combination of at least one disulfide bond mutation, at least one cavity filling mutation, at least one electrostatic mutation, and at least one proline mutation; and,

[0025] i) A combination of at least one disulfide bond mutation, at least one cavity filling mutation, at least one electrostatic mutation, at least one proline mutation, and at least one N-linked glycosylation mutation.

[0026] In a specific embodiment of the present invention, the mutation satisfies one or more of the following conditions:

[0027] (1) The disulfide bond mutation includes one or more amino acid residues selected from positions 102, 243, 490, 494, and 495 mutated to C;

[0028] (2) The cavity filling mutation includes one or more of the amino acid residue at position 179 mutated to I, the amino acid residue at position 213 mutated to Y, and the amino acid residue at position 301 mutated to L;

[0029] (3) The electrostatic mutation includes the mutation of the amino acid residue at position 238 to H, and / or the mutation of the amino acid residue at position 54 to E;

[0030] (4) The proline mutation includes the mutation of one or more amino acid residues selected from positions 213, 215, and 217 to P; and,

[0031] (5) The N-linked glycosylation mutation includes the mutation of one or more amino acid residues selected from positions 172, 180, 398, 253, 372, 402, and 491 to N.

[0032] It is known in the art that the amino acid homology of the F protein within the RSV AB subtype is >95%, and the amino acid homology between subtypes A and B is 88.3% - 90.9%, which is relatively conserved. Among them, the nucleotide (amino acid) homology of the RSV F protein within subtypes A and B is relatively high, being 95.9% - 100% (98.3% - 100%) and 97.5% - 100% (98.7% - 100%) respectively, and between subtypes it is 83.2% - 84.9% (93.1% - 95.1%) (reference: DOI: 10.3760 / cma.j.issn.1003 - 9279.2015.05.006). Moreover, the full length of the F protein sequence of the RSV A / B subtype is 574 aa, so it can be ensured that the mutated sites correspond to the same position on different strains. In the publicly available pre-clinical and clinical articles, although the Pre-F mutants are mostly mutated with the A2 strain, the research results show cross-protective effects among different subtypes. The present invention studied the design of the same mutation sites on the F proteins of 4 strains: A2 strain, B18537 strain, A23 strain (GenBank: MZ221197.1, OR666571.1), and B6 strain (GenBank: MW587044.1, OR666608.1), and the experimental verification results all induced comparable immune responses and antibody levels. Therefore, those skilled in the art can reasonably expect that the aforementioned mutation methods of the present invention can be suitable for the F proteins of all respiratory syncytial viruses.

[0033] The amino acid sequence and nucleotide sequence of the wild-type F protein of the respiratory syncytial virus can be retrieved by methods well-known to those skilled in the art, such as: the National Center of Biotechnology Information (English full name: National Center of Biotechnology Information, abbreviation: NCBI).

[0034] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant contains a disulfide bond mutation relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus, and the disulfide bond mutation includes mutations of the amino acid residues at positions 102 and 243, 490 and 494, or 490 and 495 to C.

[0035] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant contains a disulfide bond mutation, a cavity filling mutation, and an electrostatic mutation relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus.

[0036] In a specific embodiment of the present invention, the mutation satisfies one or more of the following conditions:

[0037] (1) The disulfide bond mutation includes mutations of the amino acid residues at positions 102, 243, 490, and 495 to C;

[0038] (2) The cavity filling mutation includes mutations of the amino acid residue at position 179 to I, the amino acid residue at position 213 to Y, and the amino acid residue at position 301 to L; and,

[0039] (3) The electrostatic mutation includes a mutation of the amino acid residue at position 238 to H.

[0040] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant contains mutations of the amino acid residues at positions 102, 243, 490, and 495 to C, the amino acid residue at position 179 to I, the amino acid residue at position 213 to Y, the amino acid residue at position 301 to L, and the amino acid residue at position 238 to H relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus.

[0041] In a specific embodiment of the present invention, the respiratory syncytial virus is an RSV A subtype strain or an RSV B subtype strain; and / or, the F protein mutant lacks the carboxyl-terminal tail domain of the wild-type F protein.

[0042] In the present invention, the naming standard of RSV subtype genotypes follows academic convention (classical names). For example, strains Long, A2, B18537, RSN2, A23, ON1, BA9, etc. are used as the standard to name RSV genotypes. The present invention selects and names RSV strains according to the RSV genotype classification and naming standard published by Ramaekers et al. 2020. doi: 10.1093 / ve / veaa052 (see Figure 3 of this literature). Some RSV strains still use classical names, such as the A subtype strain A2. RSV A subtype strains are selected from A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20, A21, A22, and A23. In some embodiments, strain A2 is selected, and preferably the globally prevalent strain A23 (or strain ON1). RSV B subtype strains are selected from B1, B2, B3, B4, B5, and B6. In some embodiments, strain B18537 is selected, and preferably the globally prevalent strain B6 (or strain BA9). The RSV F protein of the present invention mainly comes from the globally major prevalent strains, the A subtype strains ON1, A23, and the B subtype strains BA9, B6. Particularly preferably, the A subtype strain A23 and the B subtype B6.

[0043] In a specific embodiment of the present invention, the F protein mutant satisfies one or more of the following conditions:

[0044] (i) The RSV A subtype strains are selected from A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20, A21, A22, and A23, preferably A2 or A23;

[0045] (ii) The RSV B subtype strains are selected from B1, B2, B3, B4, B5, B6, and B18537, preferably B6 or B18537; and,

[0046] (iii) The carboxyl-terminal tail domain is the cytoplasmic tail region CT.

[0047] In the present invention, the carboxyl-terminal tail domain comprises the natural transmembrane region TM and cytoplasmic tail region CT at the C-terminus of the wild-type F protein. In some embodiments, the cytoplasmic tail region CT comprises 25, 20, 15, or 10 amino acids at the C-terminus of the wild-type F protein, i.e., some or all of the amino acids at positions 550-574 of the wild-type F protein. In some embodiments, the F protein mutant retains the natural transmembrane region TM and cytoplasmic tail region CT at the C-terminus of the F1 subunit of the wild-type F protein, or retains only the natural transmembrane region TM.

[0048] In a specific embodiment of the present invention, the cytoplasmic tail region CT comprises some or all of the amino acids at positions 550-574 of the wild-type F protein.

[0049] In a specific embodiment of the present invention, the F protein mutant comprises an amino acid sequence as shown in any one of SEQ ID NOs: 4-25.

[0050] In a specific embodiment of the present invention, the amino acid sequence of the F protein mutant is as shown in any one of SEQ ID NOs: 4-25.

[0051] Technical solution two of the present invention: A combination of F proteins of respiratory syncytial virus, the combination comprising one or more F proteins among the F protein mutants as described in technical solution one, and one or more F proteins of other respiratory syncytial viruses; or, the combination comprises two or more of the F protein mutants as described in technical solution one.

[0052] In the present invention, the "F protein of other respiratory syncytial viruses" refers to the F protein of respiratory syncytial virus not described in the F protein mutants of technical solution one of the present invention, including but not limited to the wild-type F protein of respiratory syncytial virus and F protein mutants of respiratory syncytial virus disclosed in the prior art, such as the F protein mutant encoded by Moderna mRNA-1345 or DS-Cav1 of Zhang L et al. (2016).

[0053] In a specific embodiment of the present invention, the F protein of other respiratory syncytial viruses comprises an amino acid sequence as shown in any one of SEQ ID NOs: 1-3 and SEQ ID NOs: 26-28.

[0054] In a specific embodiment of the present invention, the amino acid sequence of the F protein of other respiratory syncytial viruses is as shown in any one of SEQ ID NOs: 1-3 and SEQ ID NOs: 26-28.

[0055] In a specific embodiment of the present invention, the combination comprises at least one F protein derived from an RSV A subtype strain and at least one F protein derived from an RSV B subtype strain.

[0056] In a specific embodiment of the present invention, the combination comprises an F protein derived from strain A23 and an F protein derived from strain B6; alternatively, the combination comprises an F protein derived from strain A2 and an F protein derived from strain B18537.

[0057] In the present invention, "F protein derived from..." means that the sequence of the F protein directly comes from the wild-type sequence of the subtype (or strain), or is obtained by modification (such as mutation) on the basis of the wild-type sequence of the subtype (or strain). That is, the "F protein" can be a wild-type F protein or an F protein mutant.

[0058] In a specific embodiment of the present invention, the combination comprises: an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 23 and an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 25; alternatively, the combination comprises: an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 22 and an F protein mutant comprising the amino acid sequence shown in SEQ ID NO: 24.

[0059] In a specific embodiment of the present invention, the combination comprises an F protein mutant with the amino acid sequence shown in SEQ ID NO: 23 and an F protein mutant with the amino acid sequence shown in SEQ ID NO: 25; alternatively, the combination comprises an F protein mutant with the amino acid sequence shown in SEQ ID NO: 22 and an F protein mutant with the amino acid sequence shown in SEQ ID NO: 24.

[0060] In a specific embodiment of the present invention, the F protein mutants are tandemly linked by 2A peptides.

[0061] In the present invention, the 2A peptide, namely the self-cleaving polypeptide 2A, is a short peptide derived from a virus (~18 - 25 amino acids), which are commonly referred to as "self-cleaving" peptides and can generate multiple proteins from a single transcript. The first self-cleaving 2A peptide identified and studied originated from foot-and-mouth disease viruses (FMDV). 2A peptides are widely used for the simultaneous expression of multiple genes on a single vector and are often used as polypeptide cleavage signals. In some embodiments, the 2A peptide is a viral self-cleaving polypeptide selected from the group consisting of: foot-and-mouth disease virus (FMDV) (F2A) peptide, equine rhinitis A virus (ERAV) (E2A) peptide, Thosea asigna virus (TaV) (T2A) peptide, porcine teschovirus-1 (PTV-1) (P2A) peptide, Theiler's virus 2A peptide, and encephalomyocarditis virus 2A peptide. Preferred 2A peptides are P2A and T2A. The sequences of P2A, T2A, E2A, and F2A are shown in Table I below:

[0062] Table I Sequences of 2A peptides

[0063]

[0064] Note: Usually, the GSG sequence is added to the N-terminus of the 2A peptide to improve the cleavage efficiency.

[0065] In a specific embodiment of the present invention, the 2A peptide is selected from one or more of the F2A peptide, E2A peptide, T2A peptide, P2A peptide, Theiler's virus 2A peptide, and encephalomyocarditis virus 2A peptide; and / or, the N-terminus of the 2A peptide further contains the GSG sequence.

[0066] In a specific embodiment of the present invention, the amino acid sequence of the T2A peptide is as shown in SEQ ID NO: 57, the amino acid sequence of the P2A peptide is as shown in SEQ ID NO: 58, the amino acid sequence of the E2A peptide is as shown in SEQ ID NO: 59, or the amino acid sequence of the F2A peptide is as shown in SEQ ID NO: 60.

[0067] The third technical solution of the present invention: An antigen combination of respiratory syncytial virus, the antigen combination comprising the F protein mutant as described in the first technical solution or the combination of the F protein of respiratory syncytial virus as described in the second technical solution, and other RSV antigen fragments.

[0068] In the present invention, the "other RSV antigen fragments" refer to other RSV antigen fragments other than the RSV F protein.

[0069] In a specific embodiment of the present invention, the other RSV antigen fragments include one or more selected from attachment protein G, small hydrophobic protein SH, nucleocapsid protein N, and matrix protein M2-1.

[0070] Technical solution four of the present invention: An isolated nucleic acid, the nucleic acid comprising a nucleotide sequence encoding the F protein mutant as described in technical solution one, the combination of the F protein of respiratory syncytial virus as described in technical solution two, or the antigen combination as described in technical solution three.

[0071] In the present invention, after engineering the RSV F protein, nucleic acid sequence optimization can be carried out through publicly disclosed or self-developed codon optimization programs for coding genes and mRNA sequence optimization programs, thereby improving the stability of the mRNA sequence, extending the half-life of the mRNA sequence, increasing the in vitro and in vivo expression levels of the protein, and further enhancing the immunogenicity and neutralizing protective efficacy of the antigen.

[0072] In a specific embodiment of the present invention, the nucleic acid further comprises a 5'UTR and / or a 3'UTR, preferably the 5'UTR and / or the 3'UTR are from the Pfizer bivalent expression vector BNT162b2 (Pfizer bivalent expression vector BNT162b2, the RNA sequences of which can be shown as SEQ ID NO: 61 and SEQ ID NO: 62 respectively); and / or, the nucleic acid further comprises a polyA tail, preferably the length of the polyA tail is 50 to 150 or more.

[0073] In a specific embodiment of the present invention, the nucleic acid is DNA.

[0074] In a specific embodiment of the present invention, the DNA can be transcribed into an RNA comprising a nucleotide sequence shown in one or more of SEQ ID NO: 32 to 53.

[0075] In a specific embodiment of the present invention, the DNA can be transcribed into an RNA with a nucleotide sequence shown in one or more of SEQ ID NO: 32 to 53.

[0076] In a specific embodiment of the present invention, the nucleic acid further comprises a promoter; for example, the T7 promoter.

[0077] In a specific embodiment of the present invention, the nucleic acid is RNA, preferably mRNA.

[0078] In a specific embodiment of the present invention, the nucleic acid encoding the F protein mutant comprises a nucleotide sequence shown in any one of SEQ ID NO: 32 to 53.

[0079] In a specific embodiment of the present invention, the nucleotide sequence of the nucleic acid encoding the F protein mutant is as shown in any one of SEQ ID NOs: 32 to 53.

[0080] In a specific embodiment of the present invention, the nucleic acid encoding the F protein of the other respiratory syncytial virus comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 29 to 31 and SEQ ID NOs: 54 to 56.

[0081] In a specific embodiment of the present invention, the nucleotide sequence of the nucleic acid encoding the F protein of the other respiratory syncytial virus is as shown in any one of SEQ ID NOs: 29 to 31 and SEQ ID NOs: 54 to 56.

[0082] In a specific embodiment of the present invention, the nucleic acid further comprises a 5' cap structure, such as a 7mG(5')ppp(5')N1mpNp cap.

[0083] In a specific embodiment of the present invention, the nucleic acid further comprises modifications, such as pseudouridine (Ψ) and / or N1-methylpseudouridine (m1Ψ) modifications.

[0084] In some embodiments, the nucleic acid is a messenger ribonucleic acid (mRNA) or a composition thereof, which comprises a heterologous 5' untranslated region (5'-UTR) and / or a heterologous 3' untranslated region (3'-UTR); and one or two coding sequences operably linked to the 3'-UTR and / or 5'-UTR, which encode at least one antigenic peptide or protein derived from the RSV fusion (F) protein or its fragment or variant.

[0085] In some embodiments, the 3' end of the 3' untranslated region (3'-UTR) of the RNA or its composition is linked to a poly(A) tail (poly-A tail), and the length of the poly-A tail is 50 - 150 or more.

[0086] In some embodiments, the 5' end of the 5' untranslated region (5'-UTR) of the DNA capable of being transcribed into the RNA or its composition is linked to an RNA polymerase promoter sequence, such as a T7 promoter, etc.

[0087] In some embodiments, the RNA further comprises a 7mG(5')ppp(5')N1mpNp cap.

[0088] The fifth technical solution of the present invention: A recombinant expression vector, which comprises the nucleic acid as described in the fourth technical solution.

[0089] Sixth technical solution of the present invention: A transformant, the transformant comprising the nucleic acid as described in the fourth technical solution or the recombinant expression vector as described in the fifth technical solution; the transformant is a non-animal or plant variety.

[0090] In a specific embodiment of the present invention, the host cell of the transformant is a eukaryotic cell or a prokaryotic cell.

[0091] In a specific embodiment of the present invention, the prokaryotic cell is a bacterium, such as Escherichia coli.

[0092] Seventh technical solution of the present invention: A lipid nanoparticle (LNP), the lipid nanoparticle comprising the nucleic acid as described in the fourth technical solution.

[0093] The RNA of the present invention may further comprise a lipid mixture, the lipid mixture comprising a PEG-modified lipid, a non-cationic lipid, a sterol, an ionizable cationic lipid, or any combination thereof. The lipid mixture encapsulates the RNA to form a lipid nanoparticle (such as an mRNA-LNP formulation).

[0094] In some embodiments, the RNA comprises an RNA polynucleotide having an open reading frame encoding at least one antigenic protein having at least one modification, at least one 5'-terminal cap, and is formulated within a lipid mixture. The lipid nanoparticle generally comprises an ionizable cationic lipid, a non-cationic lipid, a sterol, and a PEG lipid component, as well as a target nucleic acid molecule.

[0095] The lipid nanoparticle described above can stably express the pre-fusion conformation of the RSV F protein in an animal model or in the human body. After the F protein is expressed, it can be in the form of monomers, polymers, trimers, etc., and induce a neutralizing antibody response against RSV in the subject.

[0096] Eighth technical solution of the present invention: A pharmaceutical composition, the pharmaceutical composition comprising one or more selected from the group consisting of the F protein mutant as described in the first technical solution, the combination of the F protein of respiratory syncytial virus as described in the second technical solution, the antigen combination as described in the third technical solution, the nucleic acid as described in the fourth technical solution, and the lipid nanoparticle as described in the seventh technical solution, and a pharmaceutically acceptable carrier.

[0097] The pharmaceutical composition of the present invention can be a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. In the present invention, the pharmaceutical composition can be administered in a solution. It can be administered in a non-buffered solution, such as in physiological saline or in water. Alternatively, it can also be administered in a suitable buffered solution. The buffered solution can include acetate, citrate, gliadin, carbonate or phosphate, or any combination thereof. In a preferred embodiment, the buffered solution is phosphate buffered saline (PBS). The pH and osmolality of the buffer of the pharmaceutical composition can be adjusted such that it is suitable for administration to a subject.

[0098] In some embodiments, the buffered solution further contains a reagent for controlling the osmolality of the solution such that the osmolality is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffered solution to control osmolality include (but are not limited to) proteins, peptides, amino acids, non-metabolic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids or salts. In some embodiments, the reagent for controlling the osmolality of the solution is a salt. In certain embodiments, the reagent for controlling the osmolality of the solution is sodium chloride or potassium chloride.

[0099] The ninth technical solution of the present invention: The use of one or more selected from the F protein mutants as described in Technical Solution 1, the combination of the F protein of respiratory syncytial virus as described in Technical Solution 2, the antigen combination as described in Technical Solution 3, the nucleic acid as described in Technical Solution 4, the lipid nanoparticles as described in Technical Solution 7, and the pharmaceutical composition as described in Technical Solution 8 in the preparation of a drug for preventing diseases caused by respiratory syncytial virus.

[0100] In a specific embodiment of the present invention, the drug is a vaccine, such as an mRNA vaccine.

[0101] As used herein, "diseases caused by respiratory syncytial virus" is intended to include any diseases associated with respiratory syncytial virus infection. Exemplary diseases caused by respiratory syncytial virus include upper respiratory tract infections, lower respiratory tract infections (such as bronchiolitis or pneumonia), viral otitis media, asthma or wheezing-related diseases, chronic pulmonary diseases or other possible complications.

[0102] The present invention discloses the use of the aforementioned product as a vaccine for preventing RSV infection. In some embodiments, an mRNA-LNP formulation vaccine is prepared by mixing an mRNA composition encoding the F proteins of two RSV subtypes, or an mRNA composition is obtained by inserting the coding regions (coding sequences, CDS) of the F protein genes of subtype A and subtype B into a complete mRNA sequence and then prepared into an mRNA-LNP formulation vaccine. This mRNA-LNP formulation vaccine can effectively prevent infection by RSV subtype A and B strains and has neutralizing antibody efficacy equivalent to or better than that of subtype A on subtype B.

[0103] In some embodiments, an mRNA-LNP formulation vaccine is prepared by mixing an mRNA composition encoding the prefusion F proteins of two RSV subtypes.

[0104] In some embodiments, the RSV bivalent mRNA vaccine of the present invention contains coding region sequences encoding the F proteins from two RSV subtype strains, and the subtype strains are selected from or are classical strains (or genotypes), or are RSV epidemic strains (or genotypes) during a certain period. Preferably, they are the global major epidemic strain subtype A strain A23 and subtype B strain B6.

[0105] In some embodiments, the mRNA sequence of the RSV bivalent mRNA vaccine can contain only the coding region of one F protein, or two coding regions of F proteins can be tandemly connected through a self-cleaving polypeptide 2A sequence (2A peptide). The mRNAs of individual F proteins from different subtypes form an mRNA-LNP formulation of the RSV bivalent vaccine through an LNP encapsulation process of "encapsulating first and then mixing" or "mixing first and then encapsulating".

[0106] Based on common general knowledge in the art, the above preferred conditions can be combined arbitrarily to obtain various preferred examples of the present invention.

[0107] The reagents and raw materials used in the present invention are all commercially available.

[0108] The positive and progressive effects of the present invention are as follows:

[0109] (1) To enhance the stability of the prefusion conformation of the F protein, the present invention encodes an RSV F protein variant with a stabilized prefusion conformation, which effectively improves the stability of the prefusion conformation of the F protein through one or more combinations of disulfide bond mutations, cavity filling mutations, electrostatic mutations, proline mutations, and N-linked glycosylation mutations, as well as artificial modification techniques such as sequence truncation or sequence deletion. And by codon-optimizing the mRNA nucleic acid sequence, the protein expression level of the sequence is increased.

[0110] (2)To enhance the immunoprotective efficacy of the RSV vaccine against RSV A and B serotypes, the present invention innovatively combines the F proteins of subtypes A and B to form a bivalent vaccine, which highly expresses the prefusion F protein that can induce high levels of neutralizing antibodies against RSV A subtype strains and the prefusion F protein that can induce high levels of neutralizing antibodies against RSV B subtype strains, overcoming the problem of insufficient neutralizing antibody titers in the B subtype of monovalent vaccines. In particular, the neutralizing antibody response in the B subtype is equal to or comparable to that in the A subtype.

[0111] (3)As a prophylactic vaccine, the RSV F protein bivalent mRNA vaccine overcomes the disadvantages of low immunoprotective efficacy, high side effects, and dependence on adjuvants to enhance immune efficacy of recombinant protein subunit vaccines. BRIEF DESCRIPTION OF THE DRAWINGS

[0112] Figure 1 Schematic diagram of RSV F glycoprotein variants and wild-type RSV F glycoprotein; wherein, the arrow indicates furin protease cleavage; SP represents signal peptide; p27 represents the 27aa peptide removed after cleavage; FP represents fusion peptide; HRA and HRB represent heptad repeat sequences A and B; TM represents transmembrane region; CT represents cytoplasmic tail region.

[0113] Figure 2 Positive rates of pre-F and post-F of the F protein mutant mRNA sequence detected by FCM.

[0114] Figure 3 Positive rate of total-F of the F protein mutant mRNA sequence detected by FCM.

[0115] Figure 4 MFI values of pre-F and post-F of the F protein mutant mRNA sequence detected by FCM.

[0116] Figure 5 MFI value of total-F of the F protein mutant mRNA sequence detected by FCM.

[0117] Figure 6 Positive rates of pre-F and post-F of the F protein multi-site mutant mRNA sequence detected by FCM.

[0118] Figure 7 Positive rate of total-F of the F protein multi-site mutant mRNA sequence detected by FCM.

[0119] Figure 8 MFI of pre-F and post-F of the F protein multi-site mutant mRNA sequence detected by FCM.

[0120] Figure 9The MFI of the total-F of the mRNA sequence of the F protein multi-site mutant was detected by FCM.

[0121] Figure 10 The IU / mL values of the neutralizing antibodies of RSV-A1 and RSV-B1 / 18537 in serum were detected by the FRNT50 method. Specific implementation manners

[0122] The present invention will be further described below by way of examples, but the present invention is not limited to the scope of the described examples. For the experimental methods without specific conditions noted in the following examples, they are carried out according to conventional methods and conditions, or selected according to the product specifications.

[0123] Example 1: Design of RSV pre-F protein

[0124] The RSV F protein is encoded by the F gene and is initially synthesized as a single polypeptide precursor with a length of about 574 amino acids, called F0. This protein contains a signal peptide (SP, aa 1-20), a signal peptide cleavage site (aa 21-25), a p27 peptide (p27), a fusion peptide (FP), a heptapeptide repeat sequence A (HRA), a heptapeptide repeat sequence B (HRB), a transmembrane peptide (TM), and a CT functional domain. The F protein has two conformations - pre-fusion (Pre-F) and post-fusion (Post-F) states. Pre-F is a metastable structure. When the virus fuses with the cell, Pre-F transforms into the stable Post-F, and this process can also occur spontaneously. Various influencing factors such as temperature and osmotic pressure can trigger the conformational transformation of Pre-F. Studies have found that Pre-F has more antibody-binding epitopes and is more effective in inducing neutralizing antibodies (NAb), accounting for more than 90% of the human F-specific neutralizing activity, making it the preferred antigen for vaccine development. However, Pre-F is an unstable structure. Therefore, protein modification or transformation is required to make it more stable in the Pre-F conformation.

[0125] Therefore, according to the important structural domains and functions of the F protein, the present invention designed a series of mRNA antigens for mutations and truncated mutations of the key structural and functional domains of the F protein. As Figure 1 shown.

[0126] With the wild-type sequence of the F gene of the RSV virus (referring to the NCBI virus strain serial number MZ221197.1) as a reference, a series of 25 different F mutant mRNA sequences were designed:

[0127] Table 1 summarizes the amino acid sequences of variant F antigens encoding different mutations and the nucleotide sequences of the corresponding mRNAs. In the table, MRNA-RSV-1345 and MRNA-RSV-ds-cav1 correspond to the mutant or mutant combination sequences in the corresponding public patents (CN115103682A and CN105473604B), respectively.

[0128] Table 1 RSV mRNA vaccine F protein antigen

[0129]

[0130]

[0131]

[0132] Example 2: Preparation of RSV F antigen mRNA vaccine formulation

[0133] Construction of cloning plasmid: The target plasmid was constructed by the method of enzymatic digestion and ligation. Restriction enzyme sites were introduced at both ends of the target fragment by primers and PCR amplification. The target fragment and the vector (Thermo Fisher) were respectively digested with the same restriction enzyme (Yeasen). The digested products of the target fragment and the vector were ligated in vitro using DNA ligase (Yeasen). The ligation product containing the newly inserted gene and the vector was transformed into Escherichia coli (Thermo Fisher). The transformed bacterial solution was spread on a plate containing antibiotics (Sangon Biotech) for selection, and recombinant clones were obtained through screening and identification.

[0134] Preparation of mRNA: In vitro synthesis (IVT) of mRNA was carried out using T7 RNA polymerase (Yeasen) on the linearized plasmid. The mRNA encodes a codon-optimized RSV F protein, and the transcribed mRNA contains two untranslated regions and a poly(A) tail. The 5’UTR and 3’UTR of the non-coding region and the poly(A) tail sequence are the same as those used in the mRNA COVID-19 vaccine BNT162b2 from Biotech / Pfizer. mRNA containing modified nucleosides was generated by replacing uridine triphosphate (UTP) with 1-methylpseudouridine-5'-triphosphate (Yeasen). The prepared mRNA was purified and analyzed by agarose gel electrophoresis.

[0135] 5’UTR (SEQ ID NO: 61):

[0136] GAATAAACTAGTATTCTTCTGGTCCCCACAGACTCAGAGAGAACCCGCCACC

[0137] 3’UTR (SEQ ID NO: 62):

[0138] CTCGAGCTGGTACTGCATGCACGCAATGCTAGCTGCCCCTTTCCCGTCCTGGGTACCCCGAGTCTCCCCCGACCTCGGGTCCCAGGTATGCTCCCACCTCCACCTGCCCCACTCACCACCTCTGCTAGTTCCAGACACCTCCCAAGCACGCAGCAATGCAGCTCAAAACGCTTAGCCTAGCCACACCCCCACGGGAAACAGCAGTGATTAACCTTTAGCAATAAACGAAAGTTTAACTAAGCTATACTAACCCCAGGGTTGGTCAATTTCGTGCCAGCCACACCCTGGAGCTAGC

[0139] Preparation of mRNA-LNP formulation: The mRNA was encapsulated in LNPs in a self-assembled form through a microfluidic device (Pengzan, LNP-S1-L). Four lipid components, namely ionizable cationic lipid, cholesterol, DSPC, and PEGylated lipid (Aventis), were dissolved in ethanol at a molar ratio of 50:38.5:10:5, and the mRNA was dissolved in citrate (Sangon) buffer. The aqueous mRNA solution and the lipid ethanol solution were rapidly mixed through a microfluidic chip. The prepared LNP was exchanged and concentrated with phosphate buffer (PBS, Sangon).

[0140] Example 3: Determination of the cellular expression level of F protein

[0141] To verify whether the designed antigen mRNA sequence can be expressed in cells and the expression efficiency of different antigen sequences, the mRNA sequence was first transfected into cells, and flow cytometry (FCM) was used to detect the expression of antigen mRNA in cells.

[0142] Experimental principle: The fusion protein (F) on the surface of RSV virus undergoes a conformational change from Pre to Post, and there are three conformations: pre-fusion pre-F, intermediate Intermediate, post-fusion post-F, and pre-F trimer Trimer. In order to identify different conformations of the F protein, the structure of the F protein and its antibodies were studied. It was found that there are at least 7 completely different antigenic epitopes on the surface of the protein, and antibodies that can bind to different epitopes were successfully screened, namely φsite_D25 / 5C4 / AM22, I site_131-2A / 2F, II site_Motavizumab / Palivizumab, III site_MPE8, IV site_101F / mAb19, and V site_hRSV90. Among them, the 101F antibody that recognizes the IV epitope, the Palivizumab antibody that recognizes the II epitope, and the 131-2A antibody that recognizes the I epitope can simultaneously recognize the pre and post conformations of the F protein and can be used as detection antibodies for total F protein / Total-F; the D25 antibody that recognizes the φ epitope or the hRSV90 that recognizes the V epitope only binds to the F protein in the Pre conformation and can be used as a detection antibody for pre-F; the MPE8 antibody that recognizes the III epitope prefers to recognize the Pre conformation and has weak binding activity with the Post conformation; the monoclonal antibody AM14, whose recognized antigenic epitope is located in the near-equatorial region of the F-pre protein and spans two monomers, can specifically recognize the Trimer structure; while the 4D7 monoclonal antibody can simultaneously recognize the post-F or the Intermediate conformation of the F protein and can be used as a non-pre-F detection antibody. In this experiment, Palivizumab, D25, and 4D7 were respectively selected to detect Total-F, pre-F, and post-F, providing a basis for in vitro screening of the mRNA sequence encoding the F protein antigen.

[0143] Experimental materials:

[0144] Table 2 Main experimental materials, instruments and sources

[0145]

[0146] (I) Cell transfection

[0147] Cell plating: One day in advance, collect 1×10 5 (100,000) cells in the logarithmic growth phase and inoculate them into a 24-well cell culture plate. Supplement the DMEM medium containing double antibiotics + 10% FBS to 0.5 mL, mix the cells evenly, and incubate them overnight in a cell culture incubator at 37 °C and 5% CO 2 ;

[0148] On the second day, the mRNA-LNP Mixture was prepared according to Example 2. According to the formulated transfection dose, 50 μL of the mRNA-LNP Mixture was respectively taken and evenly dropped into each cell well. At the same time, the untransfected group was set as the negative control group, and the cross-shaking method was used to shake well;

[0149] The cell plate was placed in an incubator at 37 °C and 5% CO 2 for incubation.

[0150] (II)Flow cytometry detection (FCM method)

[0151] (1)Cell collection: At 24 h after transfection and incubation, the cells were washed with 5 mL of PBS, and then 80 μL of trypsin was added to each well to digest the cells, and an equal volume of complete medium was added to terminate the digestion. The cells were collected into a 96-well plate;

[0152] (2)Cell sub-plating: The cells in each well of the well plate were evenly distributed into another 2 clean 96-well plates using a multichannel pipette;

[0153] (3)Cell washing: 250 μL of PBS was added to each tube of the 96-well plate, and then the plate was centrifuged at 4 °C and 600 g for 5 min in a plate centrifuge; the centrifuged 96-well plate was carefully taken out, and the liquid in the wells was aspirated clean using the aspiration mode of a 96-well plate washer;

[0154] (4)Preparation of primary antibody working solution: The Palivizumab / D25 / 4D7 antibody and Cell Staining Buffer were respectively prepared into primary antibody working solution at 2 μL of antibody + 100 μL per tube;

[0155] (5)Primary antibody incubation: Different primary antibody working solutions were added to the corresponding 96-well plates at 100 μL / well using a multichannel pipette. The cells were gently vortexed and resuspended, and incubated at 4 °C for 30 min;

[0156] (6)Cell washing: PBS was added to each well at 200 μL / well using a multichannel pipette, and centrifuged at 600 g and 4 °C for 5 min; the centrifuged 96-well plate was carefully taken out, and the liquid in the wells was aspirated clean using the aspiration mode of a 96-well plate washer;

[0157] (7)Preparation of secondary antibody working solution: The Goat Anti-Human IgG-FITC antibody and Cell Staining Buffer were prepared into the secondary antibody working solution of Palivizumab / D25 at 1 μL + 100 μL; the Goat Anti-Mouse IgG-Elab Fluor® 488 antibody and Cell Staining Buffer were prepared into the secondary antibody working solution of 4D7 at 4 μL + 100 μL per tube;

[0158] (8)Secondary antibody incubation: Use a multi-channel pipette to add different secondary antibody working solutions to the corresponding 96-well plates at 100 μL / well, vortex gently to resuspend and mix the cells, and incubate in the dark at room temperature for 60 min;

[0159] (9)Cell washing: Use a multi-channel pipette to add PBS to the wells at 200 μL / well, centrifuge at 600 g at 4 ºC for 5 min; Carefully remove the centrifuged 96-well plate, and use the suction mode of a 96-well plate washer to suck out the liquid in the wells completely;

[0160] (10)Detection by flow cytometry: Use a multi-channel pipette to add PBS to the wells at 200 μL / well, vortex gently to resuspend the cells, transfer them to a flow cytometer, select the FITC channel to detect the content of Palivizumab+ / D25+ / 4D7+ cells and the corresponding fluorescence intensity (MFI) for evaluation, and determine the expression level of Total-F of the mRNA sequences encoding the F protein in the cell line, as well as the proportion of the pre-F and non-pre-F conformations of the F protein.

[0161] Example 4: Immunogenicity study of RSV mRNA vaccine in mice

[0162] Immunization and sampling of mice (Hubei Branch of Beijing Vital River Laboratory Animal Technology Co., Ltd.). At 0 / 14 days, 6-8-week-old BALB / c mice (n = 6) were immunized intramuscularly with mRNA-LNP of RSV F variant. Serum was collected at 14 / 28 days to measure neutralizing antibody and IgG antibody titers.

[0163] ELISA for measuring serum F protein-specific IgG antibody titer. Measured using an ELISA kit (Sino Biological). Add RSV F protein solution to the ELISA well plate and incubate at 4 ºC for 12 hours. The next morning, wash the plate 3 times with Wash Buffer, then add blocking solution and block at 37 ºC for 2 hours. After 2 hours, wash the plate 3 times with Wash Buffer, then add a series of diluted serum samples or controls and incubate at 37 ºC for 2 hours. After incubation, wash the plate 3 times with Wash Buffer, then add enzyme-labeled secondary antibody and incubate at 37 ºC for 2 hours. After 2 hours, wash the plate 3 times with Wash Buffer, then add substrate solution for color development and incubate at room temperature. Finally, add stop solution to terminate the color reaction, and then read the absorbance at 450 nm (BioTek, Synergy H1).

[0164] Determination of the neutralizing antibody titer of the authentic RSV virus. The neutralizing antibody was detected by the micro-cytopathic effect method. Cells were seeded in a 96-well plate one day in advance and used the next day. Serum was inactivated, and the serum was serially diluted in a 96-well plate, and duplicate wells were set for each sample; the RSV virus (Wuhan Institute of Virology) was diluted to an appropriate concentration; the diluted virus solution was mixed with the diluted serum and incubated at 37 °C for 1 hour. After 1 h, the virus-antibody incubation solution was aspirated and transferred to a new 96-well cell culture plate and cells were added. At the same time, negative cell wells and positive virus wells were set and cultured at 37 °C. The cytopathic effect of the cells in each group was observed under the microscope every day. The cytopathic effect of each group of cells was observed, and the serum dilution at which 50% of the cell wells did not show cytopathic effect was taken as the determination end point, and the CPE inhibition rate and IC50 were calculated.

[0165] ELISPOT assay for the secretion of splenocyte cytokines. A commercial ELISPOT kit (Dakewei) was used for the detection experiment. Mouse splenocytes were isolated and added to a 96-well plate pre-coated with anti-cytokine antibody, and the peptide library was added for stimulation for 40 h. After 40 h, the cells were lysed and the plate was washed six times, and then the diluted biotin-labeled antibody solution was added to each well and incubated at 37 °C for 1 hour. After completion, the plate was washed and the diluted enzyme-labeled avidin working solution was added to each well and incubated at 37 °C for 1 hour. After completion, the plate was washed and the freshly prepared AEC chromogenic solution was added to each well and allowed to stand at room temperature in the dark for 30 minutes. Finally, the color development was terminated and the number of spots in each well was read (Mabtech, IRIS 2).

[0166] Control settings

[0167] The present invention sets the following controls:

[0168] NC: Un-transfected group;

[0169] Empty LNP: Blank LNP without carrying the mRNA vaccine;

[0170] Comparative Example 1: According to the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the literature (Wilson E, et al. 2023) and the Moderna patent (CN115103682A), it was found that its antigen is the F protein (1-549aa). The amino acids at positions 104-144 were replaced with GS, and mutations S155C-S290C, A149C-Y458C, S190F, V207L, and L373R were introduced to stabilize the pre-fusion conformation of the F protein. Based on this, MRNA-RSV-1345 (SEQ ID NO: 1) was designed in this project, which has the same mutation sites and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the Moderna patent (CN115103682A).

[0171] Comparative Example 2: According to the RSV pre-F sequence mutant (DS-Cav1) reported in the literature (McLellan et al. 2013) and the NIAID patent (CN105473604B), it was found that its antigen is the F protein (1-513aa) with a T4 fibritin trimerization motif (foldon) added at the C-terminus. It introduced mutations S155C-S290C, S190F, and V207L to stabilize the pre-fusion conformation of the F protein. Based on this, MRNA-RSV-ds-cav1 (SEQ ID NO: 2) was designed in this project, which has the same mutation sites and truncated length as the RSV pre-F sequence mutant (DS-Cav1) reported in the NIAID patent (CN105473604B). Since mRNA-1345 is a membrane-type F protein sequence containing a transmembrane region (TM), while DS-Cav1 is a secreted F protein sequence with a foldon at the C-terminus, to make the comparative examples have the same properties, the present invention removed the foldon from DS-Cav1 and retained its transmembrane region (TM), finally obtaining the sequence MRNA-RSV-ds-cav1 (SEQ ID NO: 2).

[0172] Comparative Example 3: Referring to Comparative Example 1, the F gene sequence from the RSV A subtype strain A23 (refer to the NCBI virus strain serial number OR666571.1) was used to design MRNA-RSV-1345-A23 (SEQ ID NO: 26), which has the same mutation sites and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the Moderna patent (CN115103682A).

[0173] Comparative Example 4: Referring to Comparative Example 1, the F protein sequence from the RSV B subtype strain B18537 (refer to the NCBI virus strain serial number P13843) was used to design MRNA-RSV-1345-B18537 (SEQ ID NO: 27), which has the same mutation sites and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the Moderna patent (CN115103682A).

[0174] Comparative Example 5: Referring to Comparative Example 1, the F gene sequence from the RSV B subtype strain B6 (refer to the NCBI virus strain serial number OR666608.1) was used to design MRNA-RSV-1345-B6 (SEQ ID NO: 28), which has the same mutation sites and truncated length as the RSV mRNA vaccine antigen sequence (mRNA-1345) reported in the Moderna patent (CN115103682A).

[0175] Summary and Analysis of Results

[0176] In Vitro Expression Results of RSV F Antigen Variants

[0177] As can be seen from Example 3, the positive rates and MFI values of Total-F, pre-F, and post-F of the mRNA sequence encoding the F protein were detected by flow cytometry (FCM) in Hela cells. The detection results are shown in Tables 3, 4, and Figures 2 to 5 as follows:

[0178] Table 3 Positive Rates of pre-F, post-F, and Total-F of the mRNA Sequence Detected by FCM

[0179]

[0180]

[0181] Table 4 MFI Values of pre-F, post-F, and Total-F of the mRNA Sequence Detected by FCM

[0182]

[0183]

[0184] By detecting 19 RSV F protein mutants (SEQ ID NO: 3 - 21) designed by FCM, the results showed that:

[0185] 1. The expression level of the pre-F conformation of the wild-type sequence (HY-RSV-A23-F-delCT) was low, and the post-F conformation was abundant, indicating that under natural conditions, the pre-F conformation of the F protein was unstable and could not be used as a candidate antigen for the RSV mRNA vaccine, so it was excluded.

[0186] 2. At the pre-F conformational expression level, compared with the wild-type sequence (HY-RSV-A23-F-delCT), the expression levels of HY-RSV-A23-F-delCT-A102C, HY-RSV-A23-F-delCT-Q494C, HY-RSV-A23-F-delCT-V495C, HY-RSV-A23-F-delCT-V179I, HY-RSV-A23-F-delCT-S213Y, HY-RSV-A23-F-delCT-V301L, HY-RSV-A23-F-delCT-S238H, HY-RSV-A23-F-delCT-S215P, and HY-RSV-A23-F-delCT-I217P were all increased by at least 2-fold. Although the increase in the expression level of HY-RSV-A23-F-delCT-T54E was slightly lower, it was still nearly 1.5-fold higher.

[0187] 3. At the Total-F conformational expression level, the observed results were similar to those of the pre-F conformation.

[0188] 4. At the post-F conformational expression level, the expression levels of most F protein mutants were increased to some extent or were similar to the wild-type sequence, indicating that single-site mutations were not sufficient to maintain a sufficiently stable pre-F conformation.

[0189] Conclusion: The disulfide bond mutations A102C, V243C and A490C, V495C, the cavity filling mutations V301L, S213Y, V179I and the electrostatic mutation S238H can stabilize the pre-F conformation of the F protein. At the same time, compared with the wild-type sequence, site mutations increased the in vitro expression level of the sequence. Although single-site mutations may be difficult to maximize the stability of the pre-F structure, combinations of multiple-site mutations can achieve the goal, and DS-Cav1 and mRNA-1345 are examples.

[0190] Therefore, the present invention innovatively combines multiple-site mutations including disulfide bond mutations, cavity filling mutations and electrostatic mutations to form a new stabilized F protein mutant sequence, as shown in SEQ ID NO: 22 to SEQ ID NO: 25.

[0191] The expression levels of multi-site mutant sequences were detected by flow cytometry (FCM), and the results are shown in Tables 5, 6 and Figures 6 to 9 。

[0192] Table 5 Positive rates of pre-F, post-F, and Total-F of mRNA sequences detected by FCM

[0193]

[0194] Table 6 MFI values of pre-F, post-F, and Total-F for detecting mRNA sequences by FCM

[0195]

[0196] As can be seen from the above table, the expression levels of HY-RSV-F-delCT-mut-A2, HY-RSV-F-delCT-mut-A23, HY-RSV-F-delCT-mut-B18537, and HY-RSV-F-delCT-mut-B6 have increased significantly, about 2 times higher than the control sequence (MRNA-RSV-1345). Therefore, they can be used as effective candidate antigens for the next step of immunogenicity screening and evaluation, and the F protein-specific antibody IgG titer detection and RSV authentic virus neutralizing antibody titer determination are carried out for the above antigens.

[0197] Determination results of RSV authentic virus neutralizing antibody titer

[0198] The present invention detects the neutralizing antibody levels of sera against two strains of RSV A2 / B1 for the sequences of SEQ ID NO: 22-28 (including mRNA-LNP preparations of RSV monovalent (single subtype sequence) and bivalent (A and B subtype sequence combinations)), by GFP fluorescence method (i.e., FRNT50 method). The results are shown in Figure 10 :

[0199] 1. The FRNT50 detection results show that HY-RSV-F-delCT-mut-A23&HY-RSV-F-delCT-mut-B6 is the optimal bivalent combination, and HY-RSV-F-delCT-mut-A2&HY-RSV-F-delCT-mut-B18537 is the sub-optimal bivalent combination, that is, the bivalent vaccine of RSV epidemic strains is superior to the bivalent vaccine of classical strains.

[0200] 2. Compared with the same dose of MRNA-RSV-1345, the neutralizing antibody levels of the bivalent preferred antigen sequence combination HY-RSV-F-delCT-mut-A23&HY-RSV-F-delCT-mut-B6 against classical and epidemic strains of RSV A / B subtypes are increased by about 10 times at a dose of 2 μg and about 30 times at a dose of 10 μg.

[0201] The neutralizing antibody titer detection results show that HY-RSV-F-delCT-mut-A23 and HY-RSV-F-delCT-mut-B6 are antigen sequences that are at least more excellent in effect than MRNA-RSV-1345 (Comparative Example 1) and MRNA-RSV-ds-cav1 (Comparative Example 2).

[0202] Sequence information:

[0203] Table 7 Amino acid sequence of F antigen

[0204]

[0205]

[0206]

[0207]

[0208]

[0209]

[0210]

[0211]

[0212]

[0213]

[0214] Table 8 Nucleotide sequence of mRNA

[0215]

[0216]

[0217]

[0218]

[0219]

[0220]

[0221]

[0222]

[0223]

[0224]

[0225]

[0226]

[0227]

[0228]

[0229]

[0230]

[0231]

[0232]

[0233]

[0234]

[0235]

[0236]

[0237]

[0238]

[0239]

[0240]

[0241]

[0242]

[0243] Note: "T" in Table 8 should be "U".

Claims

1. A mutant of the F protein of respiratory syncytial virus, characterized in that: The amino acid sequence of the F protein mutant comprises one or more mutations selected from disulfide bond mutations, cavity filling mutations, electrostatic mutations, proline mutations and N-linked glycosylation mutations relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus; and the mutations satisfy one or more conditions selected from the following: (1) The disulfide bond mutation comprises one or more amino acid residues selected from 102, 243, 490, 494 and 495 mutated to C; (2) the cavity-filling mutation comprises one or more selected from the group consisting of a mutation of the amino acid residue at position 179 to I, a mutation of the amino acid residue at position 213 to Y, and a mutation of the amino acid residue at position 301 to L; (3) The electrostatic mutation includes a mutation of the amino acid residue at position 238 to H, and / or a mutation of the amino acid residue at position 54 to E; (4) the proline mutation comprises one or more amino acid residues selected from 213, 215 and 217 mutated to P; and, (5) The N-linked glycosylation mutation comprises mutation of one or more amino acid residues selected from 172, 180, 398, 253, 372, 402 and 491 to N.

2. The F protein mutant according to claim 1, characterized in that The amino acid sequence of the F protein mutant comprises a disulfide bond mutation relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus, wherein the disulfide bond mutation comprises a mutation of amino acid residues at positions 102 and 243, 490 and 494, or 490 and 495 to C.

3. The F protein mutant according to claim 1, characterized in that The amino acid sequence of the F protein mutant comprises a disulfide bond mutation, a cavity filling mutation and an electrostatic mutation relative to the amino acid sequence of the wild-type F protein of respiratory syncytial virus; Preferably, the mutation satisfies one or more of the following conditions: (1) The disulfide bond mutation comprises mutation of amino acid residues 102, 243, 490 and 495 to C; (2) the cavity-filling mutation comprises a mutation of the amino acid residue at position 179 to I, a mutation of the amino acid residue at position 213 to Y, and a mutation of the amino acid residue at position 301 to L; and, (3) The electrostatic mutation includes a mutation of the amino acid residue at position 238 to H; More preferably, the amino acid sequence of the F protein mutant comprises mutations of amino acid residues 102, 243, 490 and 495 to C, mutation of amino acid residue 179 to I, mutation of amino acid residue 213 to Y, mutation of amino acid residue 301 to L and mutation of amino acid residue 238 to H relative to the amino acid sequence of wild-type F protein of respiratory syncytial virus.

4. The F protein mutant according to any one of claims 1 to 3, characterized in that The respiratory syncytial virus is an RSV A subtype strain or an RSV B subtype strain; and / or, the F protein mutant lacks the carboxyl terminal tail domain of the wild-type F protein; Preferably, the F protein mutant satisfies one or more of the following conditions: (i) the RSV A subtype strain is selected from A1, A2, A3, A4, A5, A6, A7, A8, A9, A10, A11, A12, A13, A14, A15, A16, A17, A18, A19, A20, A21, A22 and A23, preferably A2 or A23; (ii) the RSV B subtype strain is selected from B1, B2, B3, B4, B5, B6 and B18537, preferably B6 or B18537; and, (iii) the carboxyl terminal tail domain is a cytoplasmic tail region CT; preferably, the cytoplasmic tail region CT comprises part or all of the amino acids at positions 550 to 574 of the wild-type F protein.

5. The F protein mutant according to claim 4, characterized in that The F protein mutant comprises an amino acid sequence as shown in any one of SEQ ID NOs: 4 to 25.

6. A combination of F proteins of respiratory syncytial virus, characterized in that: The combination comprises one or more F proteins in the F protein mutant according to any one of claims 1 to 5, and one or more F proteins of other respiratory syncytial viruses; or, the combination comprises two or more F proteins in the F protein mutant according to any one of claims 1 to 5; Preferably, the combination comprises at least one F protein derived from RSV A subtype strain and at least one F protein derived from RSV B subtype strain; and / or, the F protein of the other respiratory syncytial virus comprises an amino acid sequence as shown in any one of SEQ ID NOs: 1 to 3 and SEQ ID NOs: 26 to 28; More preferably, the combination comprises an F protein derived from an A23 strain and an F protein derived from a B6 strain; or, the combination comprises an F protein derived from an A2 strain and an F protein derived from a B18537 strain; Further more preferably, the combination comprises: an F protein mutant comprising the amino acid sequence as shown in SEQ ID NO: 23 and an F protein mutant comprising the amino acid sequence as shown in SEQ ID NO: 25; or, the combination comprises: an F protein mutant comprising the amino acid sequence as shown in SEQ ID NO: 22 and an F protein mutant comprising the amino acid sequence as shown in SEQ ID NO:

24.

7. The combination of F proteins of respiratory syncytial virus according to claim 6, characterized in that The F protein is connected in series via a 2A peptide; Preferably, the 2A peptide is selected from one or more of F2A peptide, E2A peptide, T2A peptide, P2A peptide, Theiler virus 2A peptide and encephalomyocarditis virus 2A peptide; and / or, the N-terminus of the 2A peptide further comprises a GSG sequence; More preferably, the amino acid sequence of the T2A peptide is as shown in SEQ ID NO: 57, the amino acid sequence of the P2A peptide is as shown in SEQ ID NO: 58, the amino acid sequence of the E2A peptide is as shown in SEQ ID NO: 59, or the amino acid sequence of the F2A peptide is as shown in SEQ ID NO:

60.

8. An antigen combination of respiratory syncytial virus, characterized in that: The antigen combination comprises the F protein mutant according to any one of claims 1 to 5 or the combination of the F protein of the respiratory syncytial virus according to claim 6 or 7, and other RSV antigen fragments; Preferably, the other RSV antigen fragments include one or more selected from the group consisting of attachment protein G, small hydrophobic protein SH, nucleocapsid protein N and matrix protein M2-1.

9. An isolated nucleic acid, characterized in that The nucleic acid comprises a nucleotide sequence encoding the F protein mutant according to any one of claims 1 to 5, the combination of F proteins of respiratory syncytial virus according to claim 6 or 7, or the antigen combination according to claim 8; Preferably, the nucleic acid further comprises a 5'UTR and / or a 3'UTR, preferably the 5'UTR and / or the 3'UTR are from Pfizer's bivalent expression vector BNT162b2; and / or the nucleic acid further comprises a polyA tail, preferably the length of the polyA tail is 50 to 150 or more.

10. The nucleic acid according to claim 9, characterized in that The nucleic acid is DNA; Preferably, the nucleic acid further comprises a promoter; for example, a T7 promoter.

11. The nucleic acid according to claim 9, wherein The nucleic acid is RNA, preferably mRNA; Preferably, the nucleic acid satisfies one or more of the following conditions: (1) The nucleic acid encoding the F protein mutant comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 32 to 53; (2) The nucleic acid encoding the F protein of the other respiratory syncytial virus comprises a nucleotide sequence as shown in any one of SEQ ID NOs: 29 to 31 and SEQ ID NOs: 54 to 56; (3) the nucleic acid further comprises a 5' cap structure, such as a 7mG(5')ppp(5')N1mpNp cap; and, (4) The nucleic acid further comprises a modification, such as pseudouridine (Ψ) and / or N1-methylpseudouridine (m1Ψ) modification.

12. A recombinant expression vector, characterized in that: The recombinant expression vector comprises the nucleic acid according to claim 9 or 10.

13. A transformant, characterized in that: The transformant comprises the nucleic acid according to any one of claims 9 to 11 or the recombinant expression vector according to claim 12; the transformant is a non-animal or plant species; Preferably, the host cell of the transformant is a eukaryotic cell or a prokaryotic cell; More preferably, the prokaryotic cell is a bacterium, such as Escherichia coli.

14. A lipid nanoparticle, characterized in that: The lipid nanoparticle comprises the nucleic acid of claim 11.

15. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises one or more selected from the group consisting of the F protein mutant according to any one of claims 1 to 5, the combination of F proteins of respiratory syncytial virus according to claim 6 or 7, the antigen combination according to claim 8, the nucleic acid according to any one of claims 9 to 11, and the lipid nanoparticles according to claim 14, and a pharmaceutically acceptable carrier.

16. Use of one or more selected from the group consisting of the F protein mutant according to any one of claims 1 to 5, the combination of the F protein of the respiratory syncytial virus according to claim 6 or 7, the antigen combination according to claim 8, the nucleic acid according to any one of claims 9 to 11, the lipid nanoparticle according to claim 14, and the pharmaceutical composition according to claim 15 in the preparation of a medicament for preventing a disease caused by the respiratory syncytial virus; Preferably, the drug is a vaccine, such as an mRNA vaccine.

Images