Application of TaNOP2 protein and its encoding gene in wheat breeding

Abstract

The present invention discloses the application of TaNOP2 protein and its coding gene in wheat breeding. TaNOP2 The invention relates to the use of genes as inhibitory targets in plant breeding, wherein the goal of the plant breeding is to cultivate plants with increased plant height, / or yield, / or tiller number, / or ear length, / or ear weight, / or number of grains per ear, / or 1000-grain weight, / or photosynthetic rate, / or grain length, / or grain width, / or grain circumference, and / or grain surface area. This invention provides new ideas and potential targets for molecular breeding of wheat, can be used to cultivate new high-yield wheat germplasm, and has industrial promotion value.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology and relates to the application of TaNOP2 protein and its encoding gene in wheat breeding. Background Art

[0002] Wheat (scientific name: Triticum aestivum Wheat (Triticum aestivum L.) is an annual or biennial herbaceous plant in the genus Triticum, family Poaceae. After years of development, wheat has become one of the world's most widely distributed, largest crops, second in total production, most traded, and most nutritious.

[0003] Wheat breeding is of vital importance in modern agriculture. It not only improves wheat yield and quality, but also enhances its disease resistance, adaptability, and nutritional value. Increased plant height is often accompanied by more stem and leaf growth, thereby increasing the plant's biomass. Taller plants can better utilize light energy and increase the area dedicated to photosynthesis. Taller plants improve field ventilation and light conditions, reducing the incidence of pests and diseases. An increase in the number of tillers means each wheat plant can produce more ears, increasing the number of ears and grain yield per unit area. Increased ear length generally means more spikelets and grains per ear. Longer ears typically have more uniform grain distribution, reducing variability in grain size. Longer ears can better utilize light energy and increase the area dedicated to photosynthesis. An increased photosynthetic rate means that the plant can more efficiently convert light energy into chemical energy, promoting biomass accumulation. Wheat breeding plays an important role in increasing yield, improving quality, enhancing disease and stress resistance, and increasing nutritional value. By combining traditional breeding with modern biotechnology, wheat varieties that are better adapted to future agricultural needs can be cultivated, contributing to global food security and sustainable agricultural development. Summary of the Invention

[0004] The purpose of the present invention is to provide the application of TaNOP2 protein and its encoding gene in wheat breeding.

[0005] The present invention provides the use of TaNOP2 protein in regulating plant phenotypic traits. The regulation of plant phenotypic traits means that a reduction in TaNOP2 protein increases plant height, / or yield, / or tiller number, / or ear length, / or ear weight, / or number of grains per ear, / or 1000-grain weight, / or photosynthetic rate, / or grain length, / or grain width, / or grain circumference, and / or grain surface area.

[0006] The present invention also provides TaNOP2 The application of genes in regulating the phenotypic traits of plants. The regulation of the phenotypic traits of plants means: knocking out TaNOP2The gene increases the plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area of ​​the plant. Alternatively, the regulation of the phenotypic traits of the plant means: inhibiting TaNOP2 Gene expression increases the plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area of ​​the plant. Alternatively, the regulation of the phenotypic traits of the plant means: TaNOP2 Gene editing is performed on the target gene to increase the plant height and / or yield and / or number of tillers and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area of ​​the plant.

[0007] The present invention also protects TaNOP2 protein or TaNOP2 The invention relates to the use of genes as inhibition targets in plant breeding; the goal of the plant breeding is to cultivate plants with increased plant height and / or yield and / or number of tillers and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area.

[0008] The present invention also protects against TaNOP2 The application of a substance that inhibits a gene and / or a substance that inhibits TaNOP2 protein in plant breeding; the goal of the plant breeding is to cultivate plants with increased plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area. TaNOP2 Genes can be specifically inhibited TaNOP2 Gene expression. Inhibition TaNOP2 The gene expression substance can be specifically: TaNOP2 Gene-targeted gene editing vectors.

[0009] The present invention also provides a plant breeding method for the purpose of increasing plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area, comprising the following steps: inhibiting the growth of TaNOP2The expression of the gene increases the plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area of ​​the plant. TaNOP2 Gene expression is achieved through gene editing. The target of gene editing is located at TaNOP2 Specifically, the gene editing is based on Cas9, and the targets of the sgRNA are shown in SEQ ID NO: 2 at positions 240-259 and SEQ ID NO: 2 at positions 362-381. The gene editing is achieved by introducing a gene editing vector. TaNOP2 Gene expression is suppressed by introducing TaNOP2 Substances that inhibit gene expression. TaNOP2 The gene expression substance can be specifically: TaNOP2 Gene-targeted gene editing vectors.

[0010] The present invention also provides a plant breeding method for the purpose of increasing plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain perimeter and / or grain surface area, comprising the following steps: TaNOP2 Genes are edited to obtain gene-edited plants, and plants with increased plant height and / or yield and / or number of tillers and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area relative to the recipient plant are screened from the gene-edited plants. The gene editing is achieved by introducing a gene editing vector.

[0011] The present invention also provides a method for preparing wheat with increased plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 27 in the wheat A genome with the DNA molecule shown in SEQ ID NO: 27; TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome is replaced with the DNA molecule shown in SEQ ID NO: 28. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome is replaced with the DNA molecule shown in SEQ ID NO: 30. TaNOP2The DNA molecule represented by SEQ ID NO: 29 in the gene produces wheat with increased plant height, / or yield, / or tiller number, / or ear length, / or ear weight, / or number of kernels per ear, / or 1000-kernel weight, / or photosynthetic rate, / or kernel length, / or kernel width, / or kernel circumference, and / or kernel surface area. Specifically, the substitution is a homozygous substitution, i.e., the substitution occurs on both homologous chromosomes.

[0012] The present invention also provides a method for preparing wheat with increased plant height and / or yield and / or tiller number and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area, comprising the following steps: replacing the DNA molecule shown in SEQ ID NO: 31 in the wheat A genome with the DNA molecule shown in SEQ ID NO: 32; TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome was replaced with the DNA molecule shown in SEQ ID NO: 32. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome was replaced with the DNA molecule shown in SEQ ID NO: 33. TaNOP2 The DNA molecule represented by SEQ ID NO: 29 in the gene produces wheat with increased plant height, / or yield, / or tiller number, / or ear length, / or ear weight, / or number of kernels per ear, / or 1000-kernel weight, / or photosynthetic rate, / or kernel length, / or kernel width, / or kernel circumference, and / or kernel surface area. Specifically, the substitution is a homozygous substitution, i.e., the substitution occurs on both homologous chromosomes.

[0013] The TaNOP2 protein is as follows (a1) or (a2) or (a3) ​​or (a4) or (a5) or (a6): (a1) the protein shown in SEQ ID NO: 4; (a2) the protein shown in SEQ ID NO: 7; (a3) ​​the protein shown in SEQ ID NO: 1; (a4) a fusion protein obtained by connecting a tag to the N-terminus or / and C-terminus of the protein (a1) or (a2) or (a3); (a5) a protein related to the phenotypic traits of the plant obtained by replacing and / or deleting and / or adding one or more amino acid residues of (a1) or (a2) or (a3); (a6) a protein derived from wheat and having more than 98% identity with (a1) or (a2) or (a3) ​​and related to the phenotypic traits of the plant. Exemplarily, the tag may be a Poly-Arg tag, a Poly-His tag, a FLAG tag, a Strep-tag II tag, a c-myc tag, etc. (a1) is the A genome of wheat TaNOP2 TaNOP2 protein encoded by the gene. (a2) is the TaNOP2 protein encoded by the gene of wheat B genome. TaNOP2 TaNOP2 protein encoded by the gene. (a3) ​​is the D genome of wheat TaNOP2 The phenotypic traits are plant height and / or yield and / or number of tillers and / or ear length and / or ear weight and / or number of grains per ear and / or thousand-grain weight and / or photosynthetic rate and / or grain length and / or grain width and / or grain circumference and / or grain surface area.

[0014] described TaNOP2 The gene is a gene encoding TaNOP2 protein. Specifically, TaNOP2 The gene is as follows (b1) or (b2) or (b3) or (b4) or (b5): (b1) a DNA molecule with a coding region as shown in SEQ ID NO: 5; (b2) a DNA molecule with a coding region as shown in SEQ ID NO: 8; (b3) a DNA molecule with a coding region as shown in SEQ ID NO: 2; (b4) a DNA molecule derived from tomato and having more than 95% identity with (b1) or (b2) or (b3) and encoding the protein; (b5) a DNA molecule that hybridizes with the nucleotide sequence defined by (b1) or (b2) or (b3) under stringent conditions and encodes the protein. The stringent conditions can be hybridization at 65°C and washing the membrane in a DNA or RNA hybridization experiment using a solution of 0.1×SSPE (or 0.1×SSC), 0.1% SDS. (b1) is the genome of wheat A. TaNOP2 (b2) is the CDS of the wheat B genome. TaNOP2 (b3) is the CDS of the wheat D genome. TaNOP2 The CDS of the gene. Specifically, TaNOP2 The gene is located in the wheat A genome TaNOP2 A gene having a segment shown in SEQ ID NO: 6. Specifically, TaNOP2 The gene is located in the wheat B genome TaNOP2 A gene having a segment shown in SEQ ID NO: 9. Specifically, TaNOP2 The gene is located in the wheat D genome TaNOP2 The gene has the segment shown in SEQ ID NO: 3.

[0015] The gene editing vector expresses Cas9 protein and sgRNA. The target of the sgRNA is located at TaNOP2gene. Specifically, the sgRNA targets are shown at positions 240-259 of SEQ ID NO: 2 and at positions 362-381 of SEQ ID NO: 2. The gene editing vectors are recombinant plasmids SG2027-1 and SG2027-2. Recombinant plasmid SG2027-1 is a circular plasmid formed by a double-stranded DNA molecule, with positions 1-7914 of SG2027-1 as shown in SEQ ID NO: 10, and positions 7915-15898 of SG2027-1 as shown in GenBank: OQ615330.1 (21-AUG-2024), positions 280-8263. Recombinant plasmid SG2027-2 is also a circular plasmid formed by a double-stranded DNA molecule. Compared with recombinant plasmid SG2027-1, the sequence difference of recombinant plasmid SG2027-2 lies only in the sgRNA coding region, that is, the DNA segment shown in SEQ ID NO: 11 replaces positions 519-614 in SEQ ID NO: 10.

[0016] Any of the above plants has TaNOP2 Any of the above plants is a monocot or dicot. Any of the above plants is a grass. Any of the above plants is a wheat plant. Any of the above plants is a Kenong 199 wheat.

[0017] The present invention provides new ideas and potential targets for wheat molecular breeding, can be used to cultivate new high-yield wheat germplasm, and has industrial promotion value. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 These are exemplary photos of plants in the grain filling stage.

[0019] Figure 2 is the statistical result of photosynthetic rate.

[0020] Figure 3 These are the statistical results of plant height, number of tillers per plant and yield per plant.

[0021] Figure 4 These are exemplary photos of ear phenotypes and kernels.

[0022] Figure 5 These are the statistical results of ear length, number of grains per ear, weight per ear and thousand-grain weight.

[0023] Figure 6 It is the statistical result of grain length, grain width, grain circumference and grain area.

[0024] Figure 7 RNA m 5 Results of C modification levels. DETAILED DESCRIPTION

[0025] The present invention will be further described in detail below in conjunction with specific embodiments. The examples provided are only for illustrating the present invention and are not intended to limit the scope of the present invention. The examples provided below can serve as a guide for further improvements by those skilled in the art and are not intended to limit the present invention in any way.

[0026] The experimental methods in the following examples, unless otherwise specified, are all conventional methods, and are carried out in accordance with the techniques or conditions described in the literature in this field or in accordance with the product instructions. The materials, reagents, etc. used in the following examples, unless otherwise specified, can all be obtained from commercial channels. Unless otherwise specified, the quantitative tests in the following examples are all repeated three times, and the results are averaged. The wild-type plant refers to the Kenong 199 plant. Kenong 199 (Kenong199, KN199) is a wheat germplasm in the prior art. In the examples, *P<0.05, **P<0.01, ***P<0.001, ****P<0.0001; the P value is from one-way analysis of variance (as well as non-parametric or mixed methods).

[0027] Sequencing confirmed that the cDNA of the Kenong 199 plant contains the DNA molecules shown in SEQ ID NO: 2, SEQ ID NO: 5, and SEQ ID NO: 8. Sequencing also confirmed that the genomic DNA of the Kenong 199 plant contains the DNA molecules shown in SEQ ID NO: 3 (located in genome D), SEQ ID NO: 6 (located in genome A), and SEQ ID NO: 9 (located in genome B). The DNA molecule shown in SEQ ID NO: 2 encodes the protein shown in SEQ ID NO: 1. SEQ ID NO: 3 represents the region of the genomic DNA encoding the protein shown in SEQ ID NO: 1 where the sgRNA target is located. The DNA molecule shown in SEQ ID NO: 5 encodes the protein shown in SEQ ID NO: 4. SEQ ID NO: 6 represents the region of the genomic DNA encoding the protein shown in SEQ ID NO: 4 where the sgRNA target is located. The DNA molecule shown in SEQ ID NO: 8 encodes the protein shown in SEQ ID NO: 7, and SEQ ID NO: 9 is the segment of the genomic DNA where the sgRNA target is located in the DNA molecule encoding the protein shown in SEQ ID NO: 7.

[0028] Example

[0029] 1. Construction of recombinant plasmid

[0030] The recombinant plasmid SG2027-1 is a circular plasmid (15898 bp) formed by a double-stranded DNA molecule, positions 1-7914 of which are shown in SEQ ID NO: 10, and positions 7915-15898 of which are shown in GenBank: OQ615330.1 (21-AUG-2024) at positions 280-8263. In SEQ ID NO: 10, nucleotides 519-614 are the sgRNA coding region (the target sequence of the sgRNA corresponds to positions 240-259 in SEQ ID NO: 2, or positions 300-319 in SEQ ID NO: 3, or positions 237-256 in SEQ ID NO: 5, or positions 426-445 in SEQ ID NO: 6, or positions 237-256 in SEQ ID NO: 8, or positions 418-437 in SEQ ID NO: 9), and nucleotides 2697-6968 encode the Cas9 protein.

[0031] Recombinant plasmid SG2027-2 is a circular plasmid (15,898 bp) composed of double-stranded DNA. Compared to recombinant plasmid SG2027-1, the sequence of recombinant plasmid SG2027-2 differs only in the sgRNA coding region, where positions 519-614 of SEQ ID NO:10 are replaced with the DNA segment represented by SEQ ID NO:11. The nucleotide sequence represented by SEQ ID NO:11 represents the sgRNA coding region (the target sequence of the sgRNA corresponds to positions 362-381 of SEQ ID NO:2, positions 614-633 of SEQ ID NO:3, positions 380-399 of SEQ ID NO:5, positions 762-781 of SEQ ID NO:6, positions 350-369 of SEQ ID NO:8, or positions 724-743 of SEQ ID NO:9).

[0032] 2. Preparation of mutant plants

[0033] 1. The recombinant plasmid SG2027-1 and the recombinant plasmid SG2027-2 were co-introduced into Agrobacterium tumefaciens EHA105 competent cells by electroporation to obtain recombinant Agrobacterium.

[0034] 2. Take the immature embryos of the seeds of Kenong 199 as explants.

[0035] 3. The recombinant Agrobacterium obtained in step 1 is introduced into the explant obtained in step 2 by the Agrobacterium infection method, and rooted regenerated plants are cultured to obtain T0 generation plants.

[0036] 4. Screen transgenic plants from the T0 generation plants obtained in step 3.

[0037] Screening method: Take plant leaves and extract genomic DNA; use the genomic DNA as a template and use the primer pair consisting of HYG-F1 and HYG-R1 for PCR amplification. If an amplified product (about 519bp) is obtained, the plant is a transgenic plant.

[0038] 5. The T0 generation transgenic plants screened in step 4 are self-pollinated and the seeds are harvested, and then the seeds are cultivated into plants, namely the T1 generation plants.

[0039] 6. Screen transgenic plants from the T1 generation plants obtained in step 5 (the screening method is the same as that in step 4).

[0040] 7. The T1 generation transgenic plants screened in step 6 are self-pollinated and the seeds are harvested, and then the seeds are cultivated into plants, which are the T2 generation plants.

[0041] 8. Select target plants from the T2 generation plants obtained in step 7.

[0042] Screening method: Take plant leaves and extract genomic DNA; use the genomic DNA as a template and use the primer pair consisting of HYG-F1 and HYG-R1 to perform PCR amplification, and screen plants without amplification products.

[0043] 9. Select homozygous gene-edited plants from the T2 generation target plants screened in step 8.

[0044] Screening method: Genomic DNA was extracted from plant leaves. Using the genomic DNA as a template, PCR amplification was performed using primer pair A1 (composed of A-F1 and A-R1), primer pair B1 (composed of B-F1 and B-R1), primer pair D1 (composed of D-F1 and D-R1), primer pair A2 (composed of A-F2 and A-R2), primer pair B2 (composed of B-F2 and B-R2), or primer pair D2 (composed of D-F2 and D-R2). The amplified products were recovered and sequenced. Based on the sequencing results, plants meeting criterion ① were selected to meet criterion ②. Criterion ①: Each primer pair yielded a single sequencing result for each amplified product (indicating homozygous genotype for that amplified product). Criterion ②: The sequencing results of the amplification product obtained using primer pair A1 are different from those of wild-type sequence A1, and / or the sequencing results of the amplification product obtained using primer pair B1 are different from those of wild-type sequence B1, and / or the sequencing results of the amplification product obtained using primer pair D1 are different from those of wild-type sequence D1, and / or the sequencing results of the amplification product obtained using primer pair A2 are different from those of wild-type sequence A2, and / or the sequencing results of the amplification product obtained using primer pair B2 are different from those of wild-type sequence B2, and / or the sequencing results of the amplification product obtained using primer pair D2 are different from those of wild-type sequence D2. Wild-type sequence A1: The nucleotide sequence of the amplification product obtained by PCR amplification using genomic DNA from wild-type leaves as a template using primer pair A1. Wild-type sequence B1: The nucleotide sequence of the amplification product obtained by PCR amplification using genomic DNA from wild-type leaves as a template using primer pair B1. Wild-type sequence D1: The nucleotide sequence of the amplification product obtained by PCR amplification using genomic DNA from wild-type leaves as a template using primer pair D1. Wild sequence A2: The nucleotide sequence of the amplified product obtained by PCR amplification using primer pair A2 and genomic DNA from leaves of wild-type plants as a template. Wild sequence B2: The nucleotide sequence of the amplified product obtained by PCR amplification using primer pair B2 and genomic DNA from leaves of wild-type plants as a template. Wild sequence D2: The nucleotide sequence of the amplified product obtained by PCR amplification using primer pair D2 and genomic DNA from leaves of wild-type plants as a template.

[0045] After the above steps, two homozygous gene-edited plants were obtained from the T2 generation plants, named Ta-KO1 and Ta-KO2. TaNOP2 Compared with the genes in the Ta-KO1 plant genome, TaNOP2The following mutations occurred in the genes: CTCGGACGCCGGTAGCAGCGAGG (SEQ ID NO: 26) in the A genome mutated to CTCGGACGCCGGTAGCGCGAGG (SEQ ID NO: 27), CTCGGACGCCGGTAGCAGCGAGG (SEQ ID NO: 26) in the B genome mutated to CTCGGACGCCGGTGCAGCGAGG (SEQ ID NO: 28), and ACTCTGGAGAGGAATCAGATGGG (SEQ ID NO: 29) in the B genome mutated to ACTCTGGAGAGGAATGGG (SEQ ID NO: 30). All mutations were homozygous (i.e., a pair of homologous chromosomes had the same mutation), and no mutations occurred in other parts. Compared with the wild-type plant genome, TaNOP2 Compared with the genes in the Ta-KO2 plant genome, TaNOP2 The following gene mutations occurred: CTCGGACGCCGGTAGCAGCGAGG (SEQ ID NO: 26) in the A genome mutated to CTCGGACGCCGGTGCAGCGAGG (SEQ ID NO: 31), CTCGGACGCCGGTAGCAGCGAGG (SEQ ID NO: 26) in the B genome mutated to CTCGGACGCCGGTAAGCAGCGAGG (SEQ ID NO: 32), and ACTCTGGAGAGGAATCAGATGGG (SEQ ID NO: 29) in the B genome mutated to ACTCTGGAGAGGAATCGATGGG (SEQ ID NO: 33). All mutations were homozygous (i.e., the same mutation occurred on a pair of homologous chromosomes). No other mutations occurred.

[0046] 3. Phenotypic Identification

[0047] The test seeds were obtained from self-pollination of Ta-KO1 and Ta-KO2 plants, as well as seeds from wild-type plants. On September 28, 2023, the test seeds were planted in a field at the experimental base in Shunyi District, Beijing, watered, and covered with film. On March 13, 2024, the film was removed and normal cultivation and management resumed.

[0048] See the photos of plants in the grain filling stage for details. Figure 1 (Scale bar, 20 cm). Flag leaves were removed at the heading stage for photosynthetic rate measurement. The photosynthetic rate was measured using the LI-6800 Photosynthesis System (Biosciences). Specific measurement conditions: CO2 concentration of 400 µmol / mol, leaf temperature maintained at 28 ± 1°C, relative humidity of 55%-75%, and airflow rate of 500 µmol / s. Results are shown in [ 1 ]. Figure 2(Sample number ≥ 15 plants). At the mature stage, plant height, number of tillers per plant and yield per plant were measured. Figure 3 (Number of samples = 7 plants). Full maturity, ear phenotype photos are shown in Figure 4 A (scale bar, 3 cm), grain photos see Figure 4 B (scale bar, 1 cm). At the mature stage, 6 plants were randomly selected, and 2-3 mature ears of uniform size were selected from each plant, obtaining a total of 15 mature ears. The ear length, number of grains per ear, and weight per ear were counted. At the mature stage, 6 plants were randomly selected, and the grains in the mature ears were harvested and the thousand-grain weight was measured. The results are shown in Figure 5 At the mature stage, 6 plants were randomly selected, and 2-3 mature ears of uniform size were selected from each plant, resulting in a total of 15 mature ears. The grains were collected, and 20 grains were randomly selected from them to measure the grain length (GL), grain width (GW), grain perimeter (GP) and grain area (GA). Figure 6 . Figures 1 to 6 In the figure, Ta-KO1 represents the results of the above steps on plants grown from seeds obtained by self-pollination of Ta-KO1 plants, Ta-KO2 represents the results of the above steps on plants grown from seeds obtained by self-pollination of Ta-KO2 plants, and Ta-CK represents the results of the above steps on plants grown from seeds obtained by self-pollination of wild-type plants. The results showed that, compared with the offspring plants of the wild-type plants, the offspring plants of Ta-KO1 plants and the offspring plants of Ta-KO2 plants had significantly increased photosynthetic rate, significantly increased plant height, significantly increased number of tillers per plant, significantly increased yield per plant, significantly increased ear length, significantly increased number of grains per ear, significantly increased weight per ear, significantly increased thousand-grain weight, significantly increased grain length, significantly increased grain width, significantly increased grain circumference, and significantly increased grain area.

[0049] 4. RNA m 5 C modification level

[0050] The test seeds included seeds obtained from self-pollination of Ta-KO1 plants, seeds obtained from self-pollination of Ta-KO2 plants, and seeds from wild-type plants. The test seeds were germinated and cultured in the greenhouse until the heading stage. Flag leaves were removed for total RNA extraction. Three biological replicates were set up for each test seed.

[0051] Total RNA was collected and RNA Dot-blot was performed. The specific antibody used was anti-m 5 C antibody (Diagenode, C15200081), which can specifically recognize m on RNA 5 C modification site. The RNA amount was set to 1000 ng and then diluted to 500 ng. Figure 7The results showed that RNA samples of different doses could be recognized by specific antibodies, and the signal intensity was positively correlated with the amount of RNA. Total RNA was collected and detected by triple quadrupole liquid chromatography-mass spectrometry (UHPLC-MS / MS). 5 The abundance of C modification was determined using an Agilent 6400 triple quadrupole liquid chromatography-mass spectrometry instrument, which features high sensitivity and high resolution. Watson's distilled water (0.1% formic acid) and acetonitrile (0.1% formic acid) were used as mobile phases. The separation column was a GOLDaQ column (100 mm × 2.1 mm, pore size 1.9 μm), and ion pair injection detection was used. This column is widely used in the quantitative analysis of RNA modifications due to its excellent separation efficiency and stability. The results are shown in the figure. Figure 7 The results showed that compared with Ta-CK plants, Ta-KO1 and Ta-KO2 offspring plants had higher RNA m 5 C modification levels were significantly increased.

[0052] The sequences of the primers used in the above examples are as follows:

[0053] HYG-F1 (SEQ ID NO: 12): 5'-CAAAGATCGTTATGTTTATCGGCACT-3';

[0054] HYG-R1 (SEQ ID NO: 13): 5'-TTGGCGACCTCGTATTGGGAA-3'.

[0055] A-F1 (SEQ ID NO: 14): 5'-AGGAGGAGGAGGATTCAGACG-3';

[0056] A-R1 (SEQ ID NO: 15): 5'-GGGATGGCTTGATGGAGAA-3'.

[0057] A-F2 (SEQ ID NO: 16): 5'-TTGATGGGCTTTGTTGTG-3';

[0058] A-R2 (SEQ ID NO: 17): 5'-TTGGAAGGTTAGGTGGTC-3'.

[0059] B-F1 (SEQ ID NO: 18): 5'-GAAGAAGGTGGTCAAGGTCC-3';

[0060] B-R1 (SEQ ID NO: 19): 5'-ACGCAGCACTAATTTGCATAGC-3'.

[0061] B-F2 (SEQ ID NO: 20): 5'-CTCCATCAAGCCATTCCA-3';

[0062] B-R2 (SEQ ID NO: 21): 5'-ATGCGAACAGAAGAAGGAAA-3'.

[0063] D-F1 (SEQ ID NO: 22): 5'-AGGAGGAGGAGGATTCAGACG-3';

[0064] D-R1 (SEQ ID NO: 23): 5'-CACAACAAAGCCCATCAACT-3'.

[0065] D-F2 (SEQ ID NO: 24): 5'-GTTGATGGGCTTTGTTGT-3';

[0066] D-R2 (SEQ ID NO: 25): 5'-AGATTTGGCAGGTTAGGT-3'.

[0067] The present invention has been described in detail above. It will be apparent to those skilled in the art that the present invention may be practiced over a wide range of parameters, concentrations, and conditions without departing from the spirit and scope of the present invention and without unnecessary experimentation. Although specific embodiments have been given herein, it should be understood that further modifications may be made to the present invention. In summary, this application is intended to encompass any variations, uses, or improvements to the present invention, including those made by conventional techniques known in the art that depart from the scope of the present invention. Applications of the essential features may be made within the scope of the following claims.

Claims

1. A method for preparing wheat with increased grain length, grain width, grain perimeter and grain surface area, comprising the steps of: replacing the DNA molecule represented by SEQ ID NO: 27 in the wheat A genome with the DNA molecule represented by SEQ ID NO:

27. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome is replaced with the DNA molecule shown in SEQ ID NO:

28. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome is replaced with the DNA molecule shown in SEQ ID NO:

30. TaNOP2 The DNA molecule represented by SEQ ID NO: 29 in the gene produces wheat with increased grain length, grain width, grain circumference and grain surface area; described TaNOP2 The gene is the gene encoding TaNOP2 protein; The TaNOP2 protein is as follows (a1) or (a2) or (a3): (a1) the protein represented by SEQ ID NO: 4; (a2) the protein represented by SEQ ID NO: 7; (a3) the protein represented by SEQ ID NO: 1; In the wheat A genome TaNOP2 The gene has the segment shown in SEQ ID NO: 6; the B genome of wheat TaNOP2 The gene has the segment shown in SEQ ID NO:

9.

2. A method for preparing wheat with increased grain length, grain width, grain perimeter and grain surface area, comprising the steps of: replacing the DNA molecule represented by SEQ ID NO: 31 in the wheat A genome with the DNA molecule represented by SEQ ID NO:

31. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome was replaced with the DNA molecule shown in SEQ ID NO:

32. TaNOP2 The DNA molecule shown in SEQ ID NO: 26 in the wheat B genome was replaced with the DNA molecule shown in SEQ ID NO:

33. TaNOP2 The DNA molecule represented by SEQ ID NO: 29 in the gene produces wheat with increased grain length, grain width, grain circumference and grain surface area; described TaNOP2 The gene is the gene encoding TaNOP2 protein; The TaNOP2 protein is as follows (a1) or (a2) or (a3): (a1) the protein represented by SEQ ID NO: 4; (a2) the protein represented by SEQ ID NO: 7; (a3) the protein represented by SEQ ID NO: 1; In the wheat A genome TaNOP2 The gene has the segment shown in SEQ ID NO: 6; the B genome of wheat TaNOP2 The gene has the segment shown in SEQ ID NO:9.

Images