Collocephalosporium simonii and application thereof

Abstract

The invention discloses Gliocephalum simonsii and application of the Gliocephalum simonsii, the strain number of the Gliocephalum simonsii is JSAFC 2056, the Gliocephalum simonsii is preserved in the China General Microbiological Culture Collection Center (CGMCC) on September 23, 2024, and the preservation number is CGMCC No.41562. The Gliocephalum simonsii has the advantages that the Gliocephalum simonsii can be used for preparing the Gliocephalum simonsii; the biocontrol microbial inoculum for the ponceau can significantly inhibit the survival activity of the ponceau, the survival activity of the ponceau can be reduced to 0 after the biocontrol microbial inoculum is treated for 28 days, and the biocontrol microbial inoculum is environmentally friendly, non-toxic and harmless; the preparation method of the biocontrol bacterium agent for the Richthys corpulenta is simple, the culture requirement is low, and the biocontrol bacterium agent has a good application prospect.

Description

Technical Field

[0001] The present invention belongs to the field of microbial technology and relates to Gliocephalotrichum simmonsii and its application. Background Art

[0002] Anomala corpulenta is one of the important underground pests in agricultural areas and also one of the dominant species of three scarab beetles. The main damage characteristics of the larvae of Anomala corpulenta are that they move in the soil, feed on germinated seeds, resulting in uneven emergence of crops and even large - scale lack of seedlings. At the same time, they also bite off the rhizomes and roots of plants, making the plants unable to absorb water and nutrients, and ultimately leading to the death of the plants. In addition, the wounds bitten by the larvae are easy channels for pathogens to invade, causing other diseases and further aggravating the damage to crops. Therefore, the damage of the larvae of Anomala corpulenta to crops is very serious, and effective control measures need to be taken to reduce its harm.

[0003] In recent years, the development of control agents with strong specificity, environmental friendliness, and high virulence, especially biological insecticides, or the development of new strains and new genes has become a research hotspot. Therefore, the management of pests has shifted to their ecological relationship with microorganisms. For this special group of underground pests such as Anomala corpulenta, it has become a wise choice to target the larval stage for control. Infecting the larvae with microbial agents that are relatively safe and compatible with the environment is undoubtedly the main means. Biocontrol fungi have the characteristics of parasitizing many species, strong adaptability, short pathogenic cycles, strong specificity, not causing harm to humans and livestock, and being environmentally friendly. Although the application range of Gliocephalotrichum fungi is less than that of Beauveria bassiana and Metarhizium anisopliae, it can still grow stably and maintain high infection activity at lower temperatures, having natural advantages in controlling overwintering pest populations. Therefore, screening biocontrol strains with strong pathogenicity is particularly crucial. However, there is currently no report on using Gliocephalotrichum fungi to control Anomala corpulenta. Summary of the Invention

[0004] Object of the Invention: The object of the present invention is to provide Gliocephalotrichum simmonsii and its application in controlling Anomala corpulenta.

[0005] Technical Solution: The present invention provides Gliocephalotrichum simmonsii, and the strain number of the Gliocephalotrichum simmonsii is JSAFC2056, which was deposited at the General Microbiological Center of the China Committee for Culture Collection of Microorganisms on September 23, 2024, with the deposit number CGMCC No. 41562.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the Gliocephalotrichum simmonsii is shown in SEQ ID NO.1, and the nucleotide sequence of the His gene is shown in SEQ ID NO.2.

[0007] The present invention also provides a biocontrol bacterial agent, and the active ingredient of the biocontrol bacterial agent is the above-mentioned Gliocephalotrichum simmonsii.

[0008] The present invention also provides the application of the above-mentioned Gliocephalotrichum simmonsii and the biocontrol bacterial agent in controlling Anomala corpulenta.

[0009] Furthermore, the application specifically is to spray the spore suspension of Gliocephalotrichum simmonsii JSAFC 2056 on the larvae of Anomala corpulenta.

[0010] Furthermore, the preparation method of the spore suspension is as follows: (1) inoculate the biocontrol bacterium Gliocephalotrichum simmonsii JSAFC 2056 on a PDA medium for culturing to obtain a culture; (2) place the culture obtained in step (1) in a Tween-80 solution, shake well and filter out the spores.

[0011] Furthermore, the culture conditions in step (1) are 25°C, 75% humidity, and dark culture.

[0012] Furthermore, the concentration of the spore suspension is 10 8 / ml.

[0013] Furthermore, the application amount of the spore suspension is 2 days / time, lasting for 28 days.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: Through isolation and purification of the soil in Hangzhou, Zhejiang, 1 strain of Gliocephalotrichum simmonsii is obtained. This strain can be used as a biocontrol strain and has a relatively high lethality rate and is environmentally friendly and non-toxic to Anomala corpulenta, showing strong pathogenicity to the larvae of Anomala corpulenta. It is a biocontrol strain with potential value in the control of Anomala corpulenta and has a positive significance for preventing the spread of Anomala corpulenta. Description of the Drawings

[0015] Figure 1 : Colony morphology diagram of Gliocephalotrichum simmonsii JSAFC 2056.

[0016] Figure 2 : Phylogenetic tree of Gliocephalotrichum simmonsii JSAFC 2056.

[0017] Figure 3 : Effect of Gliocephalotrichum simmonsii JSAFC 2056 on the growth of Anomala corpulenta larvae.

[0018] Figure 4 The figure shows the relationship between the inoculation days of the biocontrol strain Gliocephalotrichum simmonsii JSAFC 2056 of the present invention and the survival activity of Anomala corpulenta larvae. Detailed implementation mode

[0019] The technical solution of the present invention will be further described below with reference to the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can prevent and control plant diseases, mainly including bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Gliocephalotrichum simmonsii JSAFC 2056

[0022] 1. Isolation of Gliocephalotrichum simmonsii JSAFC 2056

[0023] Soil from Hangzhou, Zhejiang was taken, and JSAFC 2056 was isolated therefrom. The colony characteristics are as follows: When cultured on a PDA plate medium, the colony grows rapidly, adheres tightly to the substrate, and its surface color is gray to brown ( Figure 1 ).

[0024] 2. Molecular biological identification of Gliocephalotrichum simmonsii JSAFC 2056

[0025] (1) The genomic DNA of strain JSAFC 2056 was extracted using a kit from TIANGEN Company.

[0026] (2) Amplify the ITS and His genes of genomic DNA separately. DNA amplification uses a reaction volume of 30 μL, including 15 μL of 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) of each primer pair ITS1 (SEQ ID NO.3: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.4: 5'-TCCTCCGCTTATTGATATGC-3') or CYLH3F (SEQ ID NO.5: 5'-AGGTCCACTGGTGGCAAG-3') & CYLH3R (SEQ ID NO.6: 5'-AGCTGGATGTCCTTGGACTG-3'), 2 μL of template DNA and 11 μL of ddH 2 O. The PCR amplification program conditions are as follows: pre-denaturation at 94 °C for 5 min; denaturation at 94 °C for 30 s, annealing at 54 °C for 45 s (52 °C for the His gene), extension at 72 °C for 60 s, for a total of 35 cycles; finally, extension at 72 °C for 10 min.

[0027] (3) After the amplified PCR products were electrophoresed on 1% agarose gel and observed under ultraviolet light, the PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: The ITS gene sequence of strain JSAFC 2056 was SEQ ID NO.1 (CTCCCAAACCCATGTGAATCTTACCTTTACGTTCCCTCGGCGGCGTTCCCCTCGG GGTTCCCGCCAGAGGACCAACAAACCCTTTGAATTTATTAGTATTATTCTGAGTGATTTAATCAATAAATCAAAACTTTCAACAACGGATCTCTTGGTTCTGGCATCGATGAAGAACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCACATTGCGCCCGCCAGTATTCTGGCGGGCATGCCTGTTCGAGCGTCATTTCAACCCTCAAGCCCCCGGGCTTGGTGTTGGAGGTCGGCACAAGCGTCCCTCGGGTCGCCGCCGTCTCCCAAATATAGTGGCGGTCTCGCTGTAGCCTCCTCTGCGTAGTAACTCACCTCGCACTGGAACGCGGCGCGGCCAAGCCGTTAAACCCCCCACTTCTGAAGG), and the His gene sequence was SEQ ID NO.2(AGGTCCACCGGGGGCAAGGCCCCCCGTAAGCAGCTTGCTTCCAAGGCTGGTAA GTTTAATCGCATCCATCGTCGCCATCGCTGCGACCTCCATCACCATCAACATCATCGCTAACTTCCTCACCACCAGCCCGCAAGAGCGCCCCCTCCACCGGAGGTGTCAAGAAGCCTCACCGCTACAAGCCCGGTACCGTCGCTCTCCGTGAGATTCGTCGCTACCAGAAGTCCACTGAGCTTCTCATCCGCAAGCTCCCCTTCCAGCGTCTCGTAAGTACATCCGCTACTCGACGCGTCTAACGCGACTAGCACTTTACGCGCTCTCCAAAACAATACTAACTCTTCACCAACAGGTCCGTGAGATTGCCCAGGACTTCAAGAGCGACCTCCGCTTCCAGTCCTCCGCCATCGGTGCTCTCCAGGAGTCCGTTGAGTCTTACCTCGTCTCCCTCTTCGAGGACACCAACCTTTGCGCCATCCACGCCAAGCGTGTCACCATCCAGTCCAAGGACATCCAGCT).

[0028] (4) Align the sequences of SEQ ID NO.1 and SEQ ID NO.2 on the NCBI database website and construct a phylogenetic tree. See Figure 2 . The alignment results are shown in Table 1. Based on the results in Table 1, it can be deduced that the biocontrol bacterium JSAFC 2056 of the present invention is Gliocephalotrichum simmonsii, named Gliocephalotrichum simmonsii JSAFC 2056, and the said strain was deposited with the China General Microbiological Culture Collection Center on September 23, 2024, with the deposit number CGMCC No. 41562, and the taxonomic name is Gliocephalotrichum simmonsii JSAFC 2056, and the deposit address is Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard 1, Beichen, Chaoyang District, Beijing.

[0029] Table 1 Alignment results of SEQ ID NO.1 and SEQ ID NO.2 sequences

[0030]

[0031] Example 2: Determination of the pathogenicity of Gliocephalotrichum simmonsii JSAFC 2056 against the larvae of Anomala corpulenta

[0032] 1. Preparation of spore suspension

[0033] (1) Inoculate the biocontrol bacterium Gliocephalotrichum simmonsii JSAFC 2056 on PDA medium to make a culture, and the culture conditions are: culture for 5 - 7 days under dark conditions at 25 °C;

[0034] (2) Use an inoculation needle to pick out the fungal blocks in the culture and place them in a Tween - 80 solution (0.1%) and shake well. After shaking, filter out the spores and adjust the concentration to make a biocontrol agent for Anomala corpulenta. The spore concentration of the biocontrol agent for Anomala corpulenta is 10 8 spores / mL.

[0035] 2. Determination of pathogenicity

[0036] (1) Immersion method: Take healthy Anomala corpulenta larvae of the same size (collected from the fields of Sizhuang Village, Houbai Town, Jurong City), immerse them in the spore suspension with a concentration of 10 8 spores / mL for 20 s, then quickly take them out and place them in a culture box, one larva per box. The box is filled with sand. Use the immersion of 0.1% Tween - 80 as a control. Each group has 10 larvae and 3 replicates. Place the treated larvae in a constant temperature of 22 °C for feeding. After 3 d, observe the color change, death situation and infection situation of Anomala corpulenta larvae every day and record the data.

[0037] Use SPSS 27.0 software for data statistical analysis, and calculate the median lethal time (LT 50 ) through Probit regression analysis.

[0038] The Anomala corpulenta larvae infected by the strain Gliocephalotrichum simmonsii JSAFC 2056 after 10 days are shown in Figure 3 , it can be seen that this strain has a pathogenic effect on Anomala corpulenta. The pathogenicity test results of the spore suspension of strain JSAFC 2056 (10 8 spores / mL) infecting Anomala corpulenta larvae are shown in Figure 4 . From Figure 4 , it can be known that after inoculating Anomala corpulenta larvae, the survival rate of the larvae is significantly lower than that of the control; the survival activity curve from 10 to 20 d shows a rapid downward trend, and then shows a slow downward trend until the 28th d. The survival rate of Anomala corpulenta larvae infected with strain JSAFC 2056 reaches 0. The virulence regression equation is y = 0.162 - 1.873x (R 2 = 0.975), LT 50The value is 11.56 d, and the 95% confidence interval is 10.88 - 12.25 d.

[0039] (2) Pot method: Select pots with a diameter of 12 cm. Place 1 healthy and uniformly sized Anomala corpulenta larva in each pot. Set up 2 groups in the experiment (control group and treatment group), with 10 in each group. The experimental group: Pour 8 mL of JSAFC 2056 spore suspension (10 8 individuals / mL) into each pot; the control group: Pour 8 mL of 0.1% Tween-80 into each pot.

[0040] (3) Pour the pots once every 2 days, and count the mortality rate of Anomala corpulenta after 28 days.

[0041] After 28 days, all Anomala corpulenta larvae in the experimental group died, while the mortality rate of Anomala corpulenta larvae in the control group was only 3%.

[0042] In summary, the strain JSAFC 2056 provided by the present invention is a biocontrol fungus that can be used to control Anomala corpulenta, and has the characteristics of strong pathogenicity, environmental protection and no pollution, and difficulty in generating drug resistance to Anomala corpulenta larvae, and can be widely used for the control of Anomala corpulenta larvae before emergence.

Claims

1. A Gliocephalotrichum simmonsii, characterized in that The strain number of the Gliocephalotrichum simmonsii is JSAFC 2056, which was deposited in the General Microbiology Center of the China Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC No.41562.

2. The Gliocephalotrichum simmonsii according to claim 1, characterized in that The nucleotide sequence of the ITS gene of the Simmondsia simonii is shown in SEQ ID NO.1, and the nucleotide sequence of the His gene is shown in SEQ ID NO.

2.

3. A biocontrol agent, characterized in that: The active ingredient of the biocontrol fungus agent is the Gliocephalotrichum simmonsii as described in any one of claims 1 to 2.

4. Use of the Gliocephalotrichum simmonsii according to any one of claims 1 to 2 and the biocontrol fungus agent according to claim 3 in controlling A. cooperi.

5. The use according to claim 4, characterized in that: The application is specifically to spray the spore suspension of Gliocephalotrichum simmonsii JSAFC 2056 described in any one of claims 1 to 2 on the larvae of A. cooperi.

6. The use according to claim 5, characterized in that: The preparation method of the spore suspension is: (1) The biocontrol bacterium Simmons colloidus JSAFC 2056 was inoculated on PDA medium to prepare a culture; (2) The culture obtained in step (1) is placed in a Tween-80 solution, shaken well, and then the spores are filtered out.

7. The use according to claim 6, characterized in that: The culture conditions in step (1) are 25° C., 75% humidity, and dark culture.

8. The use according to claim 5, characterized in that: The concentration of the spore suspension is 10 8 / mL.

9. The use according to claim 5, characterized in that: The spore suspension was applied 2 times a day for 28 days.

Images