Bacillus subtilis L48 strain and application thereof

By using Bacillus subtilis L48 strain as a bio-defensive agent, the problems of continuous cropping obstacles and disease infection in Chuju planting are solved, effective prevention and treatment and growth promotion of Chuju, and green and environmentally friendly agricultural solutions are provided.

CN120118804AInactive Publication Date: 2025-06-10ANHUI UNIVERSITY OF TRADITIONAL CHINESE MEDICINE
View PDF 12 Cites 0 Cited by

Patent Information

Application Number
CN202510482602.3
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-17
Publication Date
2025-06-10
Estimated Expiration
Not applicable · inactive patent

AI Technical Summary

Technical Problem

There are continuous cropping obstacles and disease infection problems in Chuju planting, resulting in an increase in mortality rate and a decrease in quality. The existing agrochemical products are costly and are not friendly to the soil environment.

Method used

The L48 strain of Bacillus subtilis was screened as a new bio-drug agent. Chuju was treated by root injury perfusion method to inhibit the growth of Fusarium syringae and Fusarium oxysporus and alleviate continuous cropping disorders.

Benefits of technology

Effectively prevent and control the root rot and blight of Chuju, promote the growth of Chuju, alleviate continuous cropping obstacles, and provide green prevention and control technology and sustainable development industrial solutions.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118804A_ABST
    Figure CN120118804A_ABST
Patent Text Reader

Abstract

The invention provides a bacillus subtilis L48 strain and application thereof, and relates to the technical field of agricultural biological control. The bacillus subtilis L48 strain is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on October 23, 2024, and the preservation number of the bacillus subtilis L48 strain is GDMCC NO.65332. The bacillus subtilis L48 strain has the advantages that the bacillus subtilis L48 strain is preserved in the Guangdong Microbial Culture Collection Center (GDMCC) on October 23, 2024; the bacterium is gram-positive bacterium, can generate protease, amylase, cellulase and siderophore, and can decompose potassium and fix nitrogen. The growth of root rot pathogenic bacteria fusarium solani and fusarium oxysporum can be effectively inhibited, meanwhile, the Chuzhou chrysanthemum diseases can be effectively prevented and treated, the growth of the Chuzhou chrysanthemum is promoted, and the continuous cropping obstacle of the Chuzhou chrysanthemum is relieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the technical field of microbial control, and particularly relates to a Bacillus subtilis L48 strain and its application. Background Art

[0002] Chuju of Anhui medicine is a traditional characteristic product in Anhui Province. In recent years, due to the continuous increase in the demand for Chuju in domestic and foreign markets, the planting area of Chuju has been continuously expanded and the accumulation of planting years, which makes the continuous cropping obstacle of Chuju become more and more obvious. The continuous cropping obstacle leads to an increase in the morbidity and mortality rate of Chuju and a decline in quality, becoming the main problem restricting the production of Chuju. In addition, Chuju itself is also easily infected by Fusarium solani and Fusarium oxysporum, causing root rot and wilt disease, further resulting in a reduction in the yield and quality of Chuju.

[0003] At present, for the continuous cropping obstacle and disease infection of Chuju, agricultural chemical products such as soil fumigants, fungicides, and chemical fertilizers are usually used to improve the continuous cropping obstacle. However, these methods not only have high costs but also can lead to the imbalance of the soil ecological environment. Therefore, seeking an efficient and environmentally friendly soil improvement method to overcome the soil continuous cropping obstacle is particularly crucial for the continuous planting of Chuju. Summary of the Invention

[0004] Aiming at the deficiencies of the prior art, the present invention provides a Bacillus subtilis L48 strain and its application, screening an antagonistic bacterium against soil continuous cropping obstacle pathogenic bacteria from the rhizosphere microorganisms of Chuju, constructing a new biological control agent capable of preventing and controlling the continuous cropping obstacle of Chuju, and promoting the rural economic and social development in the authentic producing area of Chuju.

[0005] To achieve the above object, the present invention is realized through the following technical solutions:

[0006] A Bacillus subtilis L48 strain, the strain is preserved in the Guangdong Microbial Culture Collection Center, and the preservation number is: GDMCC NO.65332.

[0007] The Bacillus subtilis L48 strain can effectively prevent and control the diseases of Chuju, promote the growth of Chuju, and alleviate the continuous cropping obstacle of Chuju.

[0008] Preferably, the diseases of Chuju are any one or more of root rot caused by Fusarium solani and wilt disease caused by Fusarium oxysporum.

[0009] Preferably, the method for the application of the strain in preventing and controlling the diseases of Chuju, promoting the growth of Chuju, and alleviating the continuous cropping obstacle of Chuju is to prepare the strain into a bacterial liquid and then perform the root-injuring perfusion method on Chuju.

[0010] Preferably, the concentration of bacteria in the bacterial liquid is 10 8 -10 9 CFU / mL.

[0011] Moreover, the bacterial liquid of the above-mentioned Bacillus subtilis L48 can be used to prepare a biocontrol agent.

[0012] The present invention provides a strain of Bacillus subtilis L48 and its application. Compared with the prior art, the advantages are as follows:

[0013] The newly preserved strain of Bacillus subtilis L48 of the present invention can produce protease, amylase, cellulase and siderophore, and can decompose potassium and fix nitrogen. It can effectively inhibit the growth of the root rot pathogen Fusarium solani and the wilt pathogen Fusarium oxysporum. Bacterial genome sequencing determines the whole genome and secondary metabolites of the strain. The results show that strain L48 promotes carbohydrate metabolism, amino acid metabolism, metabolism of cofactors and vitamins, membrane transport, signal transduction, energy metabolism, and nucleotide metabolism. Pot experiment shows that the strain can control the root rot and wilt of Chrysanthemum morifolium Ramat., and can promote the growth of chrysanthemum. The present invention provides an excellent biocontrol strain for preventing and controlling the continuous cropping obstacle of Chrysanthemum morifolium Ramat. and promoting the growth of Chrysanthemum morifolium Ramat., and has important significance for the green prevention and control technology of Chrysanthemum morifolium Ramat. diseases and the sustainable development of the Chrysanthemum morifolium Ramat. industry. Description of the Drawings

[0014] Figure 1 It is a photograph of the colony morphology of Bacillus subtilis L48 strain on the plate in Example 1 of the present invention;

[0015] Figure 2 It is a microscopic photograph of Gram staining of Bacillus subtilis L48 strain in Example 1 of the present invention;

[0016] Figure 3 It is a phylogenetic tree of Bacillus subtilis L48 strain in Example 1 of the present invention;

[0017] Figure 4 It is the result of the growth inhibition of the pathogen by Bacillus subtilis L48 strain in Example 2 of the present invention;

[0018] Figure 5 It is the colony characteristics of Bacillus subtilis L48 on the detection plates of protease, amylase, cellulase, siderophore, potassium decomposition, nitrogen fixation and phosphorus decomposition in Example 3 of the present invention;

[0019] Figure 6 It is the whole genome of Bacillus subtilis L48 in Example 4 of the present invention;

[0020] Figure 7KEGG of Bacillus subtilis L48 in Example 4 of the present invention.

[0021] Figure 8 Schematic diagram of the pot experiment of Bacillus subtilis L48 in Example 5 of the present invention, where. A is the schematic diagram of the growth of Chrysanthemum morifolium Ramat. in groups T1-T5 after 28 days of treatment; B is the column chart of the main stem height of Chrysanthemum morifolium Ramat. in groups T1-T5 before and after treatment; C is the column chart of the lateral branch length of Chrysanthemum morifolium Ramat. in groups T1-T5 before and after treatment; D is the column chart of the number of branches of Chrysanthemum morifolium Ramat. in groups T1-T5 before and after treatment. Detailed implementation manners

[0022] To make the objectives, technical solutions and advantages of the embodiments of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are some, but not all, of the embodiments of the present invention. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0023] The following Bacillus subtilis L48 strain was deposited at the Guangdong Provincial Microbial Culture Collection Center (GDMCC) on October 23, 2024, with the deposit number: GDMCC NO.65332, and the proposed taxonomic name is Bacillus subtilis.

[0024] Example 1:

[0025] Isolation and identification of Bacillus subtilis L48 strain:

[0026] I. Raw material preparation

[0027] 1. Soil preparation

[0028] Soil samples were collected from Chuzhou City, Anhui Province (N 32°23′60″, E 118°30′64″). Soil samples were taken from the deep soil of Chrysanthemum morifolium Ramat. and the deep soil of non-planted Chrysanthemum morifolium Ramat. respectively, and randomly collected by the five-point sampling method. After mixing the soil samples evenly, they were placed in an ice bucket and taken back to the laboratory for storage at 4°C in a refrigerator for later use.

[0029] 2. Culture medium formula

[0030] LB agar: Peptone (10 g / L), Yeast extract powder (5 g / L), Sodium chloride (10 g / L), Agar (15 g / L), PH: 7.0 ± 0.1, 25°C, autoclaved at 121°C for 15 min.

[0031] LB broth: Peptone (10 g / L), yeast extract powder (5 g / L), sodium chloride (10 g / L), pH: 7.0 ± 0.1, 25 °C, autoclaved at 121 °C for 15 min.

[0032] II. Isolation and purification of Bacillus subtilis L48

[0033] 1. Strain isolation: Weigh 10.0 g of the soil from the control group and place it in a triangular flask containing 90 mL of sterile water and sterilized glass beads. Place it in a constant temperature shaker and shake it at 28 °C and 150 r / min for 30 min. After thoroughly shaking the soil, use a pipette to separately aspirate 1 mL of the liquid and add it to a test tube containing 9 mL of sterile water. Mix well to obtain a 10-fold soil dilution. Using the same method, successively prepare 10-fold, 100-fold, 1000-fold, 10000-fold, and 100000-fold soil dilutions. Take 100 - 200 μL of each prepared soil dilution with different concentration gradients and evenly spread them on LB solid plates. Place them in an inverted position in an incubator at 28 °C and observe the colony growth after 24 h. -2 times the soil dilution. Using the same method, successively prepare 10 -3 , 10 -4 , 10 -5 , 10 -6 times the soil dilution. Take 100 - 200 μL of each prepared soil dilution with different concentration gradients and evenly spread them on LB solid plates. Place them in an inverted position in an incubator at 28 °C and observe the colony growth after 24 h.

[0034] 2. Strain purification: Use an inoculation loop to separately pick the colonies growing on the plate and streak them on the LB solid plate.

[0035] III. Colony morphology and Gram staining

[0036] 1. Colony morphology: Use an inoculation loop to pick a colony and streak it on the LB solid plate to observe the morphology of the single colony. The results show that the L48 strain is initially opaque light yellow on the LB medium and gradually turns brownish red after maturation. The single colony morphology is round and the surface is not rough. ( Figure 1 ).

[0037] 2. Gram staining: Add a drop of sterile water or PBS on a glass slide. Use a long pipette tip to pick a small amount of bacteria and slide it back and forth on the glass slide until the liquid becomes turbid. Dry it beside an alcohol lamp. Stain with crystal violet for 1 min, rinse and dry; stain with iodine solution for 1 min, rinse and dry; decolorize with the decolorizing solution for 30 s, rinse and dry; stain with safranin staining solution for 1 min, rinse and dry. Drop cedarwood oil on the glass slide and observe under a microscope. Purple is Gram-positive bacteria and red is Gram-negative bacteria. The results show that the L48 strain is Gram-positive bacteria ( Figure 2 ).

[0038] IV. Strain identification

[0039] The purified L48 above was identified by 16S rDNA amplification and sequence analysis. The specific method was as follows: The Ezup column bacterial genomic DNA extraction kit was used to extract the genomic DNA of the purified strain, and the following universal primers were used to amplify the 16S rDNA of the strain: 27F (AGAGTTTGATCCTGGCTCAG) and 1492R: (TACGGCTACCTTGTACGACTT). The amplification system and conditions are shown in Tables 1 and 2 below. The amplification products were sent to General Biosystems (Anhui) Co., Ltd. for sequencing.

[0040] Table 1 16S rDNA amplification system

[0041] Reaction components Volume (μL) 2× TaqMasterMix 12.5 μL F + R primers 1 μL + 1 μL Template 2 μL - 3 μL ddH2O Up to 25 μL

[0042] Table 2 16S rDNA amplification conditions

[0043]

[0044] The PCR products amplified by the above method were subjected to BLAST alignment on the NCBI website with their sequencing results, and the MEGA11 software was used to construct a phylogenetic tree by the neighbor-joining method. The results showed that the sequence similarity between L48 and Bacillus subtilis was 100% ( Figure 3 ), and it was named Bacillus subtilis L48 strain.

[0045] Example 2:

[0046] The antibacterial ability of the isolated Bacillus subtilis L48 strain was determined as follows:

[0047] Fusarium solani and Fusarium oxysporum, the pathogenic bacteria of fusarium wilt, were used as the pathogenic bacteria for the antibacterial test.

[0048] In the aseptic operation table, in front of the alcohol lamp, 100 - 200 μL of the Bacillus subtilis L48 bacterial suspension (10 8 CFU / mL) was taken with a pipette gun and added to the LB solid plate, spread evenly with a spreader, and agar blocks with a diameter of 6 mm were prepared with a punch. The agar blocks with the bacterial suspension were inoculated around the pathogenic bacteria center at a distance of 2 - 3 cm. A punch (diameter 6 mm) was used to punch holes in the activated pathogenic bacteria plate, and the bacterial blocks were inoculated in the center of the PDA plate. Each strain was repeated 3 times, and a plate without inoculated bacteria was set as a control, and it was inverted and cultured in an incubator at 28 °C. When the colony radius of the control plate exceeded 3 cm, it was measured and recorded.

[0049] Inhibitory rate (%) = (radius of control colony - radius of treated colony) / radius of control colony × 100%.

[0050] Finally, the inhibitory rate of Bacillus subtilis strain L48 against Fusarium solani was 77 ± 0.50%, and the inhibitory rate against Fusarium oxysporum was 77 ± 0.53%; for the specific inhibitory effect, see Figure 4

[0051] Example 3:

[0052] Identification of the growth-promoting effect of the isolated Bacillus subtilis strain L48:

[0053] 1. Detection of protease ability

[0054] Inoculate Bacillus subtilis strain L48 in skim milk agar medium and observe whether a clear zone appears after culturing in a constant temperature incubator at 28°C for 24 h. The results are as Figure 5 shown, indicating that Bacillus subtilis strain L48 has the ability to produce protease.

[0055] 2. Detection of amylase ability

[0056] Inoculate Bacillus subtilis strain L48 in LB solid medium and, after culturing in a constant temperature incubator at 28°C for 24 h, stain with iodine solution and observe whether a yellow halo appears. The results are as Figure 5 shown, indicating that Bacillus subtilis strain L48 has the ability to produce amylase.

[0057] 3. Detection of cellulase ability

[0058] Inoculate Bacillus subtilis strain L48 in LB solid medium and, after culturing in a constant temperature incubator at 28°C for 24 h, stain with 1 mg / mL congo red. After 20 min, pour off the congo red and add 1 mol / L NaCl solution. After 15 min, pour off the NaCl solution. Observe whether a clear zone appears. The results are as Figure 5 shown, indicating that Bacillus subtilis strain L48 has the ability to produce cellulase.

[0059] 4. Detection of siderophore ability

[0060] Inoculate Bacillus subtilis strain L48 in siderophore detection solid medium and observe whether a clear zone appears after culturing in a constant temperature incubator at 28°C for 24 h. The results are as Figure 5 shown, indicating that Bacillus subtilis strain L48 has the ability to produce iron.

[0061] 5. Detection of nitrogen fixation ability

[0062] Inoculate Bacillus subtilis strain L48 in nitrogen fixation solid medium and observe whether the strain grows on the nitrogen fixation medium after culturing in a constant temperature incubator at 28°C for 24 h. The results are asFigure 5 As shown, Bacillus subtilis strain L48 has nitrogen-fixing ability.

[0063] 6. Detection of potassium-solubilizing ability

[0064] Inoculate Bacillus subtilis strain L48 into the potassium-solubilizing solid medium and culture it in a constant temperature incubator at 28 °C for 24 h, then observe whether the strain grows on the potassium-solubilizing medium. The results are as Figure 5 shown, Bacillus subtilis strain L48 has potassium-solubilizing ability.

[0065] 7. Detection of phosphorus-solubilizing ability

[0066] Inoculate Bacillus subtilis strain L48 into the phosphorus-solubilizing solid medium and culture it in a constant temperature incubator at 28 °C for 24 h, then observe whether there is a transparent circle formed. The results are as Figure 5 shown, Bacillus subtilis strain L48 does not have phosphorus-solubilizing ability.

[0067] Example 4:

[0068] Perform genome sequencing on the above-mentioned Bacillus subtilis strain L48:

[0069] Inoculate Bacillus subtilis strain L48 into 250 mL of LB broth, place it in a constant temperature shaker, and shake it at 28 °C and 150 r / min until it grows to the logarithmic phase (OD = 0.6 - 0.8), then centrifuge and take the precipitate to Shanghai Majorbio Bio-pharm Technology Co., Ltd. Extract DNA and use the Hiseq X Ten sequencing platform (MajorBio Co., Shanghai, China) to perform draft genome sequence analysis on Bacillus subtilis strain L48. Use NEXTflex TM Fast DNA-Seq kit to prepare an Illumina sequencing library from the sheared fragments. Then sequence the prepared library on the Illumina HiSeq X T0n sequencing platform for Illumina paired-end sequencing (2 × 150 bp). The raw reads obtained after sequencing are filtered using the fastp software, and then assembled using the de novo version 2.04 of SOPA. CDS prediction is performed using Glimmer, tRNA prediction is performed using tRNA-scan-SE, and rRNA prediction is performed using Barrnap. Sequence type analysis of the isolate is performed using the PubMLST technology. Virulence factor prediction is performed by the virulence factor database.

[0070] Genome sequencing analysis shows that the whole genome of Bacillus subtilis L48 consists of a linear chromosome of 4,338,112 bp, with a GC content of 43.03%. A total of 4457 protein-coding genes, 11 rRNAs, and 96 tRNAs are predicted ( Figure 6)。In the KEGG annotation, a total of 3,085 genes of Bacillus subtilis L48 were annotated to 43 pathways of six major functions, among which carbohydrate metabolism, amino acid metabolism, metabolism of cofactors and vitamins, membrane transport, signal transduction, energy metabolism, and nucleotide metabolism accounted for the largest proportion ( Figure 7 ), that is, Bacillus subtilis L48 strain promotes carbohydrate metabolism, amino acid metabolism, metabolism of cofactors and vitamins, membrane transport, signal transduction, energy metabolism, and nucleotide metabolism.

[0071] Example 5:

[0072] Pot experiment:

[0073] Chuju with consistent growth was selected and transplanted into flower pots filled with 600 g of sterile soil for growth. It was randomly divided into a normal group (T1), a Fusarium solani group (T2), a Fusarium oxysporum group (T3), a biocontrol agent L48 + Fusarium solani group (T4), and a biocontrol agent L48 + Fusarium oxysporum group (T5) (triplicates for each group). The root injury perfusion method was adopted (gently wash the soil with clear water, cut off 1 / 3 of the roots with scissors, and then implant them into sterile soil for cultivation);

[0074] Among them, 50 mL of clear water was poured into the roots of Chuju in T1, and 100 mL of clear water was poured into it 24 hours later, and clear water was added every five days;

[0075] T2 was to pour 50 mL of Fusarium solani spore suspension (1×10 6 CFU / mL) into the roots of Chuju, and 100 mL of clear water was poured into it 24 hours later, and clear water was added every five days;

[0076] T3 was to pour 50 mL of Fusarium oxysporum spore suspension (1×10 6 CFU / mL) into the roots of Chuju, and 100 mL of clear water was poured into it 24 hours later, and clear water was added every five days;

[0077] T4 was to pour 50 mL of Fusarium solani spore suspension (1×10 6 CFU / mL) into the roots of Chuju, and 100 mL of Bacillus subtilis L48 suspension (1×10 9 CFU / mL) was poured into it 24 hours later, and Bacillus subtilis L48 suspension was added every five days;

[0078] T5 was to pour 50 mL of Fusarium oxysporum spore suspension (1×10 6 CFU / mL) into the roots of Chuju, and 100 mL of Bacillus subtilis L48 suspension (1×10 9 CFU / mL) was poured into it 24 hours later, and Bacillus subtilis L48 suspension was added every five days;

[0079] After 28 days of treatment, the disease incidence of plants in each treatment group was observed and recorded, and the main stem height, lateral branch length, and number of branches were statistically analyzed. The effects of each treatment group were calculated by the disease index method. Culture conditions: The day and night temperature in the culture room was (28±2)°C / (23±2)°C, the light was 16 h / d, the relative air humidity was 60%-70%, and the plant height was recorded weekly during the culture.

[0080] As Figure 8 shown, compared with the T2 and T3 groups, the T4 and T5 groups can effectively inhibit the disease incidence of Chrysanthemum morifolium Ramat. cv. Qiju, and have good control effects. And it can promote the growth of the main stem and lateral branches of Chrysanthemum morifolium Ramat. cv. Qiju and increase the number of branches.

[0081] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that: they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. A Bacillus subtilis L48 strain, characterized in that: The strain is deposited in Guangdong Microbiological Culture Collection Center, and the deposit number is: GDMCC NO.65332.

2. An application of the Bacillus subtilis L48 strain as claimed in claim 1 in preventing and controlling Chuju diseases, promoting the growth of Chuju and alleviating the continuous cropping obstacles of Chuju.

3. The use according to claim 2, characterized in that: The Chuju disease is any one or more of root rot caused by Fusarium solani and wilt caused by Fusarium oxysporum.

4. The use according to claim 2, characterized in that: The method for applying the strain to preventing and controlling Chuchrysanthemum diseases, promoting the growth of Chuchrysanthemum and alleviating the continuous cropping obstacle of Chuchrysanthemum is that the strain is prepared into bacterial liquid and then the Chuchrysanthemum is treated with the root injury perfusion method.

5. The use according to claim 4, characterized in that: The concentration of bacteria in the bacterial solution is 10 8 -10 9 CFU / mL.

6. A biocontrol agent, characterized in that: The biocontrol agent contains a bacterial solution of Bacillus subtilis L48.

Citation Information

Patent Citations

  • Bacillus subtilis CYY-25 and application thereof

    CN105296381A

  • Bacillus subtillis YX72 and application thereof in prevention and treatment of tobacco fusarium root rot and growth promotion

    CN114774279A

  • Bacillus cereus YX53 and application thereof in prevention and treatment of tobacco fusarium root rot and growth promotion

    CN114806960A

  • Bacillus subtilis WZ10 and application

    CN115044494A

  • Bacillus subtilis, biocontrol inoculant and application of bacillus subtilis and biocontrol inoculant

    CN116640679A