Sephatase dsGlu756 from deep sea and application thereof

Abstract

The invention belongs to the technical field of enzyme engineering and metagenomics, and relates to dextranase dsGlu756 from deep sea and application of the dextranase dsGlu756. The amino acid sequence of the enzyme is shown as SEQ ID NO.1 in a sequence table. The dextranase dsGlu756 from the deep sea, provided by the invention, can be used for effectively catalyzing a beta-glucan substrate in an environment of 30-80 DEG C so as to generate reducing sugar. The wide temperature adaptability enables the catalyst to be better suitable for extreme industrial application scenes, optimization of an existing industrial process can be promoted, possibility is provided for development of a new bioconversion technology, and therefore the catalyst has important significance in the fields of food processing and biomass catalysis.

Description

Technical Field

[0001] The present invention belongs to the technical fields of enzyme engineering and metagenomics, and relates to a dextranase dsGlu756 derived from the deep sea and its uses. Background Art

[0002] In the field of biomass conversion, β-1,3-glucanase, as an important biocatalyst, plays a crucial role. This enzyme can efficiently decompose the glucan in the cell wall, providing a basis for subsequent bioconversion processes. Dextranases are mainly divided into endoenzymes and exoenzymes, which are responsible for cleaving the inside and ends of dextran respectively, thereby decomposing it into smaller sugar molecules. Among them, the endoenzyme hydrolyzes β-1,3-glucan from the inside of the sugar chain, exerting the main hydrolytic activity, and the exoenzyme hydrolyzes the β-1,3-glucan substrate one by one from the non-reducing end of the sugar chain, playing a certain auxiliary role.

[0003] The potential of dextranase in industrial applications is gradually being explored, providing raw materials for the production of biofuels and other industrial processes. In the paper industry, dextranase can convert xylan in paper industry, fertilizers and agricultural waste into xylose monomers, and then into fuels. In the textile industry, dextranase can be used for degumming treatment of fibers to improve the softness and spinnability of fibers. The application of dextranase in the food industry and feed industry is also relatively extensive. In the food industry, due to the presence of dextran, the extraction rate of the sugar industry is reduced, and losses are caused by the increase in the residual sucrose content in molasses. Using dextranase to treat the dextran in the decoction can effectively reduce sugar losses; in addition, in the beer brewing process, dextranase can be used to reduce the viscosity of wort, improve the filtration performance, increase the malt dissolution rate, prevent beer turbidity, and stabilize the beer quality. In the feed industry, dextranase in feed can be used to reduce the content of non-starch polysaccharides and their anti-nutritional factors, improve the absorption of nutrients by livestock and poultry, and increase the growth rate and feed conversion efficiency of livestock and poultry.

[0004] With the continuous development of biotechnology, significant progress has been made in the research and improvement of dextranase. Through genetic engineering and protein engineering means, scientists have developed a variety of highly efficient and stable dextranases, which not only have significantly improved activity and stability, but also perform well in heat resistance and stress resistance. There is currently a blank in dextranases that can exhibit high activity under extreme temperature conditions such as low temperature and high temperature. Summary of the Invention

[0005] The object of the present invention is to fill the blank in the existing technology and provide a dextranase dsGlu756 mined and identified from the deep-sea hydrothermal vent metagenome, which can effectively catalyze β-glucan substrate to generate reducing sugars in an environment of 30 - 80 °C.

[0006] To achieve the above object, the technical solution adopted by the present invention is: a dextranase dsGlu756 derived from the deep sea, and its amino acid sequence is shown in SEQ ID NO.1 in the sequence listing.

[0007] Preferably, the nucleotide sequence of the gene encoding the dextranase dsGlu756 is shown in SEQ ID NO.2 in the sequence listing.

[0008] Preferably, the present invention also provides an expression vector containing the gene, and the expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

[0009] Preferably, the present invention also provides a host cell containing the expression vector, and the host cell is a bacterium.

[0010] Preferably, the present invention also provides an engineered strain, and the engineered strain contains the gene or the expression vector.

[0011] The present invention also provides the use of the dextranase dsGlu756 in catalyzing β-glucan substrate to generate reducing sugar in an environment of 30-80°C.

[0012] The present invention further provides the use of the expression vector, the gene, the host cell, and the engineered strain in the preparation of dextranase sGlu756.

[0013] The dextranase dsGlu756 derived from the deep sea provided by the present invention can effectively catalyze β-glucan substrate to generate reducing sugar in an environment of 30-80°C. Its broad temperature adaptability enables it to be better applicable to relatively extreme industrial application scenarios, which can not only promote the optimization of existing industrial processes, but also provide possibilities for the development of new biotransformation technologies. Therefore, the present invention has important significance in the fields of food processing and biomass catalysis. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 It is the plasmid map of pET22b expressing dsGlu756 in the embodiment of the present invention; Figure 2 It is the SDS-PAGE analysis result of purified dsGlu756; wherein, M is the protein marker; 1 is the purified dsGlu756; Figure 3 It is a schematic diagram of determining the activity of dextranase by DNS method; Figure 4 It is the standard curve of glucose solution; Figure 5 It is the enzyme activity of dsGlu756 at different temperatures; Figure 6Activity comparison of dsGlu756 catalyzing different substrates. Detailed implementation mode

[0015] To facilitate the understanding of this research, the following will provide a more detailed description of this research in combination with the attached drawings and specific embodiments. However, this research can be implemented in many different forms and is not limited to the embodiments described in this specification. On the contrary, the purpose of providing these embodiments is to make the understanding of the disclosed content of this research more thorough and comprehensive.

[0016] This invention screens from deep-sea metagenomes and obtains a glucanase named dsGlu756, which can specifically hydrolyze β-1,3-glycosidic bonds. The amino acid sequence of this enzyme is shown in Sequence Listing SEQ ID NO.1, and the nucleotide sequence of its encoding gene is shown in Sequence Listing SEQ ID NO.2.

[0017] The following conducts tests and verifications on the functional characteristics and catalytic activities of this enzyme through experiments.

[0018] I. Preparation of the substrate of dsGlu756 Laminarin (L9634, Merck, Darmstadt, Germany) is used to verify the function of dsGlu756, and an acidic buffer solution with a pH of 4.8 is used to dissolve the laminarin substrate. Weigh 0.2 g of the laminarin substrate into a beaker, add 20 mL of the acidic buffer solution, place it in an 80°C water bath with magnetic stirring until the laminarin is completely dissolved, then stop heating and continue stirring until it cools down. Dilute it to 2.5 mL with the acidic buffer solution to make its final concentration 8 mg / mL.

[0019] Preparation of the acidic buffer solution: Weigh 176.52 g of disodium hydrogen phosphate dodecahydrate and 53.26 g of citric acid monohydrate into a beaker, add about 800 mL of distilled water and dissolve it fully, then transfer it to a 5 L volumetric flask. Adjust the pH to 4.8 ± 0.05 with sodium hydroxide solution (200 g / L) or citric acid solution (0.1 mol / L), and finally make up the volume with distilled water and shake well.

[0020] II. Analysis of the dsGlu756 gene and protein sequence To determine the novelty of the dsGlu756 amino acid sequence, the present invention searched for its homologous proteins in GenBank through online BLAST (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) and arranged them according to sequence similarity. As shown in Table 1, among the top 10 proteins with the highest sequence identity, the first sequence is dsGlu756 of the present invention, and this sequence is derived from the MAG database. However, this MAG sequence is only the result of metagenomic data assembly and has not been experimentally verified, and its function, enzymatic properties, and industrial application potential have not been publicly disclosed. The present invention conducted cloning, expression, and functional verification for the first time, and detailed determination of its enzymatic characteristics, proving that the enzyme has significant catalytic activity and stability under specific conditions, providing an experimental basis for its potential value in the fields of biocatalysis, industrial applications, etc., and revealing its biological function and application value for the first time, with important novelty.

[0021] Table 1. Protein sequences with high identity to dsGlu756 in GeneBank GeneBank accession number Amino acids length Identity (%) RKY82756.1 296 100.00 (MAG) MCD6116671.1 287 87.15 MCD6440788.1 250 70.56 MFO7889050.1 289 70.03 HCL00157.1 250 69.14 MBC8491511.1 250 68.55 MDZ7265024.1 285 67.04 MDZ7334553.1 285 66.06 MDZ7333026.1 285 66.06 MFW6313626.1 315 65.42 。

[0022] 1. Cloning of the dsGlu756 gene The full gene was synthesized through the dsGlu756 amino acid sequence, and codon optimization was performed for Escherichia coli expression. The synthesized sequence is shown in SEQ ID NO.1 in the sequence listing. The dsGlu756 gene fragment was amplified using Glu-F and Glu-R as primers. Using pET22b as a template, 22b-F and 22b-R as primers were used to linearly amplify pET22b. The primer sequences are shown in Table 2. The PCR amplification conditions were: 98°C for 30 seconds; 98°C for 10 seconds, 56°C for 5 seconds, 72°C for 10 seconds, for 35 cycles; 72°C for 1 minute, and then cooled to 4°C for storage.

[0023] Table 2. Primers for cloning dsGlu756 into pET22b and their sequences Primer Primer sequence (5’ - 3’) Serial number Glu-F ctgcccagccggcgatggccTGTAGCAAAAAGATATCAAATAGTGAAAG SEQ ID NO.3 Glu-R cagtggtggtggtggtggtgGTCCACGCGCTTCTGGAAG SEQ ID NO.4 22b-F CACCACCACCACCACCACTG SEQ ID NO.5 22b-R GGCCATCGCCGGCTGGGC SEQ ID NO.6 。

[0024] 2. Construction of engineering strains The obtained dsGlu756 fragment was ligated with the linearized pET22b vector fragment using a seamless cloning kit (ClonExpress II One Step Cloning Kit, Novoprotein, Nanjing) to form the expression vector pET22b-dsGlu756, and the map is as Figure 1 shown, and transformed into the Escherichia coli expression strain Escherichia coli BL21(DE3) pLysS to obtain the expression strainE. coli dsGlu756. Strain E. coli dsGlu756 expresses a fusion protein with a pelB signal peptide at the N-terminus and a His tag at the C-terminus. dsGlu756 can be obtained by Ni-NTA affinity chromatography for activity detection.

[0025] 3. Expression and purification of dsGlu756 Pick E. coli Single colonies of dsGlu756 are inoculated into the medium (containing 50 μg / mL ampicillin and 20 μg / ml chloramphenicol double resistance) for seed culture. Incubate in a shaker at 37°C and 220 rpm for 8 - 12 h; the scale of the enlarged culture is 1:500 - 1:100, and incubate in a shaker at 37°C and 220 rpm for about 4 - 6 hours. When OD 600 reaches 0.8 - 1.2, add IPTG to start induction, and the final concentration of IPTG can be 0.2 - 1 mM. The induction conditions are 18 - 30°C for 18 - 24 h. Centrifuge the induced bacterial solution at 4°C and 3000 - 6000 g for 10 minutes to collect the bacteria.

[0026] The collected bacteria are resuspended in 50 mL of pre-cooled lysis buffer, and the bacteria are lysed using an ultrasonic disruptor in an ice bath. The disruption program is a power of 290 W, ultrasonic disruption for 4 s, stop for 8 s, and the total ultrasonic duration is 15 min. Centrifuge at 4°C, 13000 g for 60 min to take the supernatant. Incubate the supernatant with 3 mL of Ni-NTA resin at 4°C for 1 hour to allow the target protein to fully bind to the resin. Wash successively with 15 mL of lysis buffer and 15 mL of wash buffer, and elute and collect the target protein with 5 mL of elution buffer. Concentrate the eluate to 2.5 mL using an Ultracel-30K ultrafiltration tube. Equilibrate the desalting column PD-10 with 25 mL of desalting buffer, add 2.5 mL of the concentrated protein solution to the desalting column PD-10, add 3.5 mL of desalting buffer to collect the protein, and the collected effluent is dsGlu756. Concentrate dsGlu756 to 1 mL using an Ultracel-30K ultrafiltration tube, measure the absorbance at 280 nm using a micro-spectrophotometer to determine the concentration of the purified protein, and take 5 μL of the protein for SDS-PAGE detection. The detection results are as Figure 2 shown. The remaining protein is snap-frozen with liquid nitrogen and stored at -80°C.

[0027] Formulations of each buffer for the above protein purification: Lysis buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 0.6808 g imidazole, pH 8.0.

[0028] Wash buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 1.3616 g imidazole, pH 8.0.

[0029] Elution buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, 17.02 g imidazole, pH 8.0.

[0030] Desalting buffer (1 L): 7.8 g NaH 2 PO 4 ·3H 2 O, 17.532 g NaCl, 100 g glycerol, pH 8.0.

[0031] III. Plotting the substrate standard curve For the determination of glucanase activity, laminarin is used as the substrate. The process is as Figure 3 follows: After the substrate is hydrolyzed, glucose monomers are produced. This reducing sugar can reduce the nitro group of DNS to an amino group in an alkaline and heated environment, producing a brownish-red substance that exhibits a characteristic absorption peak at 485 nm. After separately pipetting 1 mL of acidic buffer solution and glucose series standard working solutions into graduated test tubes, 1 mL of water and 2.5 mL of DNS reagent are added, mixed well, and then placed in a boiling water bath for 5 min. Then, it is cooled to room temperature with running water and made up to 12.5 mL with water. Using the blank as a control, the absorbance is measured at a wavelength of 540 nm. Using the glucose mass (mg) as the ordinate and the absorbance as the abscissa, a standard curve is plotted. The results are as Figure 4 shown.

[0032] Preparation of glucose series standard working solutions: Weigh 1 g of anhydrous glucose dried to a constant weight at 105 °C into a 100 mL volumetric flask, dissolve it with distilled water and make up to the mark. Respectively pipette 1 mL, 2 mL, 3 mL, 4 mL, 5 mL, 6 mL and 7 mL of the prepared glucose solution into 100 mL volumetric flasks, and make up to the mark with acidic buffer solution so that the mass of glucose in each milliliter is 0.1 - 0.7 mg.

[0033] IV. Determination of the enzyme activity of dsGlu756 at different temperatures One of the most representative proteins of β-glucanase is Blg32, which was isolated from Bacillus lehensis , and showed relatively high activity towards β-glucan substrates. Pipette 0.5 - 1 mL of the glucanase sample into a 100 mL volumetric flask, add 80 mL of acidic buffer solution, stir well for 30 min, then make up to 100 mL with acidic buffer solution and mix evenly. Then continue to dilute it twice with acidic buffer solution to control the glucanase activity at 0.04 - 0.08 U / mL. Using laminarin as the reaction substrate, first pipette 10 mL of the dissolved substrate, equilibrate it in a 50 °C water bath for 5 min, and at the same time pipette 10 mL of the glucanase sample solution, equilibrate it in a 50 °C water bath for 5 min.

[0034] The present invention uses the DNS method to determine the enzyme activity, and the specific method is as follows: Under the conditions of pH 4.8, 30 °C, 50 °C and 80 °C, a 12.5 ml reaction system includes 1 mL of appropriately diluted enzyme solution and 1 mL of glucanase substrate. After reacting for 30 min, add 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, and after cooling to room temperature, measure the absorbance value of the sample at a wavelength of 540 nm. The blank control group, under the conditions of pH 4.8, 30 °C, 50 °C and 80 °C, first adds 1 mL of appropriately diluted enzyme solution and reacts for 30 min, then supplements 1 mL of glucanase substrate, and then immediately adds 2.5 mL of DNS reagent to terminate the reaction, heat it in a boiling water bath for 5 min, and after cooling to room temperature, measure the absorbance value of the sample at a wavelength of 540 nm. One enzyme activity unit (U) is defined as the amount of enzyme that releases 1 μmol of reducing sugar from a β-glucan solution with a mass concentration of 4 mg / mL in 1 minute under certain temperature and pH conditions.

[0035] The glucanase enzyme activity is calculated according to Equation 1: Equation 1; In the formula, is the β-glucanase activity of the sample, U / mL; is the mass of glucose calculated from the absorbance on the standard curve, mg; 1000 is the conversion coefficient between millimoles and micromoles, 1 mmol = 1000 μmol; is the sample dilution factor; is the sample volume, mL; 180.2 is the molar mass of glucose, mg / mmol; is the enzymatic hydrolysis reaction time, min.

[0036] The reaction results are as Figure 5 shown. The activities of Blg32 and dsGlu756 at 30 °C reached 474.27 and 330.75 U / mg respectively, at 50 °C were 2275.72 and 1369.39 U / mg, and at 80 °C were 1026.99 and 609.41 U / mg.

[0037] V. Activity comparison of dsGlu756 catalyzing different substrates In this example, laminarin, yeast β-glucan, and barley β-glucan were used as reaction substrates respectively to compare the activities of dsGlu756 and Blg32. 1 mL of dsGlu756 and 1 mL of glucanase substrate were incubated at pH 4.8 and 30 °C for 30 min, and 1 mL of Blg32 and 1 mL of glucanase substrate were incubated at pH 4.8 and 50 °C for 30 min. Then, 2.5 mL of DNS reagent was added to terminate the reaction respectively. After heating in a boiling water bath for 5 min and cooling to room temperature, the absorbance values of the samples were measured at a wavelength of 540 nm.

[0038] The reaction results are as Figure 6 shown. Both dsGlu756 and Blg32 showed high activities towards the laminarin substrate, and also showed certain catalytic activities towards yeast and barley β-glucan, demonstrating their great application potential in the food processing and biomass conversion industries.

Claims

1. A deep-sea glucanase dsGlu756, characterized in that: The amino acid sequence is shown in the sequence listing SEQ ID NO.

1.

2. The gene encoding the glucanase dsGlu756 according to claim 1, characterized in that The nucleotide sequence is shown in the sequence listing SEQ ID NO.

2.

3. An expression vector comprising the gene according to claim 2, characterized in that: The expression vector is a eukaryotic vector, a prokaryotic vector, a plasmid vector or a viral vector.

4. A host cell comprising the expression vector according to claim 3, characterized in that: The host cell is a bacterium.

5. An engineered strain, characterized in that: The engineered strain comprises the gene according to claim 2 or the expression vector according to claim 3.

6. The use of the glucanase dsGlu756 according to claim 1, characterized in that: The glucanase dsGlu756 catalyzes β-glucan substrate to generate reducing sugars under the environment of 30-80°C.

7. Use of the gene according to claim 2, the expression vector according to claim 3, the host cell according to claim 4 or the engineered strain according to claim 5 in preparing the glucanase dsGlu756 according to claim 1.

Images