Antisense oligonucleotide and application thereof in preparation of antitumor drugs

By designing an antisense oligonucleotide that can act on the splicing site of BCS1L, the problem of lack of effective drugs for alternative splicing in the prior art is solved, and effective inhibition and apoptosis induction of tumor cells are achieved.

CN120118906AActive Publication Date: 2025-06-10SHANDONG UNIV
View PDF 4 Cites 0 Cited by

Patent Information

Application Number
CN202510375735.0
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-27
Publication Date
2025-06-10
Estimated Expiration
2045-03-27

AI Technical Summary

Technical Problem

There is no effective drug targeting alternative splicing for BCS1L in the prior art, and it is difficult to effectively regulate alternative splicing of BCS1L to control the occurrence and development of related diseases.

Method used

An antisense oligonucleotide was designed and verified, which can act on the GU splicing site at the junction of exon 2 and intron 2 of BCS1L, thereby regulating the splicing mode of BCS1L, inducing tumor cell apoptosis, inhibiting cell proliferation and mitochondrial function.

Benefits of technology

This antisense oligonucleotide can significantly inhibit the proliferation rate of cancer cells, induce apoptosis of cancer cells, reduce mitochondrial ATP content, increase reactive oxygen species, reduce basal oxygen consumption and proton leakage levels, and inhibit the function of mitochondrial complex III, thereby realizing tumor treatment.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120118906A_ABST
    Figure CN120118906A_ABST
Patent Text Reader

Abstract

The invention belongs to the technical field of biological medicine, and relates to antisense oligonucleotide and application thereof in preparation of antitumor drugs. The present invention relates to an antisense oligonucleotide comprising 5-30 nucleotides having at least 50% sequence identity with a reverse complementary sequence of a natural antisense sequence of a BCS1L polynucleotide, the antisense oligonucleotide being capable of acting on a GU splicing site at a junction of a No.2 exon and a No.2 intron of the BCS1L polynucleotide, thereby regulating a BCS1L splicing pattern. The antisense oligonucleotide provided by the invention can induce tumor cell apoptosis and inhibit cell proliferation and mitochondrial functions, and finally can be used as a medicine for treating tumors.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of biomedicine, and relates to an antisense oligonucleotide and its application in the preparation of anti-tumor drugs. Background Art

[0002] Disclosing the information of this background art section is only intended to enhance the understanding of the overall background of the present invention, and is not necessarily regarded as an admission or an implication in any form that this information constitutes the prior art already known to those of ordinary skill in the art.

[0003] Ovarian cancer is a malignant tumor of the female reproductive system with insidious onset, difficult diagnosis, and easy drug resistance and recurrence. The 5-year survival rate of ovarian cancer is about 50%. The vast majority of patients are in the advanced stage with peritoneal metastasis when they seek medical treatment, and the mortality rate of advanced ovarian cancer patients is as high as 75%. After undergoing cytoreductive surgery and chemotherapy, most patients will still relapse and develop drug resistance to traditional chemotherapy drugs. Therefore, effective early diagnosis criteria and treatment targets have become a key link in improving the prognosis of ovarian cancer.

[0004] Splicing in eukaryotes is a complex and dynamic physiological process. The spliceosome complex composed of five small ribonucleoprotein complexes (snRNPs) removes introns in precursor mRNA and ligates exons to generate mature mRNA. More than 95% of human genes combine different protein-coding regions through alternative splicing, ultimately producing proteins with different or even opposite functions, greatly increasing the diversity and complexity of the human genome and proteome. Aberrant splicing events in the transcriptome are one of the characteristics of cancer. TCGA data shows that the number of splicing events in malignant tumors is about 30% higher than that in normal tissues. Aberrant splicing plays an important role in the occurrence and development of various cancers. According to literature reports, there are aberrant splicing events in genes such as CD44, BCL2L12, BAX, AIMP2, and OPN in ovarian cancer. And a number of studies have proved that targeting alternative splicing is a promising and potential cancer treatment option.

[0005] The BCS1L gene encodes the transmembrane chaperone BCS1L (Ubiquinol-Cytochrome C Reductase Complex Chaperone) required for the assembly of mitochondrial respiratory chain complex III. There is a transmembrane domain near the N-terminus of BCS1L, which spans the inner mitochondrial membrane, an AAA (ATPases associated with various cellular activities) domain, and a mitochondrial targeting signal. BCS1L can promote the transport of folded iron-sulfur proteins and incorporate them into the core assembly of complex III. Mutations in the BCS1L gene can lead to GRACILE syndrome or Syndromes, both of which are associated with mitochondrial complex III deficiency and affect the brain, kidney, liver, heart, and skeletal muscle. In the current study, the inventors demonstrated that BCS1L produces two major isoforms through alternative splicing, one is the full-length isoform (BCS1L-L), and the other is the truncated isoform (BCS1L-S) generated by exon 2 skipping. Different from BCS1L-L, BCS1L-S cannot be localized to mitochondria due to the loss of the mitochondrial targeting signal.

[0006] Compared with drugs with poor targeting or inhibitors acting on the whole complex or metabolic enzymes, antisense oligonucleotides can target highly expressed or specifically expressed splicing isoforms in tumors, thereby improving the specificity of anti-tumor drugs and minimizing damage to normal cells. Antisense oligonucleotides (ASO) are short chains of deoxyribonucleotide analogs about 15-20 bp in length. The modified deoxy nucleic acid can competitively bind to specific splicing sites and change the splicing pattern of target genes by inhibiting RNA-RNA or splicing factor-RNA interactions. Currently, six antisense oligonucleotide drugs have obtained market authorization. As of 2022, at least ten antisense oligonucleotides have been approved by the US Food and Drug Administration (FDA). Spinraza (nusinersen) is the first FDA-approved drug for the treatment of spinal muscular atrophy (SMA). This antisense oligonucleotide can change the splicing of exon 7 of SMN2 and increase the expression of functional SMN protein. Exondys 51 (eteplirsen) has become the first FDA-accelerated approved drug for Duchenne muscular dystrophy (DMD).

[0007] Currently, there is no effective drug targeting the alternative splicing of BCS1L. There is still a need in the art to study and develop methods and drugs for controlling the occurrence and development of related diseases by regulating the alternative splicing of BCS1L. Summary of the Invention

[0008] Through research, the present invention has discovered the mitochondrial metabolism-related gene BCS1L with abnormal splicing in various malignant tumors (including ovarian cancer, etc.), and the core transcript of BCS1L differs in exon 2, whose skipping generates a long transcript (BCS1L-L) and a short transcript (BCS1L-S), and a classical GU splicing site was found at the junction of exon 2 and intron 2. Based on this, the inventors designed and verified an effective sequence capable of regulating the splicing pattern of BCS1L. This effective sequence can induce apoptosis of tumor cells, inhibit cell proliferation and mitochondrial function, and can ultimately be used as a drug for treating tumors or anti-tumor.

[0009] Based on the above research results, the present invention provides an antisense oligonucleotide and its application in the preparation of anti-tumor drugs. The technical solution provided by the present invention is as follows:

[0010] In the first aspect, an antisense oligonucleotide comprising 5 - 30 nucleotides, which has at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the BCS1L polynucleotide, and the antisense oligonucleotide can act on the GU splicing site at the junction of exon 2 and intron 2 of the BCS1L polynucleotide, thereby regulating the BCS1L splicing pattern.

[0011] In the present invention, the BCS1L polynucleotide can be the genomic DNA of BCS1L, especially the single strand (template strand) that serves as the RNA template in the genomic DNA. The oligonucleotide provided by the present invention is reverse complementary to the mRNA (including mature or immature precursor - mRNA, i.e., pre - mRNA) transcribed from the genomic DNA, can recognize and bind to the mRNA (including pre - mRNA), and thereby regulate (interfere with) the normal functions of nucleic acids, such as splicing and translation, so as to play an anti - tumor role.

[0012] BCS1L (Ubiquinol - Cytochrome C Reductase Complex Chaperone), that is, the BCS1 homolog, this gene encodes a homolog of the yeast BCS1L protein, and this protein is involved in the assembly of mitochondrial respiratory chain complex III. Mutations in this gene are associated with mitochondrial complex III deficiency and GRACILE syndrome. Due to the alternative splicing of exon 2 of BCS1L, BCS1L produces a long transcript (BCS1L - L) and a short transcript (BCS1L - S).

[0013] In the present invention, "oligonucleotide" refers to an oligomer or polymer of ribonucleic acid (RNA) or deoxyribonucleic acid (DNA) or their mimetics. "Oligonucleotide" can include natural and / or modified monomers or bonded linear or cyclic oligomers, such as deoxyribonucleosides, ribonucleosides, their substituted forms and their α - anomeric forms, peptide nucleic acids (PNAs), locked nucleic acids (LNAs), phosphorothioates, methyl phosphonates and their analogs. Oligonucleotides are capable of pairing with complementary sequences via Watson - Crick - type bases.

[0014] Antisense oligonucleotides recognize and hybridize to a "target nucleic acid". "Target nucleic acid" encompasses DNA, RNA transcribed from such DNA (including precursor mRNA and mRNA), as well as cDNA, coding sequences, non-coding sequences, sense or antisense polynucleotides derived from such RNA. Specific hybridization of the oligomeric compound to its target nucleic acid interferes with the normal function of the nucleic acid. This modulation of the function of the target nucleic acid by specifically hybridizing a compound to the target nucleic acid is generally referred to as "antisense". DNA functions to be interfered with include, for example, replication and transcription. The overall effect of this interference with the function of the target nucleic acid is to modulate the expression of the encoded product or oligonucleotide. For example, if it is an RNA oligonucleotide, it binds to another RNA target by means of RNA-RNA interactions and alters the activity of the target RNA. Antisense oligonucleotides can upregulate or downregulate the expression and / or function of a specific polynucleotide. Such molecules include, for example, antisense RNA or DNA molecules, interfering RNA (RNAi), microRNA, decoy RNA molecules, siRNA, enzymatic RNA, therapeutic editing RNA, antisense oligomeric compounds, antisense oligonucleotides, external guide sequence (EGS) oligonucleotides, alternative spliceosomes, and other oligomeric compounds that hybridize to at least a portion of the target nucleic acid. These compounds can exist in the form of single-stranded, double-stranded, partially single-stranded or circular oligomeric compounds.

[0015] The target segment can include a DNA or RNA sequence that includes at least 5 contiguous nucleotides from the 5' end of one of the preferred target segments (the remaining nucleotides being a continuous extension of the DNA or RNA that begins immediately upstream of the 5' end of the target segment and continues until the DNA or RNA contains from about 5 to about 30 nucleotides). Once one or more target regions, segments or sites are identified, those skilled in the art can select an antisense compound that is sufficiently complementary to the target, i.e., hybridizes well enough and with sufficient specificity to achieve the desired effect, according to known methods.

[0016] In the present invention, "nucleotide" encompasses naturally occurring nucleotides as well as non-naturally occurring nucleotides. "Nucleotide" includes not only molecules with the known purine and pyrimidine heterocycles, but also heterocyclic analogs and tautomers thereof. Exemplary examples of nucleotides and their analogs are molecules containing adenine, guanine, thymine, cytosine, uracil, purine, xanthine, 2,6-diaminopurine, 8-oxo-N6-methyladenine, 7-deazaxanthine, 7-deazaguanine, N4,N4-ethanocytosine, N6,N6-ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C3-C6)-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4-triazolo[1,5-a]pyrimidine, isocytosine, isoguanine, inosine.

[0017] An antisense oligonucleotide is "specifically hybridizable" when its binding to a target nucleic acid interferes with the normal function of the target nucleic acid to result in modulation of function and / or activity, and there is a sufficient degree of complementarity under conditions in which specific binding is desired (i.e., physiological conditions in the context of in vivo assays or therapeutic treatment and conditions under which assays are conducted in the context of in vitro assays) to avoid non-specific binding of the antisense compound to non-target nucleic acid sequences.

[0018] The sequence of the oligonucleotide need not be 100% complementary to the sequence of its target nucleic acid to which it is to be specifically hybridizable. Moreover, the oligonucleotide can hybridize through one or more segments such that intervening or adjacent segments are not involved in the hybridization (e.g., loop structures, mismatches, or hairpin structures). The oligonucleotides of the invention include at least 50%, or at least 60%, or at least 70%, or at least 80%, or at least 90%, or at least 95%, or at least 99% sequence complementarity with the target region in the target nucleic acid sequence to which it is targeted.

[0019] In some embodiments, the sequence of the BCS1L polynucleotide is as set forth in SEQ ID NO:1. The nucleotide sequence of SEQ ID NO:1 is the sense strand of the BCS1L genomic DNA, i.e., the sequence of the DNA single strand that is the same as the mRNA sequence transcribed therefrom.

[0020] In some embodiments, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the BCS1L polynucleotide. For example, in the polynucleotide set forth in SEQ ID NO:1, exon 2 is at positions 2197 - 2565 and intron 2 is at positions 2566 - 2663. In one embodiment of the invention, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the nucleotides at positions 2536 - 2595 of the polynucleotide having the sequence of SEQ ID NO:1.

[0021] In some embodiments, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the following BCS1L polynucleotide: a 30 - nucleotide fragment of exon 2 at the end connected to intron 2, a 30 - nucleotide fragment of intron 2 at the end connected to exon 2, or a 30 - nucleotide fragment including the junction of exon 2 and intron 2.

[0022] In some embodiments, the antisense oligonucleotide comprises (has) a reverse complementary sequence to the natural antisense sequence of the first 5 to 20 nucleotide fragments at the end connected to exon 2 of intron 2 of the BCS1L polynucleotide. Preferably, the antisense oligonucleotide comprises (has) a reverse complementary sequence to the natural antisense sequence of the first approximately 5 nucleotide fragments at the end connected to exon 2 of intron 2 of the BCS1L polynucleotide.

[0023] In some embodiments, the antisense oligonucleotide comprises (has) a reverse complementary sequence to any consecutive 5 to 20 nucleotides among nucleotides 2566 - 2585 of the BCS1L polynucleotide having the sequence of SEQ ID NO:1. In yet another embodiment of the present invention, the antisense oligonucleotide comprises (has) a reverse complementary sequence to nucleotides 2566 - 2570 of the BCS1L polynucleotide having the sequence of SEQ ID NO:1.

[0024] An intron is the part of eukaryotic DNA located between two coding regions, i.e., exons. The RNA transcribed from introns and exons is called "primary transcript, mRNA precursor (or pre-mRNA, pre-mRNA)". Introns are removed from pre-mRNA to produce the natural protein encoded by exons (here the natural protein refers to the naturally occurring, wild-type, or functional protein). During the splicing process, introns are removed from pre-mRNA and exons are joined together. The splicing reaction is a series of reactions carried out on RNA mediated by splicing factors after transcription and before translation. Therefore, pre-mRNA is RNA containing both introns and exons. mRNA is RNA from which introns are removed and exons are joined together in sequence, and can be transcribed by ribosomes into proteins.

[0025] Introns usually include one or more splicing elements. Splicing elements are relatively short, conserved RNA fragments that bind to various splicing factors for splicing reactions. Generally, an intron is determined by a 5' splice site, a 3' splice site, and the fragment between them. Usually, when the antisense oligonucleotide overlaps all or part of the splicing element, or binds to pre-mRNA very close to the element, thereby disrupting the binding and function of the splicing factor mediating the specific splicing reaction on the element, these splicing elements are "blocked".

[0026] In some embodiments, the antisense oligonucleotide comprises one or more modifications selected from: at least one modified sugar moiety, at least one modified internucleoside linkage, at least one modified nucleotide, and combinations thereof. In one embodiment of the present invention, one or more nucleotides in the antisense oligonucleotide are modified nucleotides. In one embodiment of the present invention, the one or more modifications include at least one modified internucleoside linkage selected from: phosphorothioate, 2'-O-methoxyethyl (MOE), 2'-fluoro, alkyl phosphate, dithiophosphate, alkylthiophosphonate, phosphoramidate, carbamate, carbonate, phosphotriester, aminoacetate, carboxymethyl ester, and combinations thereof. The use of modified nucleotides can enable the antisense oligonucleotides of the present invention to have higher target binding affinity and / or nuclease resistance.

[0027] In some embodiments, the antisense oligonucleotide has a nucleotide sequence as shown in SEQ ID NO:2 or SEQ ID NO:3.

[0028] In some embodiments, the antisense oligonucleotide is:

[0029] C*C*A*C*C*T*T*ACCAGA*T*A*A*A*A*T*G*G; or

[0030] C*T*C*C*C*T*A*G*C*TCCCC*A*C*C*T*T*A*C;

[0031] * represents a phosphorothioate modification.

[0032] In a second aspect, a pharmaceutical composition comprises the above antisense oligonucleotide, and a pharmaceutically acceptable diluent or carrier.

[0033] The pharmaceutical composition of the present invention can be administered in several ways, depending on whether local or systemic treatment is required and the area to be treated. Administration can be local, pulmonary (e.g., by inhalation or insufflation of powders or aerosols, including by nebulizer), intratracheal, intranasal, epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; or intracranial (e.g., intrathecal or intraventricular) administration.

[0034] The pharmaceutical composition provided by the present invention can be prepared into the required dosage form according to conventional techniques well known in the pharmaceutical industry. Such techniques include the step of combining the active ingredient with a pharmaceutical carrier or excipient. Generally, the dosage form is prepared by uniformly and intimately combining the active ingredient with a liquid carrier or a finely divided solid carrier or both, and then (if necessary) shaping the product.

[0035] In a third aspect, there is provided the use of the above-mentioned antisense oligonucleotides or pharmaceutical compositions in the preparation of anti-tumor drugs.

[0036] In some embodiments, the tumors include but are not limited to: meningioma, melanoma, acoustic neuroma, oligodendroglioma, neuroblastoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, retinoblastoma, small cell lung tumor, primary brain tumor, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchogenic carcinoma, renal cell carcinoma, hepatoma, cholangiocarcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, gastric cancer, colon cancer, malignant islet tumor, cervical cancer, endometrial cancer, adrenocortical carcinoma, breast cancer, ovarian cancer, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, Hodgkin's disease, non-Hodgkin lymphoma, multiple myeloma, neuroblastoma, breast cancer, rhabdomyosarcoma, sweat gland carcinoma, sebaceous gland carcinoma, papillary carcinoma, malignant carcinoid tumor, pre-malignant skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, urogenital tract cancer, malignant hypercalcemia, choriocarcinoma, seminoma, embryonal carcinoma, Wilms' tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial carcinoma, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, essential thrombocythemia, primary macroglobulinemia. Preferably, the BCS1L-related diseases suitable for treatment with the anti-tumor drugs of the present invention are ovarian cancer, gastric cancer, pancreatic cancer, breast cancer, lung cancer, liver cancer, kidney cancer, prostate cancer, glioma, adrenocortical carcinoma, melanoma, sarcoma, especially ovarian cancer.

[0037] In some embodiments, the administration subject of the anti-tumor drug is a mammal. The mammals described in the present invention can be any mammal, including and not limited to Rodentia (such as mice and rats), Lagomorpha (rabbits), Carnivora (felines and canines), Artiodactyla (bovids and suids), Perissodactyla (equids), or Primates and Simiiformes (humans or monkeys). The mammal is preferably a human.

[0038] In some embodiments, the anti-tumor drug has the following effects:

[0039] Inhibiting the proliferation rate of cancer cells; and / or,

[0040] Inducing apoptosis of cancer cells; and / or,

[0041] Reducing the content of mitochondrial ATP in cancer cells; and / or,

[0042] Increasing the level of reactive oxygen species (ROS) in cancer cells; and / or,

[0043] Reduce the basal oxygen consumption of cancer cells; and / or,

[0044] Reduce the proton leak level of cancer cells; and / or,

[0045] Reduce the reserve respiratory capacity of cancer cells; and / or,

[0046] Inhibit the function of mitochondrial complex III in cancer cells.

[0047] The beneficial effects of the present invention are as follows:

[0048] Experiments show that the antisense oligonucleotides provided by the present invention not only have high inhibitory activity against cancer cells, especially ovarian cancer cells, but also can inhibit the proliferation rate of cancer cells, and can also increase the proportion of early apoptosis and late apoptosis induced in cancer cells. Experiments on the effect of antisense oligonucleotides on the mitochondrial function of ovarian cancer show that the antisense oligonucleotides provided by the present invention can significantly reduce the mitochondrial ATP content in cancer cells and significantly increase the ROS level in cancer cells; at the same time, it can also reduce the basal oxygen consumption, proton leak level and reserve respiratory capacity of ovarian cancer cells, and inhibit the function of mitochondrial complex III. In summary, the antisense oligonucleotides provided by the present invention can achieve the treatment of tumors by inducing apoptosis of tumor cells, inhibiting cell proliferation and mitochondrial function, and can thus be applied to the preparation of anti-tumor drugs. Description of the Drawings

[0049] The specification drawings constituting a part of the present invention are used to provide a further understanding of the present invention. The schematic embodiments of the present invention and their descriptions are used to explain the present invention and do not constitute an improper limitation of the present invention.

[0050] Figure 1Structures, expression, and verification of the long transcript (BCS1L-L) and short transcript (BCS1L-S) of BCS1L in Example 1. Among them, A is a schematic diagram of the sequences of the long and short transcripts of BCS1L, where the yellow region represents the coding region, TMD (trans-membrane domain) is the transmembrane region, MTS (mitochondrial targeting sequence) is the mitochondrial targeting sequence, and IAS (import auxiliary sequence) is the auxiliary transmembrane region; B is the protein structure diagram of the long and short transcripts of BCS1L predicted by SWISS-MODEL; C is the protein expression of the long and short transcripts of BCS1L detected by western blotting in the normal fallopian tube cell line FTE187 and human ovarian cancer cell lines (A2780, HEY, SKOV3, OV90, HOC7, OVCAR3, OVCAR8, CAOV3); D is the analysis diagram of the expression of the main transcript of BCS1L in ovarian cancer specimens in the TCGA database and normal ovarian specimens in the GTEx database. In ovarian cancer, the proportion of BCS1L-L is high and the proportion of BCS1L-S is low; E is the analysis diagram of the expression ratio of the long and short transcripts of BCS1L in 374 ovarian cancer samples in the TCGA database and 180 normal ovarian tissues in the GTEx database; F is the verification of the expression of BCS1L in clinical samples of ovarian cancer and fallopian tube fimbria by real-time quantitative PCR; G is the verification of the expression of BCS1L by immunohistochemical scoring in 10 normal ovarian tissues and 14 fresh ovarian cancer tissues; H is the analysis of the expression of BCS1L-L and BCS1L-S in all tumor tissues in the TCGA database by bioinformatics analysis.

[0051] Figure 2Subcellular localization and functional differences between the long transcript (BCS1L-L) and short transcript (BCS1L-S) of BCS1L in Example 2. Among them, A shows the subcellular localization of the long and short transcripts of BCS1L detected by western blotting in A2780 and HeLa cell lines; B shows the protein pathway map enriched by the proteins bound to BCS1L-L or BCS1L-S detected by mass spectrometry; C shows the subcellular localization of the long and short transcripts of BCS1L detected by immunofluorescence after overexpressing the two transcripts of BCS1L-L and BCS1L-S with red fluorescent m-Cherry signal in ovarian cancer A2780 cell line, and the Pearson’s correlation coefficient is used to describe the fluorescence co-localization correlation between the long and short transcripts of BCS1L and Mito-tracker; D shows the subcellular localization of the long and short transcripts of BCS1L detected by immunofluorescence after overexpressing the two transcripts of BCS1L-L and BCS1L-S with red fluorescent m-Cherry signal in cervical cancer HeLa cell line, and the Pearson’s correlation coefficient is used to describe the fluorescence co-localization correlation between the long and short transcripts of BCS1L and Mito-tracker; E shows the effects of overexpressing BCS1L-L or BCS1L-S on mitochondrial function in ovarian cancer cells A2780 detected by Seahorse XFe24 and mitochondrial stress kit, including mitochondrial basal oxygen consumption value (Basal), ATP production (ATP), maximal oxygen consumption value (Maximal), spare respiratory capacity (SC), proton leak (Proton Leak) and non-mitochondrial oxygen consumption (Non-Mito); F shows the flow cytometry diagram of the effects of overexpressing BCS1L-L or BCS1L-S on mitochondrial membrane potential detected by JC-1 probe under the induction of 500 μM hydrogen peroxide; G shows the flow cytometry diagram of cell apoptosis detected by flow cytometry after overexpressing BCS1L-L or BCS1L-S under the induction of 500 μM hydrogen peroxide.

[0052] Figure 3Analysis diagram of the effect of antisense oligonucleotides shown in the junction site region of exon 2 and intron 2 of BCS1L variable exon 2 on exon skipping and the expression of long and short transcripts of BCS1L. Among them, A is a schematic diagram of the specific design sites of two antisense oligonucleotides; B-C are semi-quantitative PCR diagrams verifying the regulation of the alternative splicing pattern of BCS1L gene RNA by two antisense oligonucleotides in ovarian cancer cell lines A2780 and HEY; B-C are semi-quantitative PCR diagrams verifying the regulation of the alternative splicing pattern of BCS1L gene RNA by two antisense oligonucleotides in ovarian cancer cell lines A2780 and HEY; D-E are real-time quantitative PCR diagrams verifying the quantitative regulation of the alternative splicing pattern of BCS1L gene RNA by two antisense oligonucleotides in ovarian cancer cell lines A2780 and HEY; F-G are diagrams for measuring the half-inhibitory concentration IC50 of antisense oligonucleotide ASO3 on ovarian cancer cells A2780 and HEY.

[0053] Figure 4 Research diagram of antisense oligonucleotides inhibiting cell proliferation and inducing apoptosis. Among them, A-B are diagrams verifying the proportion of proliferating cells after the action of antisense oligonucleotide ASO3 at different time gradients (0, 24, 48, 72, 96 h) in ovarian cancer cell lines A2780 and HEY using the MTT assay and the long-term live cell analysis system (Incucyte S3 Live Cell Analysis Instrument); C is a flow cytometry diagram for detecting the proportion of apoptotic cells induced by antisense oligonucleotide ASO3 in ovarian cancer cell lines A2780 and HEY.

[0054] Figure 5 Research diagram of antisense oligonucleotides inhibiting the mitochondrial function of ovarian cancer cells. Among them, A-B are diagrams for detecting the cellular ATP content after the action of antisense oligonucleotide ASO3 in ovarian cancer cell lines A2780 and HEY; C-D are diagrams for detecting the reactive oxygen species content in ovarian cancer cell lines A2780 and HEY after the action of antisense oligonucleotide ASO3 using flow cytometry; E-F are diagrams for detecting the effect of antisense oligonucleotide ASO3 treatment on the mitochondrial function of ovarian cancer cells A2780 and HEY using Seahorse XFe96 and the mitochondrial stress kit; G is a diagram for verifying the function of antisense oligonucleotide ASO3 inhibiting mitochondrial complex III in ovarian cancer cell lines using the OROBOROS O2K cell energy metabolism analysis system.

[0055] Figure 6To verify the inhibition of ovarian cancer growth by the antisense oligonucleotide ASO3 using a nude mouse tumorigenesis model in the in vivo experiment of Example 4; wherein, A is the subcutaneous tumorigenesis diagram of the A2780 cell line in severely immunodeficient mice (NOD SCID mice), B is the statistical chart of the subcutaneous tumorigenesis weight of the A2780 cell line in severely immunodeficient mice, C is the statistical chart of the subcutaneous tumorigenesis volume of the A2780 cell line in severely immunodeficient mice. After injecting the antisense oligonucleotide ASO3 into the tumor twice on the 11th day and the 16th day respectively, the tumor volume and weight decreased, and the growth of ovarian cancer was inhibited. Detailed implementation manners

[0056] In order to enable those skilled in the art to more clearly understand the technical solution of the present invention, the technical solution of the present invention will be described in detail below in conjunction with specific embodiments.

[0057] Figure of the structure, expression and subcellular localization of the long and short transcripts of BCS1L in Example 1

[0058] Figure 1 A is the gene sequence and structure schematic diagram of BCS1L and its two main transcripts: the long transcript (BCS1L-L) and the short transcript (BCS1L-S), which shows the transmembrane domain, mitochondrial targeting region, auxiliary membrane-inserting region and AAA ATPase functional region of BCS1L. BCS1L-S lacks the key mitochondrial targeting region at the N-terminus and cannot enter the mitochondria.

[0059] Use SWISS-MODEL to predict the protein structures of BCS1L-L and BCS1L-S, and the structures are as Figure 1 shown in B.

[0060] Using the normal human fallopian tube cell line FTE187 and human ovarian cancer cell lines (A2780, HEY, SKOV3, OV90, HOC7, OVCAR3, OVCAR8, CAOV3) collected by the research group of the inventors of this application, verify the protein expression levels of the long and short transcripts of BCS1L by western blotting.

[0061] The main experimental steps of western blotting protein immunoblotting are as follows:

[0062] 1. Sample preparation for loading: Prepare 30 μg of protein sample that has been fully lysed and centrifuged with cell total protein lysate, dilute the sample with 5×SDS, denature it by heating at 95 °C for 10 min, and cool it on ice.

[0063] 2. Polyacrylamide gel (SDS-PAGE) electrophoresis: The loading amount of the protein marker is 2.5 μL, and the loading volume of each of the remaining wells is controlled within 25 μL. Electrophoresis is carried out at a voltage of 60 - 80 V.

[0064] 3. Membrane transfer (wet transfer method): Cut a PVDF membrane similar in shape and size to the gel. After activation with methanol, soak and equilibrate it in the transfer buffer for 10 - 15 min. Adopt the sandwich arrangement method: Place the PVDF membrane on the SDS-PAGE gel, with sponges attached to both the upper and lower sides. Place them tightly and put the fixed plate into the transfer tank. Place the transfer tank in an ice-water bath and transfer at 200 mA for 60 - 90 min.

[0065] 4. Blocking: Block in a TBST solution containing 5% skim milk on a shaker for 1 h.

[0066] 5. Incubation with primary antibody: Add the primary antibody of BCS1L (ABclonal, A7647) diluted 1:1000 with Western primary antibody diluent (Shanghai Beyotime Biotechnology Co., Ltd.) dropwise. Place the PVDF membrane with protein samples face down on the primary antibody.

[0067] 6. Incubation with secondary antibody: Wash the membrane three times in a TBST solution containing 1% Tween 20, 10 min for each wash. Dilute the secondary antibody (Jackson, 115 - 025 - 003) 1:5000 with the blocking solution and incubate with shaking on a shaker at room temperature for 1 h. Then wash it three times in TBST, 10 min for each wash.

[0068] 7. Chemiluminescence: Freshly prepare the developing solution A and B in a ratio of 1:1, add the appropriate developing solution and evenly drip it onto the membrane, and image with the ECL chemiluminescence system.

[0069] The results are as Figure 1 shown in Figure C. BCS1L-L is less expressed in normal fallopian tube epithelial cell lines and more expressed in ovarian cancer cell lines, while the expression of BCS11L-S is the opposite.

[0070] Based on the UCSC Xena data platform, further analysis according to the expression profiles of ovarian cancer samples in the TCGA database and normal ovarian specimens in the GTEx database showed that the proportion of BCS1L-L in ovarian cancer was significantly higher than that of the short transcript BCS1L-S. The results are as Figure 1 shown in Figure D.

[0071] Conduct a detailed analysis of the expression of the two transcripts of BCS1L in ovarian cancer. Use the information of 180 GTEx-ovary normal ovarian tissues and 374 TCGA-OV ovarian cancer tissues in the database. The results are as Figure 1 shown in Figure E. It can be seen that the expression of BCS1L-L / BCS1L-S is significantly increased in ovarian cancer.

[0072] Using 47 ovarian cancer samples and 22 normal fallopian tube fimbria specimens collected by the research group of the inventors of the present application, real-time quantitative PCR was performed on the expression of BCS1L-L and BCS1L-S, and their relative expression was compared using the ΔCT method (as Figure 1 shown in Figure F).

[0073] The specific primers for BCS1L-L and BCS1L-S are:

[0074] BCS1L-L-F: TTTGGTGTTTCCCTTTCAAGAT

[0075] BCS1L-L-R: CAGGGAGCAGGGAAGACATC

[0076] BCS1L-S-F: AGAGTCACGGCGGTATCGGGGGAAAT

[0077] BCS1L-S-R: GGATGTTGAAGAAAACCTTTCG

[0078] The research group of the inventors of the present application collected fallopian tube fimbria (10 cases) and ovarian cancer samples (14 cases) from Qilu Hospital of Shandong University. The ovarian cancer samples were taken from primary ovarian cancer patients who had not received any surgery or chemotherapy. In addition, normal fallopian tube fimbria samples were taken from patients who underwent total hysterectomy and bilateral salpingo-oophorectomy due to uterine diseases or pathological changes of benign tumor appendages. This study was approved by the Ethics Committee of Shandong University (SDULCLL2019-1-09), and all patients provided written informed consent.

[0079] The expression level of the BCS1L gene was further verified by immunohistochemical scoring. The specific steps of immunohistochemistry and scoring are as follows:

[0080] (1) Deparaffinization: The tissue sections fixed with formalin and embedded in paraffin were deparaffinized in xylene and hydrated after being treated with a series of ethanol solutions with gradient concentrations. The steps were the same as above;

[0081] (2) Antigen retrieval: The EDTA antigen retrieval solution was heated to boiling at high power in a microwave for 10 min, and then the dehydrated sections were immediately put in and heated at low power in the microwave for 15 min and cooled to room temperature, which took about 1 h. Wash 3 times × 3 min on a PBS shaker;

[0082] (3) Membrane permeabilization: Permeabilize with 0.2% PBST solution for 15 min, and wash 3 times × 3 min on a PBS shaker;

[0083] (4) Removal of peroxidase: Incubate with 3% hydrogen peroxide (peroxidase remover) in a wet box for 10 - 15 min, and wash 3 times × 10 min on a PBS shaker;

[0084] (5) Blocking and antibody incubation: The tissue slides were blocked with 1.5% normal goat serum or EZ - Buffer Block BSA in PBS for 1 h, then discarded; incubated with the primary antibody against BCS1L (1:200 dilution, ABclonal, A7647) overnight at 4°C in a humid chamber;

[0085] (6) Reaction enhancement: Remove the primary antibody, wash 3 times × 3 min on a shaker with PBS. Add 100 μL of tissue enhancement solution to each tissue and incubate at room temperature for 20 min, then wash 3 times × 3 min on a shaker with PBS;

[0086] (7) Secondary antibody: Then incubate the sections with 100 μL of secondary antibody mixture (enhanced enzyme - labeled goat anti - rabbit IgG polymer) for 20 min, and wash 3 times × 3 min on a shaker with PBS;

[0087] (8) DAB color development: Add an appropriate amount of freshly prepared 3,3′ - Diaminobenzidine (DAB) color - developing solution for 3 - 6 min, stain with hematoxylin, soak in hydrochloric acid alcohol for 2 s, and rinse in ammonia water for 7 - 10 s; dehydrate, with the same steps as above.

[0088] The immunohistochemical staining results were scored, considering both the staining intensity of the positive reaction and the proportion of tumor cells. The positive reaction was defined as the brown signal of BCS1L in the cytoplasm, and the staining index (0 - 12) was defined as the product of the staining intensity and the staining area. The scores for staining intensity were set as: negative 0 points; weak 1 point; medium 2 points; strong positive 3 points. The frequency of positive cells was defined as: less than 5%, 0 points; 5% - 25%, 1 point; 26% - 50%, 2 point; 51% - 75%, 3 points; more than 75%, 4 points. High expression (score ≥ 7) and low expression (score < 7) of each sample were determined by two pathologists according to the staining intensity and degree of the tissue sections. The results are as Figure 1 shown in Figure G, BCS1L was highly expressed in ovarian cancer.

[0089] Based on the gene expression profile data in the TCGA and GTEx databases, the expression of BCS1L in various tumors was analyzed.

[0090] The RNA expression level was measured by TPM (Transcripts Per Million), and the average expression value of all samples was calculated. The expression of BCS1L in 15 normal tissues and tumors was detected. The results are as Figure 1 shown in Figure H. The results showed that the proportion of BCS1L - L transcripts increased in various tumors.

[0091] Example 2 BCS1L transcript differences and their expression

[0092] The mitochondria and cytoplasm of ovarian cancer cell line A2780 and cervical cancer cell line HeLa were isolated using a mitochondrial isolation kit (Wuhan Yakeyin Biotechnology Co., Ltd.), and the subcellular localization of the BCS1L long and short transcripts was verified by western blotting, as Figure 2 shown in

[0093] The steps for mitochondrial isolation were as follows:

[0094] 1. Cell collection: For adherent cells, rinse twice with 10 mL of pre-cooled PBS, add 1 mL of PBS and scrape off the cells, then centrifuge at 500 g for 10 min.

[0095] 2. Isolation of mitochondria based on the reagent method: Add 0.75 mL of Lysis Buffer A (1X), vortex the cells at half of the maximum speed for 10 s, add 10 μL of Lysis Buffer B, vortex at the maximum speed for 5 s, and incubate on ice for 5 min; add 250 μL of Lysis Buffer C, mix and centrifuge at 600 g for 10 min; collect the supernatant into a new tube and centrifuge at 11,000 g for 10 min.

[0096] 3. Lysis of mitochondria: The supernatant after centrifugation is the cytoplasmic fraction, and the pellet is the mitochondria. Add RIPA lysis buffer to the pellet, lyse on ice for half an hour, centrifuge at 12,000 rpm for 15 min, and take the supernatant as the mitochondrial protein.

[0097] The main experimental steps of western blotting protein immunoblotting were as follows:

[0098] 1. Preparation of loading samples: Prepare 30 μg of protein samples that have been fully lysed and centrifuged with cytoplasmic and mitochondrial protein lysates. Dilute the samples with 5×SDS, heat at 95 °C for 10 min for denaturation, and then cool on ice.

[0099] 2. Polyacrylamide gel (SDS-PAGE) electrophoresis: The loading amount of the protein marker is 2.5 μL, and the loading volume of each of the other wells is controlled within 25 μL. Electrophoresis is carried out at a voltage of 60 - 80 V.

[0100] 3. Transfer membrane (wet transfer method): Cut a PVDF membrane similar in shape and size to the gel, activate it with methanol, and soak and equilibrate it in the transfer buffer for 10 - 15 min. Adopt the sandwich arrangement method: Place the PVDF membrane on the SDS-PAGE gel, with sponges attached to both the upper and lower sides. Place it tightly and put the fixed plate into the transfer tank. Place the transfer tank in an ice-water bath and transfer at 200 mA for 60 - 90 min.

[0101] 4. Blocking: Block in a TBST solution containing 5% skim milk on a shaker for 1 h.

[0102] 5. Incubate and add primary antibodies: Dilute the primary antibodies of BCS1L (ABclonal, A7647) and Tom20 (Proteintech, 11802-1-AP) at a ratio of 1:1000 using Western primary antibody diluent (Shanghai Beyotime Biotechnology Co., Ltd.), and place the PVDF membrane with protein samples face down on the primary antibodies.

[0103] 6. Incubate secondary antibody: Wash the membrane three times in TBST solution containing 1% Tween 20, for 10 minutes each time. Dilute the secondary antibody (Jackson, 115-025-003) at a ratio of 1:5000 using the blocking solution, and incubate it on a shaker at room temperature for 1 hour. Then wash it three times in TBST, for 10 minutes each time.

[0104] 7. Chemiluminescence: Freshly prepare the developing solution A and B at a ratio of 1:1, add the appropriate developing solution and evenly drip it onto the membrane, and image it using the ECL chemiluminescence system.

[0105] The results are as Figure 2 shown in

[0106] Figure 2 A. BCS1L-L is mainly expressed in mitochondria, while BCS1L-S is only expressed in the cytoplasm and cannot enter mitochondria.

[0107] The steps of Co-Immunoprecipitation (Co-IP) are as follows:

[0108] 1. Cell lysis: Wash the adherent cells 2-3 times with pre-cooled PBS to remove the culture medium or impurities. Add an appropriate amount of lysis buffer (containing protease inhibitors and phosphatase inhibitors), and lyse the cells on ice for 30 minutes; after lysis, centrifuge at 4°C and 12,000 rpm for 15 minutes, and collect the supernatant (i.e., the total protein extract).

[0109] 2. Pre-clean the magnetic beads: To reduce non-specific binding, the samples can be pre-cleared with protein A / G magnetic beads. Take an appropriate amount of protein A / G magnetic beads, wash them 2-3 times with PBS; mix the magnetic beads with the total protein extract, and incubate them with rotation at 4°C for 1 hour; after centrifugation, retain the supernatant and remove the magnetic beads.

[0110] 3. Antibody incubation: Add Flag (Sigma-Aldrich, F1804) antibody to the total protein extract, and incubate it with rotation at 4°C for 2 hours to overnight.

[0111] 4. Protein A / G magnetic bead capture: Take an appropriate amount of Protein A / G magnetic beads and wash them 2-3 times with PBS; add the magnetic beads to the antibody-protein mixture and incubate with rotation at 4°C for 2 h; the magnetic beads will bind to the antibody, thereby capturing the target protein and its interacting proteins.

[0112] 5. Washing: Wash the magnetic beads 3-4 times with pre-cooled lysis buffer, and centrifuge or use a magnetic stand to separate the magnetic beads after each wash. The purpose of washing is to remove unbound proteins and non-specific binders.

[0113] 6. Elution: Add an appropriate amount of 1×SDS loading buffer, boil for 5-10 min to elute the protein from the magnetic beads; collect the supernatant after centrifugation for subsequent mass spectrometry analysis.

[0114] The mass spectrometry results showed that the proteins interacting with BCS1L-L were mainly enriched in biological metabolic pathways such as mitochondrial carbohydrate metabolism and nucleotide metabolism, while BCS1L-S could not enrich the corresponding proteins.

[0115] To further verify the subcellular localization of BCS1L-L and BCS1L-S, exogenous overexpression plasmids of BCS1L-L and BCS1L-S with m-Cherry red fluorescent tags were constructed and transfected respectively. As Figure 2 shown in C-D, after Mito-tracker and nuclear staining, live cell fluorescence imaging was performed using a confocal microscope (Dragonfly 200).

[0116] The main experimental steps of live cell fluorescence imaging are as follows:

[0117] (1) Inoculate cells in the logarithmic growth phase in a 6-well plate with cell culture slides, and transfect the exogenous overexpression plasmid for 72 h after overnight culture;

[0118] (2) After the treatment is completed, aspirate the culture medium and wash twice with PBS (if detecting phosphatase, add phosphatase inhibitor);

[0119] (3) Dilute Mito-tracker at a ratio of 1:50000 and Hoechst at a ratio of 1:100 in pre-warmed PBS at 37°C, and add to the 6-well plate for staining for 20 min;

[0120] (4) Wash the cells 3 times with PBS, 5 min each time; take fluorescence images on an Andor Revolution confocal microscope system.

[0121] To further explore the functions of BCS1L-L with increased expression and BCS1L-S with decreased expression in ovarian cancer, we conducted relevant mitochondrial function experiments.

[0122] Specific experimental steps for measuring the oxygen consumption rate of cells using the mitochondrial stress kit on the Seahorse XFe24:

[0123] 1. Turn on and preheat the detection system one day before the experiment. Turn on the instrument host and controller, open the software Wave, wait for the controller to successfully connect to the instrument host, and heat up to 37 °C (the Seahorse XFe96 detection system should be turned on at least 5 h in advance);

[0124] 2. Seed cells. Collect cells and count them, and seed the cells into the XFe96 well culture plate at a density of (5 - 10)×10 3 cells / 80 μL. Leave one empty well at each of the four corners of the culture plate, and add 80 μL of cell growth medium as background correction wells. Place the culture plate in the laminar flow hood and let it stand for 1 h to allow the cells to settle naturally, thereby reducing the edge effect and making the cells evenly distributed. After standing, place the culture plate in an incubator at 37 °C and 5% CO 2 2. The next day, load the sample onto the instrument. Before loading, the cell density is approximately 80 - 90%;

[0125] 3. Hydrate the probe plate. Remove the lid and probe plate from the hydration plate and invert them on the laminar flow hood (to protect the sensors on the probe plate from damage). Add 200 μL of sterile 3DW to each well of the hydration plate, replace the lid and probe plate back onto the hydration plate, and ensure that all sensors are immersed in the sterile water. Incubate the entire probe in an incubator at 37 °C without CO 2 overnight.

[0126] 4. The next day, discard the sterile water and add 200 μL of XF hydration solution to each well of the hydration plate. Place the probe plate device in an incubator at 37 °C without CO 2 for 1 - 2 h for hydration. During the waiting time, prepare the drugs;

[0127] 5. Wash the cells. Take out the cells from the incubator, observe the cell status and density under the microscope and ensure good cell adhesion, confluence meeting the basic requirements and no contamination. Use a multi-channel pipette to aspirate 60 μL of the growth medium from all wells of the culture plate, leaving 20 μL remaining. Then add 200 μL of the test solution to all wells, and aspirate 200 μL again. Repeat the operation once, and finally 20 μL of the test solution remains in each well. Add 160 μL of the test solution to all wells to make the final volume 180 μL. Place the culture plate in an incubator at 37 °C without CO 2 and incubate for 1 h before loading the sample onto the instrument for detection;

[0128] 6. Prepare the drugs and add them to the drug addition wells of the probe plate. Resuspend the drugs and dilute them to the working solution, dilute and dissolve them according to the instructions, mix well and set aside. Dilute the prepared drugs to the working concentration (10×) according to the instructions and add the diluted drugs to the drug addition wells of the probe plate;

[0129] 7. Detection during operation. First, place the probe plate and the hydration plate into the instrument for calibration. After calibration, take out the hydration plate, put it into the cell culture plate, and start the energy metabolism detection stage. After the entire program runs to completion, take out the cell plate and the probe plate, save the data, and then close the program and the instrument.

[0130] The results are as Figure 2 shown in E. Compared with the control, overexpression of BCS1L-L significantly increased the basal oxygen consumption, ATP production, maximal oxygen consumption, reserve respiration, and proton leak levels in the ovarian cancer cell line A2780, while overexpression of BCS1L-S showed no change.

[0131] Under the induction of 500 μM hydrogen peroxide, the resistance of BCS1L-L or BCS1L-S overexpression to hydrogen peroxide-induced apoptosis was detected.

[0132] JC-1 (5,5’,6,6’-Tetrachloro-1,1′,3,3′-tetraethylbenzimidazolylcarbocyanine iodide) is a commonly used fluorescent dye for detecting mitochondrial membrane potential (ΔΨm). When the mitochondrial membrane potential is relatively high, JC-1 forms polymers (J-aggregates) and emits red fluorescence; when the membrane potential is relatively low, it exists in monomer form and emits green fluorescence. By detecting the change in the ratio of red to green fluorescence, the change in mitochondrial membrane potential can be evaluated. The steps for detecting mitochondrial membrane potential by flow cytometry are as follows:

[0133] 1. Cell preparation: Seed the cells in a culture plate or dish and culture them to an appropriate density (usually 70 - 80% confluence). Digest adherent cells with trypsin without EDTA and collect the cell suspension; wash the cells 2 - 3 times with PBS to remove the serum in the culture medium (serum may affect JC-1 staining).

[0134] 2. JC-1 staining: Add the diluted JC-1 working solution (5 - 10 μM) to completely cover the cells. Incubate at 37 °C in the dark for 20 minutes. After incubation, wash the cells 2 - 3 times with PBS to remove the unbound JC-1 dye.

[0135] 3. Setting of positive control: To verify the reliability of the experiment, a positive control group can be set: before JC-1 staining, treat the cells with a mitochondrial membrane potential uncoupler (such as 10 μM CCCP) for 20 - 30 min. Then perform JC-1 staining according to the above steps.

[0136] 4. Flow cytometry detection: Resuspend the cells with PBS and filter to remove cell clumps. Use flow cytometry to detect the fluorescence signal: Excitation wavelength: 488 nm, green fluorescence (monomer): emission wavelength 530 nm (FITC channel), red fluorescence (polymer): emission wavelength 590 nm (PE channel). Analyze the change in the ratio of red and green fluorescence to evaluate the mitochondrial membrane potential.

[0137] The Annexin V-PE / 7-AAD cell apoptosis staining kit (Nanjing Novoprotein Scientific Inc.) is a commonly used flow cytometry detection method for distinguishing live cells, early apoptotic cells, late apoptotic cells, and necrotic cells. Annexin V binds to phosphatidylserine (PS) on the cell surface, while 7-AAD (7-Aminoactinomycin D) is a nucleic acid dye that can penetrate the damaged cell membrane and enter dead cells. Through the combination of these two dyes, cells in different states can be accurately distinguished. The specific experimental steps are as follows:

[0138] 1. Collect cells: Collect 5×10 5 adherent cells, digest the cells with trypsin without EDTA, collect the cells after terminating the digestion, centrifuge at 1000 rpm and 4 °C for 5 min, and discard the supernatant.

[0139] 2. Wash the cells: Wash the cells twice with pre-cooled PBS, centrifuge at 1000 rpm and 4 °C for 5 min each time, and discard the supernatant.

[0140] 3. Resuspend the cells: Add 100 μL of 1×Binding Buffer and gently pipette to obtain a single-cell suspension.

[0141] 4. Cell staining: Add 5 μL of Annexin V-PE and 5 μL of 7-AAD Staining Solution and pipette well; incubate at room temperature (20 - 25 °C) for 10 min; add 400 μL of 1×Binding Buffer and mix well.

[0142] 5. Analyze the stained samples with a flow cytometer within 1 h: Normal cells are double-negative (Annexin V-PE ﹣

[0143] / 7-AAD ﹣ ); Early apoptotic cells are Annexin V-PE single-positive (Annexin V-PE ﹢ / 7-AAD ﹣ ); Late apoptotic cells are double-positive for Annexin V-PE and 7-AAD (Annexin V-PE ﹢ / 7-AAD ﹢ ).

[0144] The results are as Figure 2 shown in F-G. Overexpression of BCS1L-L can resist the abnormal mitochondrial membrane potential and apoptosis induced by hydrogen peroxide, while BCS1L-S has a poor ability to resist oxidative stress.

[0145] Example 3 Antisense oligonucleotides targeting exon 2 of BCS1L and their effects

[0146] The inventors of the present application found that the core transcripts of BCS1L differ in exon 2, and a classical GU splicing site was found at the junction of exon 2 and intron 2 of BCS1L. The inventors designed and prepared antisense oligonucleotides located in the junction region of exon 2 and intron 2 of BCS1L:

[0147] CCACCTTACCAGATAAAATGG (SEQ ID NO:2);

[0148] CTCCCTAGCTCCCCACCTTAC (SEQ ID NO:3).

[0149] By base complementary pairing, it hinders the splicing of splicing factors to the immature precursor RNA of downstream target genes, so as to interfere with the splicing of BCS1L and cause changes in the splicing pattern of exon 3.

[0150] Beijing Tsingke Biotechnology Co., Ltd. was commissioned to synthesize the following antisense oligonucleotides:

[0151] BCS1L-ASO-2:

[0152] C*C*A*C*C*T*T*ACCAGA*T*A*A*A*A*T*G*G

[0153] BCS1L-ASO-3:

[0154] C*T*C*C*C*T*A*G*C*TCCCC*A*C*C*T*T*A*C

[0155] BCS1L-NC (negative control):

[0156] C*C*T*C*T*T*A*C*C*TCAGTTA*C*A*A*T*T*T*A*T*A.

[0157] Among them, * represents phosphorothioate modification.

[0158] Figure 3A shows the binding sites of the antisense oligonucleotides BCS1L-ASO-2 and BCS1L-ASO-3. As shown in the figure, BCS1L-ASO-3 is reverse complementary to the 5'-end sequence of intron 3 of the immature precursor mRNA of BCS1L;

[0159] BCS1L-ASO-2 is reverse complementary to the junction site between exon 3 and intron 3 of the immature precursor mRNA of BCS1L and the sequences on both sides thereof.

[0160] The above 150 nM antisense oligonucleotides were transiently transfected into ovarian cancer cell lines A2780 and HEY using jetPRIME respectively, and cell RNA was harvested after 48 h. Semi-quantitative PCR and real-time fluorescence PCR were used to verify the changes in their RNA respectively. Total cell RNA was extracted using a total RNA extraction kit (Chengdu Fuji Biotechnology Co., Ltd.), and reverse transcription was performed using HiScript II Q Select RT SuperMix for qPCR (Nanjing Novozymes Biotechnology Co., Ltd., R232-01) at 37 °C for 15 min and 85 °C for 5 s. The reverse-transcribed cDNA was amplified using semi-quantitative PCR primers (as follows) and 2×Taq Plus Master Mix (Dye Plus) (Nanjing Novozymes Biotechnology Co., Ltd., P212-01), and the products were electrophoresed on a 1.5% agarose gel at 110 V for 30 min, and then imaged and photographed.

[0161] BCS1L-L-F 5'-GCGCCATTACATGATCACAC-3'

[0162] BCS1L-L-R 5'-CTTCGTTCTACCCGAATCCA-3'

[0163] BCS1L-S-F 5'-AGAGTCACGGCGGTATCGGGGGAAAT-3'

[0164] BCS1L-S-R 5'-GGATGTTGAAGAAAACCTTTCG-3'.

[0165] The results are as Figure 3 shown in Figure 3 B and

[0166] Percent spliced-in index (PSI) = gray scale of exon retention band / (gray scale of exon retention band + gray scale of exon skipping band)

[0167] In this example, real-time fluorescence quantitative PCR was further used to quantitatively detect the amplitude of the effect of ASO2 and AS03 on exon skipping, as Figure 3 shown in D-E, demonstrating that ASO3 has a better effect in ovarian cancer cells A2780 and HEY.

[0168] The inhibitory effect of the antisense oligonucleotide ASO3 on ovarian cancer cell lines A2780 and HEY was determined by the MTT method.

[0169] The experimental steps of the MTT method mainly include:

[0170] 1. Take cells in the logarithmic growth phase, digest them with trypsin, centrifuge to collect the cells, prepare a single-cell suspension, count under a microscope, and adjust the cell concentration;

[0171] 2. According to 5000 cells / 100 μL / well, with 5 replicates per group, count the required cell amount and prepare the cell suspension;

[0172] 3. Add 100 μL of the cell suspension into a 96-well plate. The wells around are used to add PBS to reduce the evaporation of the culture medium. After standing for 30 - 40 min, place it in an incubator for culture.

[0173] 4. After 24 h, add the corresponding antisense oligonucleotide to each well according to the final concentration gradient of 0, 12.5, 25, 50, 100, 200, 400 nM. After 72 h, obvious cell apoptosis was observed, and proceed to the next step;

[0174] 5. Take out the 96-well plate, add 10 μL of MTT (5 mg / mL) to each well, gently shake and mix well, then put it back into the incubator and incubate at 37 °C for 4 h.

[0175] 6. After 4 h, take out the 96-well plate, aspirate the culture medium, being careful not to disturb the formazan crystals at the bottom. Add 100 μL of DMSO to each well, shake or let it stand at room temperature for 10 min to dissolve the precipitate.

[0176] 7. Measure the absorbance at 570 nm with an enzyme-linked immunosorbent assay (ELISA) reader, and calculate the cell viability and IC50 value using GraphPad 8.0.

[0177] The results are as Figure 3 shown in F and Figure 3 G: The half-maximal inhibitory concentration (IC50) of ASO3 is 30.78 nM in A2780 and 22 nM in HEY.

[0178] Example 4 Antisense oligonucleotides inhibit the proliferation of ovarian cancer and induce its apoptosis

[0179] Taking advantage of the characteristic that ASO3 can regulate the alternative splicing of BCS1L to increase the expression of BCS1L-S, its effect on inducing apoptosis of tumor cells and anti-tumor effect were further studied.

[0180] The cell proliferation rate after adding ASO3 was verified by MTT assay and long-term live cell imaging in different ovarian cancer cells or cell lines.

[0181] The experimental steps for measuring cell proliferation rate by MTT assay mainly include:

[0182] 1. Collect cells in the logarithmic growth phase, digest with trypsin, centrifuge to collect cells, prepare a single-cell suspension, count under a microscope, and adjust the cell concentration.

[0183] 2. According to 5000 cells / 100 μL / well, with 5 replicates per group, count the required cell amount and prepare the cell suspension.

[0184] 3. Add 100 μL of cell suspension into a 96-well plate. The wells around are used to add PBS to reduce medium evaporation. After standing for 30 - 40 min, place it in an incubator for culture.

[0185] 4. After 24 h, add antisense oligonucleotide to each well at a final concentration of 100 nM. At 0, 24, 48, 72, and 96 h after treatment, add 10 μL of MTT (5 mg / mL) to each well, gently shake and mix well, then put it back into the incubator and incubate at 37 °C for 4 h. After 4 h, take out the 96-well plate, aspirate the medium, being careful not to disturb the formazan crystals at the bottom. Add 100 μL of DMSO to each well, shake or let it stand at room temperature for 10 min to dissolve the precipitate.

[0186] 5. Measure the absorbance at 570 nm with an enzyme-linked immunosorbent assay (ELISA) reader, and calculate cell viability using GraphPad 8.0.

[0187] The results are shown in Figure 4 A and Figure 4 B. The antisense oligonucleotide ASO3 can significantly inhibit the proliferation rates of ovarian cancer cell lines A2780 and HEY.

[0188] The Annexin V-PE / 7-AAD apoptosis staining kit (Nanjing Novoprotein Scientific Inc.) was used to quantitatively determine the proportion of apoptotic cells. The specific experimental steps are as follows:

[0189] 1. Collect cells: Collect 5×10 5 adherent cells, digest the cells with trypsin without EDTA, collect the cells after terminating digestion, centrifuge at 1000 rpm and 4 °C for 5 min, and discard the supernatant.

[0190] 2. Wash the cells: Wash the cells twice with pre-cooled PBS, centrifuge at 1000 rpm and 4 °C for 5 min each time, and discard the supernatant.

[0191] 3. Resuspend the cells: Add 100 μL of 1×Binding Buffer and gently pipette to obtain a single-cell suspension.

[0192] 4. Cell staining: Add 5 μL of Annexin V-PE and 5 μL of 7-AAD Staining Solution, pipette to mix; incubate at room temperature (20 - 25 °C) for 10 min; add 400 μL of 1×Binding Buffer and mix well.

[0193] 5. Analyze the stained samples by flow cytometry within 1 h: Normal cells are double-negative (Annexin V-PE ﹣

[0194] / 7-AAD ﹣ ); Early apoptotic cells are Annexin V-PE single-positive (Annexin V-PE ﹢ / 7-AAD ﹣ ); Late apoptotic cells are double-positive for Annexin V-PE and 7-AAD (Annexin V-PE ﹢ / 7-AAD ﹢ ).

[0195] The experimental results are as shown in Figure 4 Figure C. It was found that the antisense oligonucleotide ASO3 could induce an increase in the proportion of early and late apoptosis in ovarian cancer cell lines A2780 and HEY.

[0196] Example 5 Inhibition of mitochondrial function in ovarian cancer by antisense oligonucleotides

[0197] Based on the fact that ASO3 targets the key assembly partner of mitochondrial complex III, further study its effect on mitochondrial function.

[0198] Use an enhanced ATP detection kit (Beyotime) to measure the ATP content of ovarian cancer cell lines A2780 and HEY treated with the antisense oligonucleotide ASO3. The results are as shown in Figure 5 Figure A - B. After treatment with ASO3, the mitochondrial ATP content of ovarian cancer cells decreased significantly.

[0199] The specific steps for detecting ATP are as follows:

[0200] 1. Take out the reagents used in the experiment in advance and place them on ice to melt for later use. When terminating cell culture, collect the cells, wash them 3 times with pre-cooled PBS, discard the supernatant, add 100 - 200 μL of ATP lysis buffer, and lyse on ice for 10 - 15 min. Centrifuge at 12,000 g for 5 min at 4 °C, transfer the supernatant to a new 1.5 mL microcentrifuge tube, and place it on ice for later use;

[0201] 2. Preparation of the standard curve: Dilute the ATP standard with the ATP detection lysis buffer. Concentration gradients of 0.01 μM, 0.03 μM, 0.1 μM, 0.3 μM, 1 μM, 3 μM, and 10 μM can be set. After preparation, place it on ice for later use;

[0202] 3. Prepare the ATP detection working solution. Prepare an appropriate amount of ATP detection working solution according to the ratio of ATP detection reagent: ATP detection reagent diluent = 1:4, and add 100 μL of ATP detection working solution to each group;

[0203] 4. ATP concentration determination. Use a luciferase - specific 96 - well plate to detect the ATP concentration. Add 100 μL of ATP detection working solution to the detection wells, incubate at room temperature for 5 min to consume all the background ATP. Add 50 μL of the standard or the sample to be tested to the detection wells, mix well with a pipette (avoid generating bubbles), and then measure the RLU value with a luminometer. The procedure is: wait for 2 s; detect for 10 s;

[0204] 5. Plot the standard curve and calculate the ATP concentration (μM) of the sample;

[0205] 6. Detect the protein concentration of the sample to be tested by the BCA method to eliminate the error caused by the difference in protein concentration during sample preparation. Finally, convert the ATP concentration to nmol / mg.

[0206] Use a reactive oxygen species detection kit (Beyotime) to measure the reactive oxygen species level of ovarian cancer cells after ASO3 treatment. The specific steps are as follows:

[0207] 1. Cell transfection is as described above. A positive control group needs to be set in the experiment. When the cells grow to a specific time point, collect the cells;

[0208] 2. After collecting the cells, wash the cells once with PBS and discard the PBS. Resuspend the cells in 1 mL of Staining buffer pre - warmed to 37 °C in each tube;

[0209] 3. The positive control group was added with 1 μL of CCCP (final concentration 50 μM) and 1 μL of JC-1 (final concentration 2 μM) simultaneously, and the experimental group was added with 1 μL of JC-1. They were placed in an incubator and incubated for 20 - 30 min; centrifuged at 11000 rpm for 5 min, the supernatant was discarded, and the cells were washed once with 1 mL of pre-warmed PBS at 37°C; centrifuged at 11000 rpm for 5 min, the supernatant was discarded, and the cells were resuspended with 500 μL of PBS;

[0210] 4. Detection was performed on a flow cytometer (FITC and PE channels), and compensation was adjusted with the CCCP treatment group.

[0211] The results were as Figure 5 shown in C - D. After treatment with ASO3, the ROS level in ovarian cancer cells increased significantly.

[0212] The specific experimental steps for measuring the oxygen consumption rate of cells using a mitochondrial stress kit on Seahorse XFe96 are as follows:

[0213] 1. Turn on and preheat the detection system one day before the experiment. Turn on the instrument main unit and the controller, open the software Wave, wait for the controller to be successfully connected to the instrument main unit, and warm up to 37°C (the Seahorse XFe96 detection system should be turned on at least 5 h in advance);

[0214] 2. Seed the cells. Collect the cells and count them, and seed the cells into the XFe96 well culture plate at a density of (5 - 10)×10 3 cells / 80 μL. Leave one empty well at each corner of the culture plate, and add 80 μL of cell growth medium as the background correction well. Place the culture plate in a laminar flow hood and let it stand for 1 h to allow the cells to settle naturally, so as to reduce the edge effect and make the cells evenly distributed. After standing, place the culture plate in an incubator at 37°C and 5% CO 2 2. The next day, perform the detection. The cell density before detection is about 80 - 90%;

[0215] 3. Hydrate the probe plate. Remove the lid and the probe plate on the hydration plate, and place it upside down on the laminar flow hood (to protect the sensors on the probe plate from being damaged). Add 200 μL of sterile 3DW to each well of the hydration plate, replace the lid and the probe plate back onto the hydration plate, and ensure that all sensors are immersed in the sterile water. Place the entire probe in an incubator at 37°C and without CO 2 overnight.

[0216] 4. The next day, discard the sterile water, and add 200 μL of XF hydration solution to each well of the hydration plate. Place the probe plate device in an incubator at 37°C and without CO 2 2 for 1 - 2 h of hydration, and prepare the drugs during the waiting time;

[0217] 5. Wash the cells. Take the cells out of the incubator, observe the cell status and density under the microscope, and ensure good cell adhesion, confluence meeting the basic requirements, and no contamination. Use a multi-channel pipette to aspirate 60 μL of the growth medium from all wells of the culture plate, leaving 20 μL. Then add 200 μL of the test solution to all wells, and aspirate 200 μL again. Repeat the operation once. Finally, 20 μL of the test solution remains in each well. Add 160 μL of the test solution to all wells to make the final volume 180 μL. Place the culture plate in a 37°C incubator without CO 2 2 incubator, incubate for 1 h and then perform on-machine detection;

[0218] 6. Prepare the drug and add it to the drug-adding wells of the probe plate. Resuspend the drug and dilute it to the working solution. Dilute and dissolve it according to the instructions, mix well and set aside. Dilute the prepared drug to the working concentration (10×) according to the instructions and add the diluted drug to the drug-adding wells of the probe plate;

[0219] 7. Run the detection on the machine. First, place the probe plate and the hydration plate into the instrument for calibration. After calibration, take out the hydration plate, place the cell culture plate, and start the energy metabolism detection stage. After the entire program runs, take out the cell plate and the probe plate, save the data, and close the program and the instrument.

[0220] The experimental results are as Figure 5 shown in E-F. Treatment with the antisense oligonucleotide ASO3 reduces the basal oxygen consumption, proton leak level, and reserve respiratory capacity of ovarian cancer cells.

[0221] Since BCS1L is an important component of mitochondrial complex III, in this example, the OROBOROS O2K cell energy metabolism analysis system was used to evaluate the function of mitochondrial complex III. The specific steps are as follows:

[0222] 1. Instrument preparation: Turn on the OROBOROS O2K instrument and preheat it to 37°C; Calibrate the oxygen sensor: Add 2 mL of air-saturated mitochondrial respiration buffer. Use the DatLab software to calibrate the oxygen sensor.

[0223] 2. Sample loading: Add the cell or mitochondrial sample into the reaction chamber, adjust the sample concentration to 1×10 6 cells / mL, and add mitochondrial respiration buffer to make the final volume 2 mL.

[0224] 3. Baseline measurement: After adding digoxin to disrupt the membrane, record the baseline oxygen consumption rate (OCR) to reflect the basal respiration of the sample.

[0225] 4. Complex III Function Detection: Add the following reagents in sequence and record the changes in OCR: Add the substrates of Complex I and II, glutamate and malate, to the substrate. This stage is the proton leak stage of Complex I; Add 1-2 mM ADP, the substrate of ATP synthase; Add 10 mM succinate, the substrate of Complex III, to stimulate the electron transfer of Complex III and record the maximum respiratory rate. Finally, add 2.5 μM antimycin A, an inhibitor of Complex III, to inhibit the activity of Complex III and record the decrease in OCR.

[0226] 5. Data Analysis: Use DatLab software to analyze the OCR data and calculate the baseline OCR, maximum OCR, and OCR after inhibition. Compare the changes in OCR among different groups to evaluate the function of Complex III.

[0227] The results are as Figure 5 shown in Figure G. ASO3 inhibits the function of mitochondrial Complex III in ovarian cancer cell line A2780.

[0228] Example 6 In Vivo Experiment to Verify the Inhibition of Ovarian Cancer Cell Growth by Antisense Oligonucleotides

[0229] Female NOD SCID mice aged 4 - 8 weeks were used. 1x10 6 A2780 ovarian cancer cells were subcutaneously injected bilaterally into the axilla at a dose of 1 cell per site. When the subcutaneous tumor diameter was approximately 3 - 5 mm, 5 nude mice with basically the same bilateral tumor size were selected for intratumoral injection of antisense oligonucleotide ASO3.

[0230] Each nude mouse was injected with 5 nmol of antisense oligonucleotide per site, diluted with 25 μL of Opti-MEM and mixed with 3 μL of Lipofectamine 2000, and injected twice on the 11th and 16th days. The tumor size was observed and recorded every three days, and the nude mice were sacrificed by anesthesia 2 - 3 weeks later.

[0231] The results are as Figure 6 shown. Figure 6 Figures A - C are pictures of subcutaneous tumor formation in nude mice. After intratumoral injection of antisense oligonucleotide ASO3 and its corresponding control, the volume and weight were statistically analyzed. The results showed that antisense oligonucleotide ASO3 had an inhibitory effect on tumor growth.

[0232] The above are only the preferred embodiments of the present invention and are not intended to limit the present invention. For those skilled in the art, the present invention can have various modifications and changes. Any modification, equivalent replacement, improvement, etc. made within the spirit and principle of the present invention shall be included within the protection scope of the present invention.

Claims

1. An antisense oligonucleotide, characterized in that It includes 5-30 nucleotides, which have at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the BCS1L polynucleotide; the antisense oligonucleotide can act on the GU splicing site at the junction of exon 2 and intron 2 of the BCS1L polynucleotide, thereby regulating the BCS1L splicing pattern.

2. The antisense oligonucleotide according to claim 1, characterized in that The sequence of the BCS1L polynucleotide is shown in SEQ ID NO:

1.

3. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the BCS1L polynucleotide; preferably, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of nucleotides 2536-2595 of the polynucleotide having a sequence of SEQ ID NO: 1; Preferably, the antisense oligonucleotide has at least 50% sequence identity with the reverse complementary sequence of the natural antisense sequence of the polynucleotide fragment at the junction of exon 2 and intron 2 of the following BCS1L polynucleotide: a fragment of 30 nucleotides at one end of exon 2 connected to intron 2, a fragment of 30 nucleotides at one end of intron 2 connected to exon 2, or a fragment of 30 nucleotides including the boundary between exon 2 and intron 2; Preferably, the antisense oligonucleotide comprises a reverse complementary sequence of a natural antisense sequence of the first 5 to first 20 nucleotides of intron 2 of the BCS1L polynucleotide connected to exon 2 at one end; preferably, the antisense oligonucleotide comprises a reverse complementary sequence of a natural antisense sequence of the first approximately 5 nucleotides of intron 2 of the BCS1L polynucleotide connected to exon 2 at one end.

4. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide comprises a reverse complementary sequence to any consecutive 5 to 20 nucleotides in nucleotides 2566-2585 of the BCS1L polynucleotide of SEQ ID NO: 1; preferably, the antisense oligonucleotide comprises a reverse complementary sequence to nucleotides 2566-2570 of the BCS1L polynucleotide of SEQ ID NO:

1.

5. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide comprises one or more modifications selected from the group consisting of at least one modified sugar moiety, at least one modified internucleoside bond, at least one modified nucleotide and combinations thereof; preferably, one or more nucleotides in the antisense oligonucleotide are modified nucleotides; preferably, the one or more modifications comprise at least one modified internucleoside bond selected from the group consisting of phosphorothioate, 2'-O-methoxyethyl, 2'-fluoro, alkyl phosphate, phosphorodithioate, alkyl phosphonothioate, phosphoramidate, carbamate, carbonate, phosphotriester, aminoacetate, carboxymethyl ester and combinations thereof.

6. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide has a nucleotide sequence as shown in SEQ ID NO:2 or SEQ ID NO:

3.

7. The antisense oligonucleotide according to claim 1, characterized in that The antisense oligonucleotide is: C*C*A*C*C*T*T*ACCAGA*T*A*A*A*A*T*G*G; or C*T*C*C*C*T*A*G*C*TCCCC*A*C*C*T*T*A*C; * represents phosphorothioate modification.

8. A pharmaceutical composition, characterized in that: The invention comprises the antisense oligonucleotide according to any one of claims 1 to 7, and a pharmaceutically acceptable diluent or carrier.

9. Use of the antisense oligonucleotide according to any one of claims 1 to 7 or the pharmaceutical composition according to claim 8 in the preparation of anti-tumor drugs.

10. The use according to claim 9, characterized in that: The tumors include, but are not limited to, meningioma, melanoma, acoustic neuroma, oligodendroglioma, neuroblastoma, chordoma, angiosarcoma, endotheliosarcoma, lymphangiosarcoma, lymphangioendotheliosarcoma, retinoblastoma, small cell lung tumor, primary brain tumor, papillary adenocarcinoma, cystadenocarcinoma, medullary carcinoma, bronchial carcinoma, renal cell carcinoma, hepatoma, bile duct carcinoma, fibrosarcoma, myxosarcoma, liposarcoma, chondrosarcoma, osteosarcoma, gastric cancer, colon cancer, malignant pancreatic islet tumor, cervical cancer, endometrial cancer, adrenal cortical carcinoma, breast cancer, ovarian cancer, synovioma, mesothelioma, Ewing's tumor, leiomyosarcoma, rhabdomyosarcoma, colon cancer, pancreatic cancer, prostate cancer, squamous cell carcinoma, basal cell carcinoma, adenocarcinoma, Hodgkin's disease, non-Hodgkin's lymphoma, multiple bone Myeloma, neuroblastoma, breast cancer, rhabdomyosarcoma, sweat gland cancer, sebaceous gland cancer, papillary carcinoma, malignant carcinoid tumor, premalignant skin lesions, testicular cancer, lymphoma, thyroid cancer, neuroblastoma, esophageal cancer, genitourinary tract cancer, malignant hypercalcemia, choriocarcinoma, seminoma, embryonal carcinoma, Wilms tumor, cervical cancer, testicular tumor, lung cancer, small cell lung cancer, bladder cancer, epithelial cancer, glioma, astrocytoma, medulloblastoma, craniopharyngioma, ependymoma, pinealoma, hemangioblastoma, essential thrombocythemia, essential macroglobulinemia; preferably ovarian cancer, gastric cancer, pancreatic cancer, breast cancer, lung cancer, liver cancer, kidney cancer, prostate cancer, glioma, adrenocortical carcinoma, melanoma, sarcoma, more preferably ovarian cancer; Or, the subject to which the anti-tumor drug is administered is a mammal; the mammal is preferably a human; Or, the anti-tumor drug has the following effects: Inhibit the proliferation rate of cancer cells; and / or, Inducing apoptosis of cancer cells; and / or, Reducing the amount of ATP in cancer cell mitochondria; and / or, Increase the level of reactive oxygen species in cancer cells; and / or, Reducing the basal oxygen consumption of cancer cells; and / or, Reducing proton leakage levels in cancer cells; and / or, Reducing the reserve respiratory capacity of cancer cells; and / or, Inhibits the function of mitochondrial complex III in cancer cells.

Citation Information

Patent Citations

  • Antisense oligonucleotides that modulate expression of BCL2L12 and their use in treatment of disease

    CN116218845A

  • Antisense oligonucleotide for promoting jumping of PDCD1 exon 3 and application of antisense oligonucleotide

    CN117660447A

  • Therapeutic targets for mitochondrial disorders

    US20150065556A1

  • Methods to modulate TAU for treatment of tauopathies

    WO2024158825A2