SiRNA duplex for targeted regulation of LPA gene expression and application of siRNA duplex in prevention and treatment of cardiovascular and cerebrovascular related diseases

Abstract

The invention provides a siRNA duplex for targeted regulation and control of LPA gene expression and application of the siRNA duplex in prevention and treatment of cardiovascular and cerebrovascular related diseases. The present disclosure also relates to corresponding conjugates and pharmaceutical compositions. Cell and animal experiment results show that the oligonucleotide duplex can significantly inhibit the expression of the LPA gene, and can be used for preparing drugs for preventing or treating atherosclerosis and other related diseases.

Description

Technical Field

[0001] The present disclosure belongs to the field of biomedicine, and particularly relates to an siRNA duplex for targeting and regulating the expression of the LPA gene and its use in the prevention and treatment of cardiovascular and cerebrovascular related diseases. Background Art

[0002] Nucleic acid drugs, especially oligonucleotide drugs, have been widely used due to their simple synthesis and high activity. Oligonucleotide drugs usually include antisense oligonucleotides (ASO), small interfering RNAs (siRNA), microRNAs (miRNA), and nucleic acid aptamers, etc.

[0003] Oligonucleotides are a class of short DNA or RNA molecules, oligomers, which can bind to their respective complementary oligonucleotides, DNA or RNA in a sequence-specific manner to form duplexes, or, although less common, in some cases form higher-order hybrids. Oligonucleotides can bind to complementary RNA strands in a sequence-specific manner, and after hybridization, they can induce RNase H to cleave the target RNA. In natural oligonucleotides, nucleotides are linked by phosphodiester bonds. Under physiological conditions, oligonucleotides are particularly sensitive to nucleases. Therefore, when preparing oligonucleotide drugs, natural, unmodified or unmodified oligonucleotides are easily degraded rapidly in vivo, so the activity that can be exerted is very limited, and thus the drug-likeness is poor. Modifying oligonucleotides is an effective way to improve their activity, which can improve their stability to nucleases, affinity for RNA, and can better promote endocytosis and tissue targeting in cells, thereby effectively regulating the expression of target genes.

[0004] The basic structure of nucleotides can generally be divided into four parts: base, ribose, phosphate backbone, and terminus. Modifications of these four parts are exemplified as follows:

[0005] 1) Modification of bases: It is mainly divided into three forms: purine modification, pyrimidine modification, and base substitution. Purine modifications include N6-methyladenosine, N1-methyladenosine, 7-methylguanylic acid modification; pyrimidine modifications include 3-methyluridine, 5-methyluridine, 5-methylcytidine, N4-acetylcytidine, pseudouridine, thiouridine, propynyluracil nucleoside, and dihydrouracil nucleoside, etc.

[0006] 2) Modification of ribose: It is mainly divided into the modification and substitution of groups at specific positions of the ribose ring, etc. Modifications of ribose include but are not limited to 2'-position modification, 4'-position modification, 5'-position modification, isomeric modification, etc. The most common modifications at the 2'-position of ribose are 2'-OMe (2'-methoxy) modification and 2'-F (2'-fluoro) modification. Compared with natural oligonucleotides, oligonucleotides modified with both 2'-OMe and 2'-F have higher Tm values, stronger serum stability, and better activity.

[0007] 3) Modification of the phosphate backbone: The main modification methods include, but are not limited to, the modification of phosphorothioates; the modification with methylphosphonates, selenophosphonates, boranophosphonates, dithiophosphonates, and the modification by replacing the bridging oxygen atom in the phosphodiester bond connection region with a sulfur atom; the entire replacement of the phosphate ester group between nucleosides with a group without a phosphorus atom, such as replacing the P atom with a C atom, an S atom, and an N atom, etc., so as to form guanidine groups, S-methylthiourea, or nitrate esters, etc.

[0008] 4) Terminal modification: including, but not limited to, covalently connecting specific groups to the 5'-end and / or 3'-end of the sense strand, phosphorylation modification of the 5'-end of the antisense strand, etc.

[0009] Lipoprotein(a) (Lp(a)) is a special type of lipoprotein particle discovered by immunological methods. It plays a role in the occurrence and development of cardiovascular diseases and is an important risk factor for cardiovascular diseases. Lp(a) consists of an LDL-like particle containing lipid components such as cholesterol and oxidized phospholipids (OxPL), apolipoprotein A (Apo(a)), and carrier protein B-100, etc. Among them, apolipoprotein B-100 is covalently bound to Apo(a). Apo(a) is a highly polymorphic glycoprotein encoded by the LPA gene.

[0010] Currently, it is believed that Lp(a) promotes the formation of atherosclerotic plaques in multiple ways. Epidemiological and genetic studies have shown that an elevated Lp(a) level is an independent risk factor for triggering cardiovascular diseases. Even when the LDL-C level is controlled within the optimal range specified by the current guidelines, the cardiovascular risk associated with Lp(a) still exists. Therefore, inhibiting the expression level of the LPA gene can reduce the risk of occurrence of atherosclerosis and its related cardiovascular events. Alternative therapies and combination therapies that can be used for patients with lipoprotein(a)-related diseases are clinically needed. Summary of the Invention

[0011] To solve the technical problem in the prior art that there is a lack of a more effective siRNA duplex for targeted regulation of LPA gene expression, the present disclosure provides an siRNA duplex for targeted regulation of LPA gene expression and its use in the prevention and treatment of cardiovascular and cerebrovascular related diseases. The present disclosure modifies the siRNA basic sequence, screens out multiple siRNA modifiers with significant inhibitory effects on LPA gene expression, and provides corresponding siRNA conjugates.

[0012] The technical solutions of the present disclosure include, but are not limited to:

[0013] On the one hand, the present disclosure provides an siRNA duplex, which comprises an oligonucleotide duplex formed by pairing of a sense strand and an antisense strand.

[0014] On the other hand, the present disclosure provides a conjugate for reducing the expression of LPA, which comprises the above siRNA duplex and a conjugating group linked thereto.

[0015] On the other hand, the present disclosure provides a nucleic acid-protein complex, which comprises the duplex region of the above siRNA duplex or the antisense strand of the duplex region, and a nuclease.

[0016] On the other hand, the present disclosure provides a recombinant vector, which comprises a nucleic acid molecule encoding the above siRNA duplex.

[0017] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNAs, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0018] On the other hand, the present disclosure provides a recombinant cell, which synthesizes and secretes the above siRNA duplex.

[0019] In some embodiments, the recombinant cell is selected from Rhodopseudomonas sulfidophila and ribonuclease III-deficient Corynebacterium glutamicum.

[0020] On the other hand, the present disclosure provides a method for preparing an siRNA duplex, which comprises culturing the above recombinant cell or chemical synthesis.

[0021] On the other hand, the present disclosure provides a pharmaceutical composition, which comprises the above siRNA duplex, the above conjugate, or the above nucleic acid-protein complex, and a pharmaceutically acceptable carrier.

[0022] On the other hand, the present disclosure provides a method for inhibiting the expression of the LPA gene, which comprises contacting the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition with a target cell.

[0023] In some embodiments, the method is for non-diagnostic or non-therapeutic purposes.

[0024] In some embodiments, the method is in vivo or in vitro.

[0025] On the other hand, the present disclosure provides an application of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition in the preparation of a drug for treating a disease related to the expression of the LPA gene.

[0026] The diseases related to LPA gene expression are selected from diseases caused by overexpression of Apo(a) protein, pathogenic mutations in the LPA gene, abnormal metabolism of Apo(a) protein, and abnormal interaction between LPA or Apo(a) and another substance.

[0027] In some embodiments, the diseases related to LPA gene expression are selected from Berger’s disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis and / or any other diseases associated with elevated levels of Lp(a) particles, as well as other related conditions, pathologies or syndromes that have not yet been identified.

[0028] On the other hand, the present disclosure provides an application of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition for treating diseases related to LPA gene expression.

[0029] On the other hand, the present disclosure provides a method for treating diseases related to LPA gene expression, comprising administering an effective amount of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition to a subject in need thereof.

[0030] On the other hand, the present disclosure provides an application of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition in the preparation of a medicament for preventing or treating atherosclerosis and cardio-cerebrovascular diseases.

[0031] On the other hand, the present disclosure provides an application of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition for preventing or treating atherosclerosis and cardio-cerebrovascular diseases.

[0032] On the other hand, the present disclosure provides a method for preventing or treating atherosclerosis and cardio-cerebrovascular diseases, comprising administering an effective amount of the above siRNA duplex, the above conjugate, the above nucleic acid-protein complex, or the above pharmaceutical composition to a subject in need thereof.

[0033] The beneficial effects achieved by the present disclosure are at least as follows:

[0034] (1) The siRNA basic sequences, such as siRNA B01001, B01023, B01042, B01047, B02417, B06001, B01801, B01012, all have significant inhibitory effects on the LPA gene, and the highest inhibition rate can exceed 50%.

[0035] (2) The inhibition rate of the siRNA modifiers of the present disclosure on the LPA gene can reach more than 70% at most. Moreover, after the modifier is conjugated with the GalNAc conjugation group to form the corresponding siRNA conjugate, it can be efficiently delivered to the animal liver and significantly inhibit the LPA gene, significantly reducing the serum Lp(a) protein level.

[0036] (3) For each sequence modified by the alternating modification and the modification template of the present disclosure, compared with the siRNA with very small differences from the sequences disclosed in the prior art, the inhibitory activity on LPA is significantly improved, and can be increased by up to 36.0%. BRIEF DESCRIPTION OF THE DRAWINGS

[0037] In order to more clearly illustrate the technical solutions of the embodiments of the present disclosure, the accompanying drawings of the embodiments will be briefly introduced below. Obviously, the accompanying drawings in the following description are only used to exemplarily illustrate some examples of the present disclosure, rather than limiting the present disclosure.

[0038] Figure 1 Showing the inhibitory effects of siRNA B01023, B02417, and B01801 on the expression level of Lp(a) protein in the serum of cynomolgus monkeys after being respectively modified by the template modification and the off-target prevention modification and conjugated with the GalNAc conjugation group ((relative to D-3 before administration) -1 mg / kg).

[0039] Figure 2 Showing the inhibitory effects of siRNA B01023, B02417, and B01801 on the mRNA expression level of the LPA gene in the liver tissue of cynomolgus monkeys after being respectively modified by the template modification and the off-target prevention modification and conjugated with the GalNAc conjugation group ((relative to D-9 before administration) -1 mg / kg). DETAILED DESCRIPTION OF THE EMBODIMENTS

[0040] To make the present disclosure easier to understand, certain terms are first defined. In addition, it should be noted that whenever a value or a range of values of a parameter is listed, the purpose is to indicate that the intermediate values and ranges of these cited values are also intended to be part of the present disclosure.

[0041] As used herein, the articles "a" and "an" refer to one or more than one (i.e., at least one) of the grammatical objects of the article. By way of example, "an element" refers to one element or more than one element, such as a plurality of elements.

[0042] The term "including" as used herein means the phrase "including but not limited to" and is used interchangeably therewith.

[0043] The term "or" as used herein means the term "and / or" and is used interchangeably therewith, unless the context clearly indicates otherwise.

[0044] As used herein, the term "about" or "approximate" as applied to one or more target values refers to a value similar to the reference value. In certain embodiments, unless otherwise stated or otherwise apparent from the context, the term "approximate" or "about" refers to a range of values that fall within 20%, 19%, 18%, 17%, 16%, 15%, 14%, 13%, 12%, 11%, 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1% or less of the reference value in either direction (greater than or less than) (unless such numbers would exceed 100% of the possible values).

[0045] As used herein, "LPA" refers to the coding gene for apolipoprotein A or the protein expressed by that gene.

[0046] The term "LPA gene" can be a wild-type LPA gene or an LPA gene mutant with a sequence variation. Many sequence variations in the LPA gene have been identified and can be found, for example, in NCBI dbSNP and UniProt (see, e.g., ncbi.nlm.nih.gov / snp).

[0047] Each of “G”, “C”, “A”, and “U” typically represents a nucleotide containing guanine, cytosine, adenine, and uracil as bases, respectively. “T” and “dT” are used interchangeably herein and refer to a deoxyribonucleotide in which the nucleobase is thymine, such as deoxyribothymine, 2'-deoxythymidine, or thymidine. However, it should be understood that the terms “ribonucleotide” or “nucleotide” or “deoxyribonucleotide” may also refer to a modified nucleotide (as further described below) or an alternative substitution moiety. One skilled in the art will be well aware that guanine, cytosine, adenine, and uracil can be replaced by other moieties with substantially no change in the base pairing properties of an oligonucleotide (including a nucleotide having such a substitution moiety). For example, without limitation, a nucleotide containing inosine as its base can pair with a nucleotide containing adenine, cytosine, or uracil. Thus, a nucleotide containing uracil, guanine, or adenine can be replaced in the nucleotide sequences of the present disclosure by a nucleotide containing, for example, inosine. Sequences containing such substitution moieties are applicable to, including but not limited to, the double-stranded ribonucleic acids, double-stranded ribonucleic acid modifiers, double-stranded ribonucleic acid conjugates, pharmaceutical compositions, and methods of the present disclosure.

[0048] The terms “complementary”, “fully complementary”, and “substantially complementary” may be used herein to refer to base pairing between the sense and antisense strands of an siRNA, or between the antisense strand of an siRNA and a target sequence, as can be understood from the context in which they are used. In some embodiments herein, if a first nucleotide sequence exhibits at least 70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 98%, or 99% sequence complementarity with a second nucleotide sequence, the first nucleotide sequence may be considered complementary to the second nucleotide sequence. In an exemplary embodiment, 18 out of 20 nucleobases of the first nucleotide sequence pair with the corresponding region of the second nucleotide sequence, achieving 90% complementarity.

[0049] The terms “double-stranded ribonucleic acid”, “double-stranded RNA (dsRNA) molecule”, “dsRNA”, “ribonucleic acid duplex” may be used interchangeably and specifically refer to a complex of ribonucleic acid molecules having a double-stranded structure, comprising two anti-parallel, complementary or substantially complementary nucleic acid strands, having “sense” and “antisense” orientations relative to a target gene, such as the LPA gene. In some embodiments, the double-stranded ribonucleic acid (dsRNA) triggers the degradation of a target RNA, such as mRNA, by a post-transcriptional gene silencing mechanism (referred to herein as RNA interference or RNAi). Herein, in some cases, “siRNA duplex” also typically refers to the technical meaning indicated by the above definition.

[0050] As is well known in the art, the terms "siRNA duplex", "double-stranded RNAi agent", "RNAi agent", "small interfering ribonucleic acid", or "siRNA" refer to small interfering ribonucleic acid RNAi molecules. It is a class of double-stranded RNA molecules, also known as short interfering RNA or silencing RNA in the art. siRNA typically comprises a sense strand (also known as the passenger strand) and an antisense strand (also known as the guide strand), wherein each strand has a length of 17 to 30 nucleotides, typically a length of 19 to 25 nucleotides, wherein the antisense strand is complementary to the target nucleic acid (suitably a mature mRNA sequence) (such as at least 95% complementary, such as fully complementary), and the sense strand is complementary to the antisense strand such that the sense strand and the antisense strand form a duplex or duplex region. The sense and antisense strands of siRNA can form blunt-ended duplexes, or can form duplexes containing 3′ overhangs, which can be, for example, 1, 2, or 3 nucleotides in length, similar to the products produced by Dicer, and can form RISC substrates in vivo. Effective extended forms of Dicer substrates have been described in US 8349809 and US 8513207, which are incorporated herein by reference. In some embodiments, both the sense and antisense strands have 3′ overhangs that are 2 nucleotides in length. Thus, the length of the duplex region can be, for example, 17, 18, 19, 20, 21, 22, 23, 24, or 25 nucleotides, such as a length of 19, 20, 21, 22, or 23 nucleotides.

[0051] Also, in the present text, "siRNA" also refers to "basic sequence" in some cases. In the present text, "basic sequence" specifically refers to an siRNA duplex in which each nucleotide in the double-stranded ribonucleic acid is an unmodified nucleotide, and also appears as "motif", "siRNA motif", etc. throughout the text. Thus, in the present text, "siRNA", "basic sequence", "motif", "siRNA motif" can be used interchangeably, and their meanings also include the corresponding nucleotide arrangement order of the siRNA duplexes they refer to. In the present text, those skilled in the art can clearly understand their exact technical meanings according to the technical meanings of the context. In addition, the 5′-terminal nucleotide of the antisense strand of the motif may be linked to a 5′ phosphate group or a 5′ phosphate-derived group or may not be linked to a 5′ phosphate group or a 5′ phosphate-derived group.

[0052] As used herein, "siRNA modifier" refers to a double-stranded ribonucleic acid containing at least one modified nucleotide, and in some cases, also appears as "double-stranded ribonucleic acid modifier". In this article, the siRNA motif is modified in different ways to prepare the corresponding siRNA modifier. For example, in some embodiments, the motif is modified by an alternating modification method to obtain an alternately modified siRNA modifier. In other embodiments, the motif is modified by a modification method using a specific modification template to obtain a siRNA modifier modified with a specific modification template. In still other embodiments, the motif is modified by the off-target prevention modification method described herein to obtain an off-target prevention modified siRNA modifier. In some cases, multiple different modification methods can be used simultaneously to modify the same siRNA motif, thereby obtaining a corresponding siRNA modifier with multiple modification methods.

[0053] As used herein, "siRNA conjugate" refers to a double-stranded ribonucleic acid conjugate or a conjugate of a double-stranded ribonucleic acid modifier obtained by conjugating a conjugating group to a double-stranded ribonucleic acid or a double-stranded ribonucleic acid modifier. Preferably, "siRNA conjugate" refers to a conjugate of a double-stranded ribonucleic acid modifier.

[0054] In some cases herein, "siRNA" not only refers to the unmodified siRNA duplex (or siRNA motif) described above, but may also refer to its corresponding siRNA modifier and / or siRNA conjugate. For example, in contexts involving, but not limited to, treatment methods, therapeutic agents, etc., siRNA generally refers to at least one of siRNA motif, siRNA modifier, and / or siRNA conjugate. For those skilled in the art, the specific technical meaning can be clearly understood in combination with the context.

[0055] The term "antisense strand" refers to the strand of a double-stranded ribonucleic acid (such as the RNA duplex herein) that includes a region substantially complementary to the target sequence. As used herein, the term "complementary region" refers to the region on the antisense strand that is substantially complementary to the sequence defined herein (such as the target sequence). When the complementary region is not completely complementary to the target sequence, the mismatch can be in the internal or terminal region of the molecule. Generally, the most tolerated mismatches are in the terminal region, for example, within 5, 4, 3, 2, or 1 nucleotide at the 5' and / or 3' ends.

[0056] The term "sense strand" as used herein refers to the strand of a double-stranded ribonucleic acid that includes a region substantially complementary to the region of the antisense strand (as defined by this term herein).

[0057] The term "alternating modification" refers to a modification method in which nucleotides are respectively modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F) according to the nucleotide sequence of double-stranded ribonucleic acid. For example, for the antisense strand of siRNA, the odd positions (i.e., the 1st, 3rd, 5th, 7th, 11th, 13th, 15th, 17th, 19th, 21st, 23rd positions) are modified with 2'-methoxy, and the even positions (i.e., the 2nd, 4th, 6th, 8th, 10th, 12th, 14th, 16th, 18th, 20th, 22nd positions) are modified with 2'-fluoro. For the sense strand complementary to this antisense strand, the corresponding positions modified with 2'-methoxy on the antisense strand are modified with 2'-fluoro; at the positions where 2'-fluoro modification is used on the antisense strand, 2'-methoxy modification is used at the complementary pairing positions on the sense strand.

[0058] For RNA interference (RNAi), the inhibition of the target gene is achieved by the AGO2 protein loading the antisense strand of siRNA and forming a silencing complex (RISC) to cleave the gene transcript mRNA. The loading of the silencing complex (RISC) requires phosphorylation (5'-phosphate) of the 5' end of the antisense strand. The occurrence of 5' end phosphorylation can be naturally completed in cells by the subunit 1 of cleavage and polyadenylation factor I (Clp1), or can be achieved by chemical synthesis. The term "natural 5' end phosphorylation" or "simple and direct 5' end phosphorylation" refers to the phosphorylation of the 5' end of the siRNA antisense strand being completed in the intracellular environment rather than by chemical synthesis.

[0059] In this article, the "conjugation group" is a GalNAc derivative attached to an oligonucleotide. In some cases, the conjugation group includes a targeting group (which can also be called a ligand), and optionally also includes a linker, such as a GalNAc derivative linked to an oligonucleotide through a linker (such as a divalent, trivalent or tetravalent branched linker), and also such as a GalNAc derivative attached to an oligonucleotide through a monovalent linker. In most cases, both "ligand" and "conjugation group" have meanings well-known in the art.

[0060] The term "inhibition" as used herein can be used interchangeably with "reduction", "silencing", "downregulation", "suppression" and other similar terms, and includes any level of inhibition. In this article, in some cases, the meaning referred to by "regulation" is "inhibition", and those skilled in the art can clearly understand its specific meaning according to the context.

[0061] As used herein, the phrase "inhibiting the expression of LPA" includes inhibiting the expression of any LPA gene (such as, for example, a murine LPA gene, a rat LPA gene, a simian LPA gene, or a human LPA gene) as well as variants (such as naturally occurring variants) or mutants of the LPA gene. Thus, the LPA gene can be a wild-type LPA gene, a mutant LPA gene, or a transgenic LPA gene in the case of a genetically engineered cell, cell population, or organism.

[0062] "Inhibiting LPA gene expression" includes inhibition of the LPA gene at any level, such as at least partial inhibition of the expression of the LPA gene, such as inhibition of at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99%.

[0063] The expression of the LPA gene can be evaluated based on any variable level related to LPA gene expression, such as LPA mRNA level or LPA protein level. The inhibition can be evaluated by a decrease in the absolute or relative level of one or more of these variables compared to a control level. The control level can be any type of control level utilized in the art, such as a pre-dose baseline level or a level determined from a similar untreated or control (such as a buffer-only control or an inert agent control) - treated subject, cell, or sample.

[0064] In this document, in some cases, "regulating" can have the same meaning as "inhibiting"; accordingly, "regulating LPA gene expression" can mean "inhibiting LPA gene expression". For those skilled in the art, the specific technical meaning will be clear in the context.

[0065] As used herein, "patient" or "subject" is intended to include human or non - human animals, preferably mammals, such as monkeys. More preferably, the subject or patient is a human.

[0066] As used herein, "LPA-related disease" is intended to include any disease associated with the LPA gene or protein. Such a disease can be caused, for example, by overproduction of the LPA protein, by LPA gene mutations, by abnormal cleavage of the LPA protein, by abnormal interactions between LPA and other proteins or other endogenous or exogenous substances. Exemplary LPA-related diseases include Burger's disease, peripheral artery disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapolipoprotein beta-lipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis and / or any other disease associated with elevated levels of Lp(a) particles and other yet-to-be-identified related conditions, pathologies or syndromes.

[0067] As used herein, "therapeutically effective amount" is intended to include the amount of an RNAi agent that is sufficient to effect the treatment of a LPA-related disease (e.g., by attenuating, ameliorating or maintaining the existing disease or one or more symptoms of the disease) when administered to a patient for treating such a disease. The "therapeutically effective amount" can vary depending on the RNAi agent, how the agent is administered, the disease and its severity, and medical history, age, weight, family history, genetic makeup, stage of the pathological process mediated by LPA expression, type of previous or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0068] As used herein, "preventively effective amount" refers to the amount of an RNAi agent that is sufficient to prevent or ameliorate a LPA-related disease or one or more symptoms of the disease when administered to a subject who has not yet experienced or exhibited symptoms of a LPA-related disease but is likely to be susceptible to the disease. Ameliorating the disease includes slowing the progression of the disease or reducing the severity of subsequent disease. The "preventively effective amount" can vary depending on the RNAi agent, how the agent is administered, the degree of risk of the disease, and medical history, age, weight, family history, genetic makeup, type of previous or concomitant treatment (if any), and other individual characteristics of the patient to be treated.

[0069] A "therapeutically effective amount" or "preventively effective amount" also includes the amount of an RNAi agent that produces some desired local or systemic effect at a reasonable benefit / risk ratio applicable to any treatment. The RNAi agent used in the methods of the present disclosure can be administered in an amount sufficient to produce a reasonable benefit / risk ratio applicable to such treatment.

[0070] As used herein, the term "sample" includes similar fluids, cells, or tissues isolated from a subject, as well as a collection of fluids, cells, or tissues present in a subject. Examples of biological fluids include blood, serum and serous fluid, plasma, cerebrospinal fluid, ocular fluid, lymph, urine, saliva, and the like. Tissue samples can include samples from tissues, organs, or local regions. For example, a sample can be derived from a specific organ, an organ part, or the fluids or cells within these organs. In certain embodiments, the sample can be derived from the liver (e.g., the whole liver or certain segments of the liver, or certain types of cells in the liver, e.g., hepatocytes). In a preferred embodiment, a "sample derived from a subject" refers to blood or plasma drawn from the subject. In other embodiments, a "sample derived from a subject" refers to liver tissue (or its subcomponents) derived from the subject.

[0071] As used herein, unless otherwise specified, when referring to any nucleotide position of any strand of an siRNA motif, siRNA modifier, siRNA conjugate, siRNA duplex, etc., it means in the 5' to 3' direction.

[0072] In one aspect, the present disclosure provides an siRNA duplex comprising a sense strand and an antisense strand that form an inverted complementary double-stranded region, wherein the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof that are complementary to a target sequence having a nucleotide sequence as shown in SEQ ID NO: 184, SEQ ID NO: 76, SEQ ID NO: 132, SEQ ID NO: 419 (AUGGUAAUGGACAGAGUU), or SEQ ID NO: 420 (GACAGAGUUAUCAAGGCA).

[0073] The target sequence is derived from Homo sapiens lipoprotein(a) (LPA), mRNA with accession number NM_005577.4 in the NCBI database.

[0074] In some embodiments, the antisense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide fragments or modified fragments thereof in a sequence as shown in any one of SEQ ID NO: 194, 214, 232, 237, 269, 325, 377, and 379.

[0075] In some embodiments, the length of the inverted complementary double-stranded region is 17 - 21 bp, such as 20 or 21 bp.

[0076] In some embodiments, the sense strand comprises at least 15, 16, 17, 18, or 19 consecutive nucleotide segments or modified segments thereof from the sequences shown in any of SEQ ID NO: 1, 21, 39, 44, 76, 132, 184, and 186.

[0077] In some embodiments, the lengths of the sense strand and the antisense strand independently comprise 19 - 23 nucleotides; preferably, the sense strand comprises 19 - 21 nucleotides and the antisense strand comprises 21 - 23 nucleotides.

[0078] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by pairing the following sense strands and antisense strands, and optionally, each of the sense strand and the antisense strand independently comprises at least one modified nucleotide:

[0079] (1) The sense strand has the sequence shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or its fragment;

[0080] (2) The sense strand has the sequence shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or its fragment;

[0081] (3) The sense strand has the sequence shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or its fragment;

[0082] (4) The sense strand has the sequence shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence of the sequence or its fragment;

[0083] (5) The sense strand has the sequence shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or its fragment;

[0084] (6) The sense strand has a sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of said sequence or its fragment;

[0085] (7) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of said sequence or its fragment;

[0086] (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of said sequence or its fragment.

[0087] In some embodiments, the siRNA duplex is an RNAi agent for inhibiting LPA gene expression.

[0088] In some embodiments, the sense strand differs from any one of the sequences of SEQ ID NO: 1, 21, 39, 44, 76, 132, 184, and 186 by 1 - 3 nucleotides.

[0089] In some embodiments, the antisense strand differs from any one of the sequences of SEQ ID NO: 194, 214, 232, 237, 269, 325, 377, and 379 by 1 - 3 nucleotides.

[0090] In some embodiments, the number of nucleotides in the sense strand is the same as or different from the number of nucleotides in the antisense strand.

[0091] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 19 nucleotides.

[0092] In some embodiments, the sense strand has 19 nucleotides and the antisense strand has 21 nucleotides.

[0093] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 20 nucleotides.

[0094] In some embodiments, the sense strand has 20 nucleotides and the antisense strand has 22 nucleotides.

[0095] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 21 nucleotides.

[0096] In some embodiments, the sense strand has 21 nucleotides and the antisense strand has 23 nucleotides.

[0097] In some embodiments, the sense strand has 23 nucleotides and the antisense strand has 23 nucleotides.

[0098] In some embodiments, the sense strand and the antisense strand each independently comprise at least one modified nucleotide.

[0099] In some embodiments, at least one modified nucleotide is selected from any one or a combination of at least two of the group consisting of: deoxynucleotide, 3'-terminal deoxythymidine (dT) nucleotide, 2'-O-methyl modified nucleotide, 2'-fluoro modified nucleotide, 2'-deoxy modified nucleotide, locked nucleic acid, unlocked nucleic acid, conformationally restricted nucleotide, restricted ethyl nucleotide, abasic nucleotide, 2'-amino modified nucleotide, 2'-O-allyl modified nucleotide, 2'-C-alkyl modified nucleotide, 2'-hydroxy modified nucleotide, 2'-methoxyethyl modified nucleotide, 2'-O-alkyl modified nucleotide, morpholino nucleotide, phosphoramidate, nucleotide containing unnatural base, tetrahydropyran modified nucleotide, 1,5-anhydrohexitol modified nucleotide, cyclohexenyl modified nucleotide, nucleotide containing phosphorothioate group, nucleotide containing methylphosphonate group, nucleotide containing 5'-phosphate, and nucleotide containing 5'-phosphate mimic.

[0100] In some embodiments, at least one strand comprises a 3'-overhang of at least 1 nucleotide.

[0101] In some embodiments, at least one strand comprises a 3'-overhang of at least 2 nucleotides.

[0102] In some embodiments, all nucleotides on the sense strand and the antisense strand are modified in a manner of modification at the 2'-position of the nucleotide ribose.

[0103] In some embodiments, the modification at the 2'-position of the nucleotide ribose is selected from any one or a combination of several of 2'-methoxy modification, 2'-methoxyethyl modification, 2'-fluoro modification, 2'-benzyloxy modification, 2'-methylcarbonylamino modification, and 2'-pyridinemethoxy modification.

[0104] In some embodiments, the modification at the 2'-position of each nucleotide ribose is selected from the combination of 2'-methoxy modification and 2'-fluoro modification.

[0105] In some embodiments, the modification at the 2'-position of each nucleotide ribose is selected from the alternating combination of 2'-methoxy modification and 2'-fluoro modification.

[0106] In some embodiments, the modification of the 2'-position of each nucleotide ribose is as follows: the odd positions of the sense strand are all 2'-fluoro modifications, and the even positions are all 2'-methoxy modifications; and the odd positions of the antisense strand are all 2'-methoxy modifications, and the even positions are all 2'-fluoro modifications.

[0107] In some embodiments, the nucleotides are connected to each other by 3',5'-phosphodiester bonds.

[0108] In some embodiments, the nucleotides are connected to each other by 3',5'-thiophosphodiester bonds.

[0109] In some embodiments, the aforementioned oligonucleotides have alternating fluorine-oxygen modifications or template modifications.

[0110] In some embodiments, the antisense strand of the siRNA modifier has any one of the modification modes A to F shown below:

[0111]

[0112]

[0113] And / or, the sense strand has any one of the following modification modes a or b:

[0114]

[0115] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS represents that starting from the 5'-end, the nucleotide at this position is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphate ester bond; EVP represents 5'-vinyl-(E)-phosphonate.

[0116] In some embodiments, the antisense strand is modified with modification mode A, and the sense strand is modified with modification mode a.

[0117] In some embodiments, the antisense strand is modified with modification mode B, and the sense strand is modified with modification mode a.

[0118] In some embodiments, the antisense strand is modified with modification mode C, and the sense strand is modified with modification mode a.

[0119] In some embodiments, the antisense strand is modified with modification mode D, and the sense strand is modified with modification mode a.

[0120] In some embodiments, the antisense strand is modified with modification mode E, and the sense strand is modified with modification mode a.

[0121] In some embodiments, the antisense strand is modified with modification mode F, and the sense strand is modified with modification mode a.

[0122] In some embodiments, the antisense strand is modified with modification A, and the sense strand is modified with modification b.

[0123] In some embodiments, the antisense strand is modified with modification B, and the sense strand is modified with modification b.

[0124] In some embodiments, the antisense strand is modified with modification C, and the sense strand is modified with modification b.

[0125] In some embodiments, the antisense strand is modified with modification D, and the sense strand is modified with modification b.

[0126] In some embodiments, the antisense strand is modified with modification E, and the sense strand is modified with modification b.

[0127] In some embodiments, the antisense strand is modified with modification F, and the sense strand is modified with modification b.

[0128] In some embodiments, the antisense strand of the siRNA modifier has any one of the following modification modes A' to F':

[0129]

[0130] And / or, the sense strand is modified with modification a' or b':

[0131]

[0132] Wherein, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS represents that starting from the 5' end, the nucleotide at this position is connected to the adjacent nucleotide on its right by a 3',5'-thiophosphoric acid ester bond; EVP represents 5'-vinyl-(E)-phosphonate.

[0133] In some embodiments, the antisense strand is modified with modification A', and the sense strand is modified with modification a'.

[0134] In some embodiments, the antisense strand is modified with modification B', and the sense strand is modified with modification a'.

[0135] In some embodiments, the antisense strand is modified with modification C', and the sense strand is modified with modification a'.

[0136] In some embodiments, the antisense strand is modified with modification D', and the sense strand is modified with modification a'.

[0137] In some embodiments, the antisense strand is modified with modification E', and the sense strand is modified with modification a'.

[0138] In some embodiments, the antisense strand is modified with modification F', and the sense strand is modified with modification a'.

[0139] In some embodiments, the antisense strand is modified with modification A', and the sense strand is modified with modification b'.

[0140] In some embodiments, the antisense strand is modified with modification B', and the sense strand is modified with modification b'.

[0141] In some embodiments, the antisense strand is modified with modification C', and the sense strand is modified with modification b'.

[0142] In some embodiments, the antisense strand is modified with modification D', and the sense strand is modified with modification b'.

[0143] In some embodiments, the antisense strand is modified with modification E', and the sense strand is modified with modification b'.

[0144] In some embodiments, the antisense strand is modified with modification F', and the sense strand is modified with modification b'.

[0145] In some embodiments, each of the nucleotides at positions 2 to 8 from the 5'-end of the antisense strand is independently a modified nucleotide, and the modified nucleotide is UNA or GNA, or each of the nucleotides at positions 2 to 8 from the 5'-end of the antisense strand is independently DNA, where the structures of UNA and GNA are as follows:

[0146] ;

[0147] Wherein, the base is selected from any one of adenine, guanine, cytosine, thymine and uracil.

[0148] In some embodiments, the phosphorylation of the 5'-carbon atom of the nucleotide glycoside at the 5'-end of the modified antisense strand includes, but is not limited to, the following 5'-phosphorylation groups: 5'-vinyl phosphonate group (5'-E-VP), 5'-methyl phosphonate group (5'-MP), 5'-C-methyl phosphate group, 5'-thiophosphate group (5'-PS) and 5'-phosphate group (5'-P), and the structures of the modified nucleotides are as follows:

[0149] ;

[0150] Wherein, R is hydrogen, hydroxyl group, amino group, C 1-4 alkyl, aryl, C1-4 an alkoxy group, C 1-4 alkylcarbonylamino or a halogen;

[0151] The base is selected from any one of adenine, guanine, cytosine, thymine, and uracil.

[0152] In some embodiments, a 3′,5′-phosphorothioate bond is formed between the 3′-end and / or the 1st to 2nd nucleotides at the 5′-end of the sense strand and / or the antisense strand of the siRNA modifier. For example, in some embodiments, a chirally pure 3′,5′-phosphorothioate bond is formed. In some embodiments, there may be 1, 2, or 3 3′,5′-phosphorothioate bonds between the 1st to 4th nucleotides starting from the 5′-end of the sense strand and / or the antisense strand, and there may be 1, 2, or 3 3′,5′-phosphorothioate bonds between the 1st to 4th nucleotides starting from the 3′-end of the antisense strand.

[0153] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by pairing the following sense strands and antisense strands:

[0154] (1) The sense strand has the sequence shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand adopts modification method B and the sense strand adopts modification method a;

[0155] (2) The sense strand has the sequence shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand adopts modification method A and the sense strand adopts modification method a;

[0156] (3) The sense strand has the sequence shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand adopts modification method C′ and the sense strand adopts modification method a′;

[0157] (4) The sense strand has a sequence as shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method C', and the sense strand adopts modification method b';

[0158] (5) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method E, and the sense strand adopts modification method b;

[0159] (6) The sense strand has a sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method B, and the sense strand adopts modification method a;

[0160] (7) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method C, and the sense strand adopts modification method a;

[0161] (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method E, and the sense strand adopts modification method b;

[0162] (9) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification method A, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA;

[0163] The sense strand has the sequence shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand adopts modification method C, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA;

[0164] The sense strand has the sequence shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand adopts modification method E, and the sense strand adopts modification method b; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA.

[0165] The present disclosure provides an siRNA conjugate, which comprises an siRNA duplex as described in the present disclosure and a conjugating group linked to the siRNA duplex.

[0166] The double-stranded ribonucleic acid and double-stranded ribonucleic acid modifier of the present disclosure can optionally be linked to one or more conjugating groups. The conjugating group can be attached to the sense strand, antisense strand or both strands at the 3'-end, 5'-end or both ends. For example, the conjugating group can be linked to the sense strand. In a preferred embodiment, the conjugating group is linked at the 3'-end of the sense strand. In one embodiment, the conjugating group has an arbitrary GalNAc structure.

[0167] In some embodiments, the conjugating group is linked at the 3'-end or 5'-end of the nucleotide sense strand.

[0168] In some embodiments, the conjugating group is one or more GalNAc derivatives attached using a divalent or trivalent branched linker arm.

[0169] Typically, the conjugating group comprises at least one pharmaceutically acceptable targeting group, or further comprises a linker, and the siRNA, the linker, and the targeting group are connected in sequence. In some embodiments, the number of targeting groups is 1-6. In some embodiments, the number of targeting groups is 2-4. In some embodiments, the number of targeting groups is 3. The conjugating group can be connected to the siRNA molecule covalently or non-covalently, and the connection site can be at the 3'-end or 5'-end of the sense strand of the siRNA, or at the 5'-end of the antisense strand, or also in the internal sequence of the siRNA. In some embodiments, the connection site is at the 3'-end of the sense strand of the siRNA.

[0170] In some embodiments, the pharmaceutically acceptable targeting group can be a conventional ligand in the field of siRNA administration, such as the various ligands described in WO2009082607A2, which is incorporated herein by reference in its entirety.

[0171] In some embodiments, each ligand is independently selected from a ligand capable of binding to a cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a mammalian cell surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to a human hepatocyte surface receptor. In some embodiments, at least one ligand is a ligand capable of binding to the asialoglycoprotein receptor (ASGPR) on the liver surface. The types of these ligands are well-known to those skilled in the art, and their general function is to bind to specific receptors on the surface of target cells and mediate the delivery of siRNA linked to the ligand to the target cells.

[0172] In some embodiments, the pharmaceutically acceptable targeting group in the siRNA conjugate can be galactose or N-acetylgalactosamine, wherein the galactose or N-acetylgalactosamine molecule can be monovalent, divalent, trivalent, or tetravalent. That is, after the siRNA molecule forms an siRNA conjugate with a conjugating group containing galactose or N-acetylgalactosamine as the targeting group, the molar ratio of the siRNA molecule to the galactose or N-acetylgalactosamine molecule in the siRNA conjugate is 1:1, 1:2, 1:3, or 1:4. In some embodiments, when the siRNA is connected to a conjugating group containing N-acetylgalactosamine, the N-acetylgalactosamine molecule is trivalent.

[0173] The targeting group can be linked to the siRNA molecule via a suitable linker, and those skilled in the art can select a suitable linker according to the specific type of the targeting group. For the types of these linkers, targeting groups and the linking manner with the siRNA, reference can be made to the disclosure of WO2015006740A2, which is incorporated herein by reference in its entirety.

[0174] In some embodiments, the structure of the conjugating group is, for example:

[0175] ,

[0176] wherein X is a hydroxyl protecting group or H, and the hydroxyl protecting group is selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, and the amine protecting group is selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer from 0 to 20; and q, r and s are each independently an integer from 1 to 7.

[0177] In some embodiments, the structure of the conjugating group is, for example:

[0178] .

[0179] In some embodiments, the conjugating group is, for example:

[0180]

[0181] wherein X is oxygen, -N(Y)- or sulfur;

[0182] Y is C 1-4 alkyl or C 6-10 aryl;

[0183] R 1 is oxygen or sulfur;

[0184] R 2 is hydrogen, -NH 2 , C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy or halogen;

[0185] A is -(CH 2 ) a -, -(CH 2 CH 2 O) b -, -((CH 2 ) c NHCO) d - or -((CH 2 ) c CONH) d-, where a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0186] B is -(CH 2 ) e -, where e is an integer from 0 to 7;

[0187] L is -CONH- or -NHCO-;

[0188] X 1 is -(CH 2 ) f -, or -(CH 2 CH 2 O) f CH 2 -, and f is an integer from 1 to 5;

[0189] X 2 is -(CH 2 ) g -, and g is an integer from 1 to 6;

[0190] X 3 is oxygen or sulfur;

[0191] Y 1 is 0 or 1;

[0192] Y 2 is 0, 1, or 2;

[0193] When Y 3 is 1, X 4 is CH 2 ; When Y 3 is 2, X 4 is CH; When Y 3 is 3, X 3 is carbon;

[0194] m is an integer from 0 to 4;

[0195] n is an integer from 0 to 4.

[0196] In some embodiments, the conjugating group has, for example, any of the following structures:

[0197] ,

[0198] ,

[0199] , or

[0200] .

[0201] In some embodiments, the siRNA conjugates of the present disclosure can have any of the following structures:

[0202] ,

[0203] ,

[0204] ,

[0205] , or

[0206] .

[0207] In some embodiments, the conjugating group has, for example, the following structure:

[0208]

[0209] wherein X is oxygen, -N(Y)- or sulfur;

[0210] Y is C 1-4 alkyl or C 6-10 aryl;

[0211] R 1 is oxygen or sulfur;

[0212] R 2 is hydrogen, -NH 2 , C 1-4 alkyl, C 6-10 aryl, C 1-4 alkoxy or halogen;

[0213] A is -(CH 2 ) a -, -(CH 2 CH 2 O) b -, -((CH 2 ) c NHCO) d -, or -((CH 2 ) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5;

[0214] B is -(CH 2 ) e -, wherein e is an integer from 0 to 7;

[0215] L is -CONH- or -NHCO-;

[0216] X 1 is -(CH2 ) f - or -(CH 2 CH 2 O) f CH 2 -, where f is an integer from 1 to 5;

[0217] X 2 is -(CH 2 ) g -, where g is an integer from 1 to 6;

[0218] X 3 is oxygen or sulfur;

[0219] Y 1 is 0 or 1;

[0220] Y 2 is 0, 1 or 2;

[0221] When Y 3 is 1, X 4 is CH 2 ; When Y 3 is 2, X 4 is CH; When Y 3 is 3, X 3 is carbon;

[0222] m is an integer from 0 to 4;

[0223] n is an integer from 0 to 4;

[0224] q is an integer from 0 to 4.

[0225] In some embodiments, the conjugating group, for example, has any of the following structures:

[0226] , , , , or .

[0227] In some embodiments, the siRNA conjugate of the present disclosure, for example, has any of the following structures:

[0228] ,

[0229] ,

[0230] ,

[0231] , or

[0232] .

[0233] In some embodiments, the siRNA duplex comprises any one or a combination of at least two of the oligonucleotide duplexes formed by pairing of a sense strand and an antisense strand selected from the following:

[0234] (1) The sense strand has the sequence shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method B and the sense strand is modified by modification method a;

[0235] (2) The sense strand has the sequence shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method A and the sense strand is modified by modification method a;

[0236] (3) The sense strand has the sequence shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method C' and the sense strand is modified by modification method a';

[0237] (4) The sense strand has the sequence shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method C' and the sense strand is modified by modification method b';

[0238] (5) The sense strand has the sequence shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method E and the sense strand is modified by modification method b;

[0239] (6) The sense strand has the sequence shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of the sequence or its fragment; and the antisense strand has the sequence shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of the sequence or its fragment; wherein the antisense strand is modified by modification method B and the sense strand is modified by modification method a;

[0240] (7) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification mode C and the sense strand adopts modification mode a;

[0241] (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification mode E and the sense strand adopts modification mode b;

[0242] (9) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification mode A and the sense strand adopts modification mode a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA;

[0243] (10) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification mode C and the sense strand adopts modification mode a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA;

[0244] (11) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of said sequence or its fragment; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of said sequence or its fragment; wherein the antisense strand adopts modification mode E and the sense strand adopts modification mode b; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA;

[0245] Wherein, either or both of the sense strand and the antisense strand can be linked to the conjugating groups G4, G5, G6, G7, G101, G102, G103, G105 or G106.

[0246] In some embodiments, either or both of the sense strand and the antisense strand are linked to a conjugating group G101.

[0247] In some embodiments, the conjugating group is linked to the 3'-end of the sense strand.

[0248] The present disclosure also provides a nucleic acid-protein complex, which comprises the double-stranded region of the aforementioned double-stranded RNAi agent or siRNA conjugate, or the antisense strand of the double-stranded region, and a nuclease.

[0249] In the present disclosure, the term "nucleic acid-protein complex" refers to that siRNA binds to the Argonaute protein (AGO) to form an RNA-induced silencing complex (RISC). Subsequently, the siRNA is unwound into a sense strand and an antisense strand. The sense strand is degraded, and the antisense strand (guide strand) of RISC binds to the target mRNA homologous to the siRNA through base pairing. RISC has the function of a nuclease, and the siRNA guides RISC to cleave the homologous single-stranded mRNA, resulting in the loss of function of the mRNA, that is, it cannot be translated into a protein, which means "silencing" the gene.

[0250] The present disclosure also provides a recombinant vector, which comprises a nucleic acid molecule encoding the siRNA as disclosed.

[0251] In some embodiments, the vector backbone of the recombinant vector is selected from recombinant viroid-derived circular RNA vectors, tRNA, rRNA scaffolds, and chimeric tRNA / pre-miRNA vectors.

[0252] The present disclosure also provides a recombinant cell, which comprises the aforementioned siRNA or recombinant vector.

[0253] In some embodiments, the recombinant cell is selected from Rhodopseudomonas sulfidophila and Corynebacterium glutamicum deficient in ribonuclease III.

[0254] As used herein, a "recombinant vector" is preferably a vector comprising regulatory sequences operably linked to a nucleotide sequence encoding the sense strand contained in the nucleic acid molecule of the present invention. A "recombinant cell" is a cell into which at least one recombinant vector capable of expressing the nucleic acid molecule or at least one strand of this nucleic acid molecule has been introduced.

[0255] The present disclosure also provides a method for preparing the siRNA as disclosed in the present disclosure, the method comprising culturing the aforementioned recombinant cell, or directly obtaining the siRNA by chemical synthesis and mixing.

[0256] The present disclosure also provides a pharmaceutical composition comprising the siRNA duplex or the corresponding siRNA conjugate, and a pharmaceutically acceptable carrier.

[0257] In one embodiment, there is provided herein a pharmaceutical composition comprising the siRNA duplex as described herein and a pharmaceutically acceptable carrier. The pharmaceutical composition containing the iRNA can be used for treating or preventing a disease or disorder associated with the expression or activity of the LPA gene, such as atherosclerosis. Such pharmaceutical compositions are formulated based on a delivery model. One example is a composition formulated for systemic administration by parenteral delivery, such as by subcutaneous injection (S.C.). Another example is a composition that is formulated for direct delivery into the brain parenchyma, such as by infusion into the brain, such as by continuous pump infusion.

[0258] The pharmaceutical composition comprising the RNAi agent of the present disclosure can be, for example, a solution with or without a buffer or a composition containing a pharmaceutically acceptable carrier. Such compositions include, for example, aqueous or crystalline compositions, liposome formulations, micelle formulations, emulsions, and gene therapy vectors.

[0259] In the method of the present disclosure, the siRNA can be administered in a solution. A free siRNA can be administered in a non-buffered solution, such as in physiological saline or in water. Alternatively, the free siRNA can also be administered in a suitable buffered solution. The buffered solution can include acetate, citrate, gliadin, carbonate, or phosphate, or any combination thereof. In a preferred embodiment, the buffered solution is phosphate buffered saline (PBS). The pH and osmolarity of the buffer solution containing the siRNA can be adjusted such that it is suitable for administration to a subject.

[0260] In some embodiments, the buffered solution further comprises a reagent for controlling the osmolarity of the solution such that the osmolarity is maintained at a desired value, such as the physiological value of human plasma. Solutes that can be added to the buffered solution to control osmolarity include (but are not limited to) proteins, peptides, amino acids, non-metabolic polymers, vitamins, ions, sugars, metabolites, organic acids, lipids, or salts. In some embodiments, the reagent for controlling the osmolarity of the solution is a salt. In certain embodiments, the reagent for controlling the osmolarity of the solution is sodium chloride or potassium chloride.

[0261] The pharmaceutical composition of the present disclosure can be administered in a dose sufficient to inhibit the expression of the LPA gene. Generally, a suitable dose of the siRNA of the present disclosure is in the range of about 0.001 to about 200.0 milligrams per kilogram of body weight per day, typically in the range of about 1 to 50 mg per kilogram of body weight per day. For example, the siRNA (such as an siRNA conjugate) can be administered at about 0.01, 0.05, 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 1.1, 1.2, 1.3, 1.4, 1.5, 1.6, 1.7, 1.8, 1.9, 2, 2.1, 2.2, 2.3, 2.4, 2.5, 2.6, 2.7, 2.8, 2.9, 3, 3.1, 3.2, 3.3, 3.4, 3.5, 3.6, 3.7, 3.8, 3.9, 4, 4.1, 4.2, 4.3, 4.4, 4.5, 4.6, 4.7, 4.8, 4.9, 5, 5.1, 5.2, 5.3, 5.4, 5.5, 5.6, 5.7, 5.8, 5.9, 6, 6.1, 6.2, 6.3, 6.4, 6.5, 6.6, 6.7, 6.8, 6.9, 7, 7.1, 7.2, 7.3, 7.4, 7.5, 7.6, 7.7, 7.8, 7.9, 8, 8.1, 8.2, 8.3, 8.4, 8.5, 8.6, 8.7, 8.8, 8.9, 9, 9.1, 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9, 10, 10.5, 11, 11.5, 12, 12.5, 13, 13.5, 14, 14.5, 15, 15.5, 16, 16.5, 17, 17.5, 18, 18.5, 19, 19.5, 20, 20.5, 21, 21.5, 22, 22.5, 23, 23.5, 24, 24.5, 25, 25.5, 26, 26.5, 27, 27.5, 28, 28.5, 29, 29.5, 30, 31, 32, 33, 34, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, or about 50 mg / kg per single dose.

[0262] The pharmaceutical composition can be administered once daily, or multiple times at different time intervals of 1 to 365 days, or the siRNA can be administered two, three, or more sub-doses at appropriate intervals within a year, or even administered by continuous infusion or delivery using a controlled-release formulation. In this case, the siRNA contained in each sub-dose must be correspondingly less in order to achieve the total daily dose. The dosage units can also be compounded for delivery over several days, for example using a conventional sustained-release formulation that provides sustained siRNA release over a period of several days. Sustained-release formulations are well known in the art and are particularly useful for delivering reagents at specific sites and can thus be used with the reagents of the present disclosure. In this embodiment, the dosage unit contains a corresponding number of daily doses.

[0263] In other embodiments, a single dose of the pharmaceutical composition can have a long duration, such that subsequent doses are administered at intervals of no more than 3, 4, or 5 days or at intervals of no more than 1, 2, 3, or 4 weeks. In some embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once a week. In other embodiments of the present disclosure, a single dose of the pharmaceutical composition of the present disclosure is administered once every two months.

[0264] Those skilled in the art will understand that certain factors can affect the dosage and timing required to effectively treat a subject, and these factors include (but are not limited to) the severity of the disease or disorder, previous treatments, the overall health and / or age of the subject, and other co-existing diseases. In addition, treating a subject with a therapeutically effective dose of the composition can include a single treatment or a series of treatments. As described elsewhere herein, the effective dose and in vivo half-life of each siRNA encompassed by the present disclosure can be estimated using conventional methods or in vivo testing based on the use of suitable animal models.

[0265] Depending on whether local or systemic treatment is desired and depending on the area to be treated, the pharmaceutical composition of the present disclosure can be administered in many ways. Administration can be local (e.g., via a skin patch); pulmonary; by inhalation or insufflation of a powder or aerosol, including via a nebulizer; intratracheal; intranasal; epidermal and transdermal, oral, or parenteral. Parenteral administration includes intravenous, intraarterial, subcutaneous, intraperitoneal, or intramuscular injection or infusion; subdermal, e.g., via an implant device; or intracranial, e.g., intracerebral, intrathecal, or intraventricular administration.

[0266] The siRNAs for use in the compositions and methods of the present disclosure can be formulated for delivery in membranous molecular assemblies such as liposomes or micelles. As used herein, the term "liposome" refers to a vesicle composed of amphiphilic lipids arranged in at least one lipid bilayer (e.g., one lipid bilayer or multiple lipid bilayers), having an outer membrane formed of lipophilic material and an aqueous portion located internally. The lipophilic material separates the aqueous interior from the aqueous exterior, which typically does not include the siRNA composition (although in some instances it may). Liposomes are useful for transferring and delivering active ingredients to the site of action. Since the liposome membrane is structurally similar to biological membranes, when liposomes are administered to a tissue, the liposome bilayer fuses with the bilayer of the cell membrane. As the fusion of the liposome with the cell proceeds, the internal aqueous contents, including the siRNA, are delivered into the cell, where the siRNA can specifically bind to a target RNA and can mediate RNA interference (RNAi). In some cases, these liposomes are also specifically targeted, for example, to direct the siRNA to a specific cell type.

[0267] Liposomes containing siRNA can be prepared by a variety of methods. In one example, the lipid components of the liposome are dissolved in a detergent such that micelles are formed with the lipid components. For example, the lipid components can be amphiphilic cationic lipids or lipid conjugates. The detergent can have a high critical micelle concentration and can be non-ionic. Exemplary detergents include cholate, CHAPS, octyl glucoside, deoxycholate, and lauroyl sarcosine. The siRNA formulation is then added to the micelles containing the lipid components. The cationic groups on the lipid interact with the siRNA and condense around the siRNA to form liposomes. After condensation, the detergent is removed, for example, by dialysis to obtain the corresponding liposome formulation of the siRNA.

[0268] The siRNA, such as the RNA duplexes of the present disclosure, can be encapsulated in lipid formulations (e.g., LNPs or other nucleic acid-lipid particles).

[0269] As used herein, the term "LNP" refers to a stable nucleic acid-lipid particle. LNPs contain a cationic lipid, a non-cationic lipid, and a lipid that prevents aggregation of the particle (e.g., a PEG-lipid conjugate). LNPs are extremely useful for synthetic applications because they exhibit an extended circulation lifetime after intravenous (i.v.) injection and accumulate at distal sites (e.g., sites physically separated from the site of administration).

[0270] In one embodiment, the mass ratio of lipid to siRNA duplex is from about 1:1 to about 50:1, from about 1:1 to about 25:1, from about 3:1 to about 15:1, from about 4:1 to about 10:1, from about 5:1 to about 9:1, or from about 6:1 to about 9:1.

[0271] In some preferred embodiments, the lipid nanoparticles comprise a cationic lipid, a neutral lipid, a structural lipid, and a polymer-conjugated lipid.

[0272] In some preferred embodiments, the cationic lipid is a compound of formula (I) structure, or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein G 1 is C 1～6 alkylene; G 2 is C 2～8 alkylene; G 3 is C 1～3 alkylene; L 1 is C 6～15 linear alkyl; L 2 is C 12～25 branched alkyl. For example, YK-009 of formula (I-I) structure, etc. (see Patent CN114044741B, the entire content of which is incorporated herein by reference, especially including the general formula and specific compounds therein).

[0273] (I)

[0274] (I-I)

[0275] In some preferred embodiments, the cationic lipid is a compound of formula (II) structure, or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein: G 1 is C 2~8 alkylene; G 2 is C 2~8 alkylene; L 1 is -C(O)O- or -OC(O)-; L 2 is -C(O)O- or -OC(O)-; R 1 is C 6~25 linear or branched alkyl; R 2 is C 6~25 linear or branched alkyl; G 3 is HO(CH 2 ) 2 - or HO(CH 2 ) 3 -; G 4 is HO(CH 2 ) 2- or HO(CH 2 ) 3 -; L is (CH 2 ) 2 - or -(CH 2 ) 3 - or -(CH 2 ) 4 -. For example, YK-401 with the structure of formula (II-I), YK-402 with the structure of formula (II-II), YK-407 with the structure of formula (II-III), etc. (see Patent CN115784921B, and all the content in this patent document is incorporated herein by reference, especially including the general formula and specific compounds therein).

[0276] (II)

[0277] (II-I)

[0278] (II-II)

[0279] (II-III)

[0280] In some preferred embodiments, the cationic lipid is a compound of formula (III), or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein: G 1 is C 1~6 alkylene; G 2 is C 2~8 alkylene; R 1 is C 6~20 linear or branched alkyl; R 2 is C 12~25 branched alkyl; G 3 is: HO(CH 2 ) 2 N(CH 3 )(CH 2 ) 2 -, HO(CH 2 ) 2 N(CH 2 CH 3 )(CH 2 ) 2 -, (HO(CH 2 ) 2 ) 2 N(CH 2 ) 2 -, CH 3 O(CH 2 ) 2 N(CH 3)(CH 2 ) 2 -, (CH 3 ) 2 N(CH 2 ) 3 SC(O)O(CH 2 ) 2 -, (CH 3 ) 2 N(CH 2 ) 3 SC(O)-, CH 3 NH(CH 2 ) 2 N(CH 3 )(CH 2 ) 2 - or CH 3 CH 2 NH(CH 2 ) 2 -. For example, YK-201 with the structure of formula (III-I), YK-202 with the structure of formula (III-II), etc. (see Patent CN115677518B, the entire content of which is incorporated herein by reference, especially including the general formula and specific compounds therein).

[0281] (III)

[0282] (III-I)

[0283] (III-II)

[0284] In some preferred embodiments, the cationic lipid is a compound of formula (IV), or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein G 1 is C 1~8 alkylene; G 2 is C 2~8 alkylene; R 1 is C 6~25 linear or branched alkyl; R 2 is C 12~25 linear or branched alkyl; G 3 is: HO(CH 2 ) 2 N(R 3 )CH 2 CH(OH)CH 2 -, wherein R 3 is -CH 3 or -CH 2 CH 3 or -CH2 CH 2 OH For example, YK-305 with the structure of formula (IV-I), YK-310 with the structure of formula (IV-II), etc. (see Patent CN115745820B, the entire content of which is incorporated herein by reference, especially including the general formulas and specific compounds therein).

[0285] (IV)

[0286] (IV-I)

[0287] (IV-II)

[0288] In some preferred embodiments, the cationic lipid is a compound of formula (V), or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein G 1 and G 2 are each independently an unsubstituted C 6 -C 10 alkylene; G 3 is an unsubstituted C 1 -C 12 alkylene; R 1 and R 2 are each independently C 6 -C 24 alkyl or C 6 -C 24 alkenyl; R 3 is OR 5 、N、-C(=O)OR 4 、-OC(=O)R 4 or -NR 5 C(=O)R 4 ; R 4 is C 1 -C 12 hydrocarbyl; and R 5 is H or C 1 -C 6 hydrocarbyl; for example, ALC0315 with the structure of formula (V-I), etc. (see Patent CN108368028B, the entire content of which is incorporated herein by reference, especially including the general formulas and specific compounds therein);

[0289] (V)

[0290] (V-I)

[0291] In some preferred embodiments, the cationic lipid is a compound of formula (VI) structure, or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer, wherein R4 is selected from -(CH 2 ) n Q and -(CH 2 ) n CHQR; Q is selected from the group consisting of: -OR, -OH, -O(CH 2 ) n N(R) 2 , -OC(O)R, -CX 3 , -CN, -N(R)C(O)R, -N(H)C(O)R, -N(R)S(O) 2 R, -N(H)S(O) 2 R, -N(R)C(O)N(R) 2 , -N(H)C(O)N(R) 2 , -N(H)C(O)N(H)(R), -N(R)C(S)N(R) 2 , -N(H)C(S)N(R) 2 , -N(H)C(S)N(H)(R), -N(R)S(O) 2 R 8 and heterocycles; n is 1, 2 or 3; for example, SM102 of formula (VI-I) structure (see patent application CN110520409A, the entire content of which is incorporated herein by reference, especially including the general formula and specific compounds therein).

[0292] (VI)

[0293] (VI-I)

[0294] In some preferred embodiments, the cationic lipid is a compound of formula (VII) structure, or its N-oxide, solvate, pharmaceutically acceptable salt or stereoisomer (see patent CN102625696B, DLIN-MC3-DMA, the entire content of which is incorporated herein by reference, especially including the general formula and specific compounds therein),

[0295] (VII)(DLIN-MC3-DMA).

[0296] In some more preferred embodiments, the cationic lipid is selected from any one or a combination of at least two of the group consisting of YK-009, YK-407, YK-305, ALC0315, SM102 and DLIN-MC3-DMA.

[0297] In some preferred embodiments, the molar ratio of the cationic lipid to the neutral lipid is from 1:1 to 10:1.

[0298] In some preferred embodiments, the molar ratio of the cationic lipid to the structural lipid is from 1:1 to 5:1.

[0299] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-70):(0.5-5).

[0300] In some preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is (25-65):(5-25):(25-45):(0.5-5).

[0301] In some more preferred embodiments, the molar ratio of the cationic lipid, the neutral lipid, the structural lipid, and the polymer-conjugated lipid is 50:10:38.5:1.5 or 49:10:39.5:1.5.

[0302] In some preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of phosphatidylcholine, phosphatidylethanolamine, sphingomyelin, ceramide, sterol, and their derivatives.

[0303] In some more preferred embodiments, the neutral lipid is selected from any one or a combination of at least two of the group consisting of: 1,2-dilinoleoyl-sn-glycero-3-phosphocholine (DLPC), 1,2-dimyristoyl-sn-glycero-phosphocholine (DMPC), 1,2-dioleoyl-sn-glycero-3-phosphocholine (DOPC), 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC), 1,2-distearoyl-sn-glycero-3-phosphocholine (DSPC), 1,2-doundecanoyl-sn-glycero-phosphocholine (DUPC), 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC), 1,2-di-O-octadecenyl-sn-glycero-3-phosphocholine (18:0 Diether PC), 1-oleoyl-2-cholesteryl hemisuccinyl-sn-glycero-3-phosphocholine (OChemsPC), 1-hexadecyl-sn-glycero-3-phosphocholine (C16 Lyso PC), 1,2-dilinolenoyl-sn-glycero-3-phosphocholine, 1,2-diarachidonoyl-sn-glycero-3-phosphocholine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphocholine, 1,2-dioleoyl-sn-glycero-3-phosphoethanolamine (DOPE), 1,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (ME 16.0PE), 1,2-distearoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinoleoyl-sn-glycero-3-phosphoethanolamine, 1,2-dilinolenoyl-sn-glycero-3-phosphoethanolamine, 1,2-diarachidonoyl-sn-glycero-3-phosphoethanolamine, 1,2-didocosahexaenoyl-sn-glycero-3-phosphoethanolamine, 1,2-dioleoyl-sn-glycero-3-phospho-rac-(1-glycerol) sodium salt (DOPG), dipalmitoyl phosphatidylglycerol (DPPG), palmitoyl oleoyl phosphatidylethanolamine (POPE), distearoyl-phosphatidylethanolamine (DSPE), dipalmitoyl phosphatidylethanolamine (DPPE), dimyristoyl phosphoethanolamine (DMPE), 1-stearoyl-2-oleoyl-stearoylethanolamine (SOPE), 1-stearoyl-2-oleoyl-phosphatidylcholine (SOPC), sphingomyelin, phosphatidylcholine, phosphatidylethanolamine, phosphatidylserine, phosphatidylinositol, phosphatidic acid, palmitoyl oleoyl phosphatidylcholine, lysophosphatidylcholine, lysophosphatidylethanolamine (LPE) and mixtures thereof.

[0304] In some more preferred embodiments, the neutral lipid is DOPE and / or DSPC.

[0305] In some preferred embodiments, the structural lipid is any one or a combination of at least two selected from the group consisting of cholesterol, non-sterol, sitosterol, ergosterol, campesterol, stigmasterol, brassicasterol, tomatine, ursolic acid, α-tocopherol, corticosteroid.

[0306] In some more preferred embodiments, the structural lipid is cholesterol.

[0307] In some preferred embodiments, the polymer-conjugated lipid is any one or a combination of at least two selected from the group consisting of PEG-modified phosphatidylethanolamine, PEG-modified phosphatidic acid, PEG-modified ceramide, PEG-modified dialkylamine, PEG-modified diacylglycerol, PEG-modified dialkylglycerol.

[0308] In some more preferred embodiments, the polymer-conjugated lipid is any one or a combination of at least two selected from the group consisting of distearoyl phosphatidylethanolamine polyethylene glycol 2000 (DSPE-PEG2000), dimyristoyl glycerol-3-methoxy polyethylene glycol 2000 (DMG-PEG2000), and methoxy polyethylene glycol ditetradecylacetamide (ALC-0159).

[0309] Examples of the pharmaceutical compositions of the present disclosure include, but are not limited to, aqueous formulations, emulsion formulations, and liposome-containing formulations. These compositions can be produced from a variety of components, examples of which include, but are not limited to, preformed liquids, self-emulsifying solids, and self-emulsifying semi-solids. For example, it is preferred to target the liver when treating liver diseases (such as liver cancer).

[0310] The pharmaceutical formulations of the present disclosure (which can conveniently be in unit dosage forms) can be prepared according to conventional techniques well known in the pharmaceutical industry. Such techniques include steps such as combining the active ingredients with the pharmaceutical carrier or excipient. Generally, these formulations are prepared by uniformly and finely combining the active ingredients with a liquid carrier or a finely divided solid carrier or both, and, if necessary, further shaping the product.

[0311] The compositions of the present disclosure can be formulated into any of a number of possible dosage forms, such as but not limited to tablets, capsules, gelatin capsules, liquid syrups, soft capsules, suppositories, and enemas. The compositions of the present disclosure can also be formulated into suspensions in aqueous, non-aqueous media or mixed media. The aqueous suspension can further contain substances that increase the viscosity of the suspension, such substances including, for example, sodium carboxymethyl cellulose, sorbitol, and / or dextran. The suspension can also contain stabilizers.

[0312] Certain compositions of the present disclosure also incorporate carrier compounds into the formulation. As used herein, "carrier compound" or "carrier" can refer to a nucleic acid or an analogue thereof that is inert (i.e., not biologically active in itself), but is considered a nucleic acid in in vivo processes, such as by reducing the bioavailability of a biologically active nucleic acid by degrading the biologically active nucleic acid or promoting its removal from the circulation. Co-administration of a nucleic acid and a carrier compound (generally with the latter in excess) can result in a substantial reduction in the amount of nucleic acid recovered in the liver, kidneys, or other extravascular reservoirs, presumably due to competition for a common receptor between the carrier compound and the nucleic acid. For example, co-administration with polyinosinic acid, dextran sulfate, polycytidylic acid, or 4-acetamido-4'-isothiocyanostilbene-2,2'-disulfonic acid can reduce the recovery of partially phosphorothioated dsRNA in liver tissue (Miyao et al., DsRNA Res. Dev., 1995, 5, 115-121; Takakura et al., DsRNA & Nucl. Acid Drug Dev., 1996, 6, 177-183).

[0313] In contrast to carrier compounds, a "pharmaceutical carrier" or "excipient" is a pharmaceutically acceptable solvent, suspending agent, or any other pharmaceutically inert vehicle for delivering one or more nucleic acids to an animal. The excipient can be liquid or solid, and when combined with the nucleic acid and other components of a particular pharmaceutical composition, the excipient is selected, with reference to the intended mode of administration, to provide the desired volume, consistency, etc. Typical pharmaceutical carriers include but are not limited to, binders (such as pregelatinized corn starch, polyvinylpyrrolidone, or hydroxypropylmethyl cellulose, etc.); fillers (such as lactose and other sugars, microcrystalline cellulose, pectin, gelatin, calcium sulfate, ethyl cellulose, polyacrylate, or calcium hydrogen phosphate, etc.); lubricants (such as magnesium stearate, talc, silica, colloidal silica, stearic acid, metal stearates, hydrogenated vegetable oil, corn starch, polyethylene glycol, sodium benzoate, sodium acetate, etc.); disintegrants (such as starch, sodium starch glycolate, etc.); and wetting agents (such as sodium lauryl sulfate, etc.).

[0314] Pharmaceutically acceptable organic or inorganic excipients suitable for non - parenteral administration and that do not react toxically with nucleic acids can also be used to formulate the compositions of the present disclosure. Suitable pharmaceutically acceptable carriers include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, straight - chain starch, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxy - methylcellulose, polyvinylpyrrolidone, and the like.

[0315] Formulations for topical administration of nucleic acids can include sterile or non - sterile aqueous solutions, non - aqueous solutions in common solvents such as alcohols, or solutions of nucleic acids in liquid or solid oil matrices. These solutions can also include buffers, diluents, and other suitable additives. Pharmaceutically acceptable organic or inorganic excipients suitable for non - parenteral administration and that do not react toxically with nucleic acids can be used.

[0316] Suitable pharmaceutically acceptable excipients include, but are not limited to: water, salt solutions, alcohols, polyethylene glycol, gelatin, lactose, straight - chain starch, magnesium stearate, talc, silicic acid, viscous paraffin, hydroxy - methylcellulose, polyvinylpyrrolidone, and the like.

[0317] The present disclosure also provides methods for treating or preventing diseases and disorders that can be modulated by down - regulating LPA gene expression. For example, Buerger's disease, peripheral arterial disease, coronary artery disease, metabolic syndrome, acute coronary syndrome, aortic stenosis, aortic regurgitation, aortic dissection, retinal artery occlusion, cerebrovascular disease, mesenteric ischemia, superior mesenteric artery occlusion, renal artery stenosis, stable / unstable angina, acute coronary syndrome, heterozygous or homozygous familial hypercholesterolemia, hyperapobetalipoproteinemia, cerebrovascular atherosclerosis, cerebrovascular disease and venous thrombosis, stroke, atherosclerosis, thrombosis, coronary heart disease or aortic stenosis and / or any other disease associated with elevated levels of Lp(a) particles and other related conditions, pathologies or syndromes that have not yet been identified.

[0318] The siRNAs of the present disclosure can be administered to a subject using any mode of administration known in the art, including (but not limited to) subcutaneous, intravenous, intramuscular, intraocular, intratracheal, intrapleural, intraperitoneal, intra - arterial, trans - lymphatic, trans - cerebrospinal, and any combination thereof. In a preferred embodiment, these reagents are administered subcutaneously.

[0319] In additional embodiments, the siRNA is administered in combination with another therapeutic agent. The siRNA and the additional therapeutic agent can be administered combinatorially in the same composition, for example, parenterally, or the additional therapeutic agent can be administered as part of a separate composition or by another method described herein.

[0320] Examples of additional therapeutic agents include agents known to treat LPA-related diseases or disorders. For example, additional therapeutic agents include: administering to a subject one or more siRNAs of the present invention; administering to a subject a non-LPA RNAi therapeutic agent; and making a behavioral change in a subject. In some embodiments, the non-LPA RNAi therapeutic agent is one of the following additional therapeutic agents, such as an HMG Co-A reductase inhibitor (statin), ezetimibe, a PCSK-9 inhibitor, a CTEP inhibitor, a therapy targeting ANGPTL3, a therapy targeting APOC3, and niacin, or any combination thereof.

[0321] In one embodiment, an iRNA agent is administered to a patient and then an additional therapeutic agent is administered to the patient (or vice versa). In another embodiment, the iRNA agent and the additional therapeutic agent are administered simultaneously.

[0322] The nucleotide abbreviations used herein are as follows:

[0323] A = adenosine-3'-phosphate

[0324] Am = 2'-methoxyadenosine-3'-phosphate

[0325] Ams = 2'-methoxyadenosine-3'-thiophosphate

[0326] Af = 2'-fluoroadenosine-3'-phosphate

[0327] Afs = 2'-fluoroadenosine-3'-thiophosphate

[0328] G = guanosine-3'-phosphate

[0329] Gm = 2'-methoxyguanosine-3'-phosphate

[0330] Gms = 2'-methoxyguanosine-3'-thiophosphate

[0331] Gf = 2'-fluoroguanosine-3'-phosphate

[0332] Gfs = 2'-fluoroguanosine-3'-thiophosphate

[0333] C = cytidine-3'-phosphate

[0334] Cm = 2'-methoxycytidine-3'-phosphate

[0335] Cms = 2'-methoxycytidine-3'-thiophosphate

[0336] Cf = 2'-fluorocytidine-3'-phosphate

[0337] Cfs = 2'-fluorocytidine-3'-thiophosphate

[0338] U = uridine-3'-phosphate

[0339] Um = 2'-O-methyluridine-3'-phosphate

[0340] Ums = 2'-O-methyluridine-3'-thiophosphate

[0341] Uf = 2'-fluorouridine-3'-phosphate

[0342] Ufs = 2'-fluorouridine-3'-thiophosphate

[0343] AmsEVP = 5'-vinyl-(E)-phosphonate-2'-O-methyladenosine-3'-thiophosphate

[0344] UmsEVP = 5'-vinyl-(E)-phosphonate-2'-O-methyluridine-3'-thiophosphate

[0345] Agna = adenosine glycol nucleic acid

[0346] Cgna = cytidine glycol nucleic acid

[0347] Ggna = guanosine glycol nucleic acid

[0348] Tgna = thymidine glycol nucleic acid

[0349] Ugna = uridine glycol nucleic acid

[0350] Examples of the code rules for siRNA motifs (or motifs), siRNA modifiers, siRNA conjugates, etc. in this article are as follows:

[0351] For sequences with alternating modifications of 2'-O-methyl (2'-OMe) and 2'-fluoro (2'-F), add "-AL" after the motif number. For example, the code for the alternating modifier B01023 is B01023-AL.

[0352] For siRNA modifiers in Examples 4 and 6, for example, which involve using the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP disclosed in this article, the corresponding code rules are: change the first letter of the code of the corresponding motif of the siRNA modifier from "B" to "C", and add the corresponding template name of the siRNA modifier at the end. For example, for motif B01023, the code for the modifier obtained after modification with the DV25P template is C01023-DV25P.

[0353] For the siRNA modifiers / siRNA conjugates in Examples 7-10, for example, the modification templates DV25P to DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP to DV27SP, DV29SP, DV32SP, DV34SP, DV38SP disclosed herein are involved, and at the same time, off-target modification methods may be further adopted, and a conjugation group is connected to the 3'-end of the sense strand. Its coding method is to change the first letter of the code of the corresponding motif from "B" to "D", and sequentially add the corresponding template name and / or off-target modification name after the code, and add a conjugation group name such as "G103", "G101", etc. at the end. For example, the siRNA motif B01023 is modified with the DV25P template, and the off-target modification d7B5 is adopted, and the conjugation group G101 is connected, and its corresponding code is D01023-DV25Pd7B5G101.

[0354] Table I Examples of codes for siRNA duplexes (motifs, modifiers, conjugates) in the present disclosure

[0355]

[0356] Example

[0357] In the following examples, the P value of the experimental data for inter-group comparison < 0.05, and the difference is statistically significant.

[0358] Other objects, features and advantages of the present disclosure will become apparent from the following detailed description. However, it should be understood that the detailed description and specific embodiments (although representing specific embodiments of the present disclosure) are given for explanatory purposes only, because various changes and modifications made within the spirit and scope of the present disclosure will become apparent to those skilled in the art after reading this detailed description.

[0359] The experimental techniques and methods used in this example are all conventional technical methods unless otherwise specified. For example, the experimental methods without specific conditions in the following examples are usually carried out under conventional conditions such as those described by Sambrook et al., Molecular Cloning: A Laboratory Manual (New York: Cold Spring Harbor Laboratory Press, 1989), or according to the conditions recommended by the manufacturer. The materials, reagents, etc. used in the examples can be obtained through commercial channels unless otherwise specified.

[0360] Those skilled in the art can understand that in each embodiment of the present disclosure, when the test substance in the experiment is an siRNA conjugate, it includes but is not limited to the inhibition rate, IC 50 、IC 40The experimental data and results can correspondingly reflect the inhibition rate, IC 50 , IC 40 and so on of the corresponding siRNA modifiers of the siRNA conjugate. For those skilled in the art, there is no obstacle to understanding.

[0361] Example 1: Inhibitory effect of siRNA motif on LPA gene

[0362] According to the human LPA mRNA sequence (NM_005577.4), 192 siRNA motifs were designed and synthesized, and the inhibitory effects of each siRNA motif on the LPA gene were detected by the dual-luciferase system, as shown in Table 2.

[0363] 1.1 Synthesis of siRNA motif

[0364] Instruments and reagents: Tsingke 192 P model DNA / RNA automatic synthesizer, whose solid-phase carrier is a general carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (manufactured by cytiva).

[0365] Preparation method:

[0366] According to the monomer concentration of 0.15 M, the following nucleotide monomer solutions were respectively prepared with acetonitrile: DMT-A-2'-O-TBDMS phosphoramidite monomer (Formula 11), DMT-C-2'-O-TBDMS phosphoramidite monomer (Formula 12), DMT-G-2'-O-TBDMS phosphoramidite monomer (Formula 13) and DMT-U-2'-O-TBDMS phosphoramidite monomer (Formula 14).

[0367] Formula 11 Formula 12

[0368] Formula 13 Formula 14

[0369] Through the solid-phase phosphoramidite method, nucleoside monomers were sequentially connected one by one from the 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleoside monomer includes four steps of deprotection, coupling, oxidation or sulfurization, and hydroxyl protection. Among them, when a phosphodiester bond is used to connect two nucleotides, when connecting the latter nucleoside monomer, it includes four steps of deprotection, coupling, oxidation, and hydroxyl protection. When a phosphorothioate bond is used to connect two nucleotides, when connecting the latter nucleoside monomer, it includes four steps of deprotection, coupling, sulfurization, and hydroxyl protection.

[0370] The preparation is carried out by the following steps:

[0371] Load the solid-phase carrier at the specified position of the synthesizer, and obtain the corresponding product after several synthesis cycles. The synthesis cycles include (1) deprotection, (2) coupling, (3) oxidation / sulfidation, and (4) hydroxyl protection. The cycle process and the reagents used are described as follows:

[0372] (1) Deprotection

[0373] Use a 3% solution of dichloroacetic acid in toluene as the deprotection reagent to remove the DMT protecting group, and then wash with acetonitrile.

[0374] (2) Coupling

[0375] Use 0.25 M 5-ethylthiotetrazole as the activator to couple the acetonitrile solution of each nucleotide monomer, and then rinse with acetonitrile.

[0376] (3) Oxidation / Sulfidation

[0377] Oxidation: Use a 0.05 M solution of iodine in pyridine / water (90 / 10) as the oxidizing agent for oxidation, and then rinse with acetonitrile.

[0378] Sulfidation: Use a 3% solution of hydrogen xanthate in pyridine as the sulfiding agent for sulfidation, and then rinse with acetonitrile.

[0379] (4) Hydroxyl Protection

[0380] Use a 10% solution of acetic anhydride in tetrahydrofuran (CAP A) and tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) (CAP B) as the hydroxyl protection reagent for hydroxyl protection, and then rinse with acetonitrile.

[0381] Repeat the above operations, and cycle through the above steps in the set nucleotide arrangement order to obtain the product of the sense strand or the antisense strand with a specific sequence arrangement.

[0382] (5) Use a 3% solution of dichloroacetic acid in toluene as the deprotection reagent to remove the DMT protecting group of the last nucleotide, and then wash with acetonitrile.

[0383] (6) Ammonolysis and Purification

[0384] Transfer the reacted solid-phase carrier to a reactor, add concentrated ammonia water (25-28%), keep it for ammonolysis at 60 °C for 12 h, then cool the system to room temperature, filter the mixture, wash the filter cake with a mixed solution of purified water and ethanol, combine the filtrate, pass it through a chromatography column, concentrate, and lyophilize to obtain the 2'-O-TBDMS protected product.

[0385] (7) Removal of TBDMS

[0386] DMSO and triethylamine hydrofluoride were added to the obtained product, and the reaction was carried out at 60 °C for 2 h. Then, an aqueous solution of ammonium acetate was added to the reaction solution, shaken and mixed evenly. Anhydrous ethanol was added, and after shaking and mixing evenly, crystallization was carried out at -20 °C for 8 - 12 h. After centrifugation, the supernatant was discarded, and the precipitate was washed with anhydrous ethanol to obtain an unmodified single-stranded product.

[0387] (8)Annealing

[0388] The sense strand and the antisense strand of the obtained siRNA motif were mixed at a molar ratio of 1:1, heated to 95 °C and maintained for 3 min, and then slowly cooled to room temperature to form a double strand of the siRNA motif.

[0389] 193 siRNAs in Table 2 were synthesized by the above method, where ANC is a nonsense sequence and serves as a negative control.

[0390] 1.2 Detection of the inhibitory effect of siRNA motif on LPA gene by dual-luciferase method

[0391] The experimental materials and methods are as follows:

[0392] 1.2.1 Experimental materials

[0393] Table 1 Experimental materials

[0394]

[0395] Construction of psiCHECK2-LPA plasmid: The full-length mRNA sequence of LPA gene (NM_007755.4) was cloned into the dual-luciferase plasmid psiCHECK(TM)-2, and it was commissioned to Cloud-Zhou Biotechnology (Guangzhou) Co., Ltd. for construction, with the product number VB240227-1779ggq.

[0396] 1.2.2 Experimental methods

[0397] 1) Plasmid transfection and cell plating

[0398] Day 0: Transfer the psiCHECK2-target gene plasmid into Huh7 cells

[0399] The psiCHECK2-target gene plasmid was diluted to 10 ng / μL with Opti-MEM. Take Huh7 cells, first wash them with DPBS, then add trypsin for digestion, and adjust the cell density to 1×10 5cells / mL. Mix according to the ratio of Fugene-HD transfection reagent: 10 ng / μL of psiCHECK2-target gene plasmid dilution = 3:100 (volume ratio). After mixing evenly, incubate at room temperature for 10 min. After the incubation, add it to Huh7 cells, and then inoculate into a 96-well plate at a density of 10,000 cells per well, with 100 μL of culture medium in each well. Place the Huh7 cells in a 5% CO 2 incubator at 37 °C and culture overnight.

[0400] 2) Preparation of siRNA solution and cell transfection

[0401] Day 1: Treatment of siRNA

[0402] Mix the RNAiMAX transfection reagent and Opti-MEM according to a volume ratio of 1.5:48.5 to obtain mixture X, and incubate at room temperature for 15 min. Mix the test siRNA solution with an initial concentration of 12 nM and the above mixture X at a volume ratio of 1:1 to obtain mixture Y, and incubate at room temperature for 15 min. After incubation, add 20 μL of the obtained mixture Y to 100 μL of fresh DMEM medium at a volume ratio of 1:5 and mix evenly to obtain mixture Z. The final transfection concentration of the test siRNA is 1 nM. Discard the supernatant of the Huh7 cells cultured overnight in the 96-well plate in step 1), add 120 μL of the above mixture Z to each well of the 96-well plate, and then place the 96-well plate in a CO 2 cell culture incubator and culture for 48 h.

[0403] 3) Cell sampling and fluorescence expression detection

[0404] Day 2 / Day 3: Detection of reporter gene

[0405] Reagent preparation:

[0406] Reagent A: Transfer the content of a bottle of Dual-Glo® luciferase buffer to a bottle of Dual-Glo® luciferase substrate to prepare Dual-Glo® luciferase reagent. After dispensing the prepared reagent, store it in the dark at -80 °C in the refrigerator.

[0407] Reagent B: Calculate the amount of Dual-Glo® Stop & Glo® reagent required for the experiment. Use a new container to dilute the Dual-Glo® Stop & Glo® substrate 1:100 into the Dual-Glo® Stop & Glo® buffer to prepare the required volume of Dual-Glo® Stop & Glo® reagent. This reagent is prepared and used immediately.

[0408] Sample addition and detection:

[0409] Use a pipette to aspirate the cell supernatant, add 75 μl of fresh 10% FBS (fetal bovine serum) DMEM medium to each well, equilibrate to room temperature, add 75 μl of reagent A to each well, and shake the plate at room temperature for 10 minutes to lyse the cells.

[0410] After observing that the cell lysis is complete under a microscope, detect the luminescence value of firefly luciferase (Firefly lum) using a multimode microplate reader. The parameters of the microplate reader are set for chemiluminescence Lum detection, full wavelength, integration time of 1 second, and detection height of 1 mm.

[0411] After the detection is completed, add 75 μl of reagent B to each well in the wells of the previous step, shake the plate at room temperature for 10 minutes, and detect the luminescence value of Renilla luciferase (Renilla lum). The parameters of the microplate reader are set for chemiluminescence Lum detection, full wavelength, integration time of 1 second, and detection height of 1 mm.

[0412] Set a control group in the experiment, replace the above siRNA with Opti-MEM, and the remaining conditions are the same as those in the experimental group; a blank group, Huh7 cells not transfected with psiCHECK2-target gene plasmid and without adding siRNA.

[0413] 4) Calculation of the inhibition rate of siRNA on the target gene

[0414] The ratio of the fluorescence value of Renilla luciferase to the fluorescence value of firefly luciferase is denoted as α, and the calculation formula is:

[0415] α = (average Renilla lum value in the test wells - average Renilla lum value in the blank control group) / (average Firefly lum value in the test wells - average Firefly lum value in the blank control group);

[0416] According to the above formula, the ratio calculated for the experimental group is denoted as: α (experimental group), and the ratio calculated for the control group is denoted as: α (transfection reagent control group).

[0417] Calculate the inhibition rate of siRNA on the expression of the target gene according to the following formula:

[0418] Inhibition rate (%) = [1 - α (average value of the experimental group) / α (average value of the transfection reagent control group)] × 100%.

[0419] After 3 repeated experiments, with 3 parallel detection wells set each time, the inhibition rates of each siRNA motif on the expression of LPA mRNA are shown in Table 2 below. Among them, 114 siRNA motifs have an inhibition rate on the LPA gene greater than 25%, showing good inhibitory activity.

[0420] Table 2 Inhibition of siRNA basic sequences on the LPA gene

[0421]

[0422]

[0423]

[0424]

[0425]

[0426]

[0427]

[0428]

[0429]

[0430]

[0431] Example 2: Synthesis of Alternately Modified siRNA Modifiers

[0432] To improve the inhibition rate and stability, the siRNA motifs in Table 2 were alternately modified with 2'-methoxy (2'-OMe) and 2'-fluoro (2'-F), and 3',5'-phosphorothioate bonds were introduced between the nucleotides at the 5'-end and / or 3'-end.

[0433] 2.1 Synthesis of Alternately Modified siRNA Modifiers

[0434] The rule for alternate modification in this disclosure is as follows: Nucleotides at odd positions of the sense strand and nucleotides at even positions of the antisense strand are both modified with 2'-F, and nucleotides at other positions are modified with 2'-OMe. Additionally, there are 3',5'-phosphorothioate bonds between the first and second nucleotides and between the second and third nucleotides starting from the 5'-end of the sense strand; there are 3',5'-phosphorothioate bonds between the first and second nucleotides and between the second and third nucleotides starting from the 5'-end of the antisense strand, and there are 3',5'-phosphorothioate bonds between the first and second nucleotides and between the second and third nucleotides starting from the 3'-end of the antisense strand. The alternately modified siRNA modifiers designed according to this rule are denoted by adding "-AL" after the original sequence number, as shown in Table 3.

[0435] Instruments and reagents: Tsingke 192P DNA / RNA automatic synthesizer, with a solid-phase carrier being a general carrier of cross-linked polystyrene beads, model Primer support 5G Unylinker 350 (manufactured by Cytiva).

[0436] For example, the preparation method may include:

[0437] Prepare solutions of the following nucleotide monomers in acetonitrile respectively according to a monomer concentration of 0.15 M: DMT-A-OMe phosphoramidite monomer (Formula 1), DMT-C-OMe phosphoramidite monomer (Formula 2), DMT-G-OMe phosphoramidite monomer (Formula 3), and DMT-U-OMe phosphoramidite monomer (Formula 4), DMT-A-F phosphoramidite monomer (Formula 5), DMT-C-F phosphoramidite monomer (Formula 6), DMT-G-F phosphoramidite monomer (Formula 7), and DMT-U-F phosphoramidite monomer (Formula 8).

[0438]

[0439]

[0440]

[0441] Through the solid-phase phosphoramidite method, nucleoside monomers are connected one by one in the 3'-5' direction according to the nucleotide arrangement order. Each connection of a nucleoside monomer includes four reaction steps: deprotection, coupling, oxidation or sulfidation, and hydroxyl protection. Among them, when a phosphoester linkage is used between two nucleotides, when connecting the latter nucleoside monomer, it includes four reaction steps: deprotection, coupling, oxidation, and hydroxyl protection. When a phosphorothioate linkage is used between two nucleotides, when connecting the latter nucleoside monomer, it includes four reaction steps: deprotection, coupling, sulfidation, and hydroxyl protection.

[0442] (1) Deprotection

[0443] Use a 3% dichloroacetic acid toluene solution as the deprotection reagent to remove the DMT protecting group, and then wash with acetonitrile.

[0444] (2) Coupling

[0445] Use 0.25 M 5-ethylthiotetrazole as the activator to couple the acetonitrile solution of each nucleotide monomer, and then wash with acetonitrile.

[0446] (3) Oxidation / Sulfidation

[0447] Oxidation: Use a 0.05 M iodine pyridine / water (90 / 10) solution as the oxidant for oxidation, and then wash with acetonitrile.

[0448] Sulfuration: Use a pyridine solution of 3% hydrogenated xanthogen as the sulfuring agent for sulfuration, and then rinse with acetonitrile.

[0449] (4)Hydroxyl protection

[0450] Use a 10% acetic anhydride tetrahydrofuran solution (CAP A) and a tetrahydrofuran / pyridine / N-methylimidazole 74 / 10 / 16 (v / v / v) solution (CAP B) as the hydroxyl protection reagents for hydroxyl protection, and then rinse with acetonitrile.

[0451] Repeat the above operations, and cycle through the above steps according to the set nucleotide arrangement order to obtain the sense strand product or antisense strand product with a specific sequence arrangement.

[0452] (5)Use a 3% dichloroacetic acid toluene solution as the deprotection reagent to remove the DMT protecting group of the last nucleotide, and then wash with acetonitrile.

[0453] (6)Ammonolysis and purification

[0454] Transfer the solid support to a reactor, add concentrated ammonia water (25%-28%, mass percentage), keep the ammonolysis at 60 °C for 12 h, then cool the system to room temperature, transfer the mixture to a pressure filter tank for filtration, wash the filter cake with a mixed solution of purified water and ethanol, combine the filtrates, pass through a chromatography column, concentrate, and freeze-dry to obtain the single-stranded product modified with 2'-OMe and 2'-F.

[0455] (7)Annealing

[0456] Mix the purified sense strand and antisense strand in a 1:1 molar ratio, heat to 95 °C and keep for 3 min, then slowly cool to room temperature to form the siRNA duplex.

[0457] Synthesize the sense strand and antisense strand of the siRNA listed in Table 3 according to the above method, a total of 194 siRNAs. Among them, APC-AL is the positive control, which is the original sequence of the drug Olpasiran that has entered clinical phase III (the basic sequence of its sense strand is shown in SEQ ID NO: 387, and the basic sequence of its antisense strand is shown in SEQ ID NO: 388) and is subjected to the above alternating modification. ANC-AL is the negative control (its basic sequence is shown in Table 2), which is the nonsense sequence of alternating modification.

[0458] SEQ ID NO: 387: CAGCCCCUUAUUGUUAUACGA

[0459] SEQ ID NO: 388: UCGUAUAACAAUAAGGGGCUG

[0460] Example 3: Inhibitory effect of alternately modified siRNA modifiers on LPA gene

[0461] Using the dual-luciferase system and the human primary hepatocyte transfection method, the inhibitory effect of the alternately modified siRNA modifiers synthesized in Example 2 on the LPA gene was determined.

[0462] 3.1 Detection by dual-luciferase method

[0463] The inhibitory effects of all 194 alternately modified modifiers in Table 3 on the LPA gene were detected by the dual-luciferase method. The experimental materials and methods refer to 1.2.1 and 1.2.2 of Example 1.

[0464] 3.1.1 Experimental results

[0465] After 3 repeated experiments, 3 parallel detection wells were set for each siRNA modifier, and the inhibitory effect of the siRNA modifiers in Table 3 on the LPA gene was detected by the dual-luciferase method.

[0466] Table 3 Inhibition of alternately modified siRNA modifiers on LPA gene

[0467]

[0468]

[0469] 3.2 Detection of the inhibitory effect of alternately modified siRNA modifiers on the LPA gene by human primary hepatocyte transfection method

[0470] Eighteen modifiers with better activity were selected from the 194 alternately modified siRNA modifiers in Table 3 (see Table 5). After the modifiers were transfected into human primary hepatocytes via liposome (Lipofectamine RNAiMAX), the inhibition rate of each sequence on the LPA gene was detected using qPCR technology, and the dose-effect relationship curve was fitted to calculate IC 40 , and the siRNA transfection concentration was set starting from 10 nM, with 3-fold serial dilution, using a total of 8 concentrations (10 nM, 3.3 nM, 1.1 nM, 0.37 nM, 0.12 nM, 0.04 nM, 14 pM, 5 pM) to detect the inhibitory activity against the LPA gene.

[0471] 3.2.1 Experimental materials

[0472] Table 4 Experimental materials

[0473]

[0474] Solvent: Sterilized RNase-free water.

[0475] 3.2.2 Experimental method

[0476] 1) Resuscitation of human primary hepatocytes

[0477] The culture medium was preheated in a constant temperature environment at 37 °C for more than 30 min. 120 μL of PBS was added to each well of the collagen-coated 96-well plate, and after shaking several times, the PBS was aspirated and discarded. The cell cryopreservation tube was taken out of the liquid nitrogen tank and placed in a 37 °C water bath, and gently shaken until only a small part of the ice crystals remained in the tube. The cell suspension was poured into the resuscitation medium at one time. 1 mL of resuscitation medium was aspirated to rinse the inner wall of the cryopreservation tube 2 - 3 times. The resuscitation medium cell suspension was inverted and mixed evenly. Centrifuged at 150 g for 5 min at room temperature, the supernatant was discarded, and the cells were resuspended in the preheated plating medium, and counted using a cell counter.

[0478] 2) Plating of human primary hepatocytes and siRNA transfection

[0479] Preparation of siRNA transfection complex: Mix RNAiMAX transfection reagent and Opti-medium at a volume ratio of 1.5:23.5 to obtain solution A, and incubate at room temperature for 15 minutes; according to the transfection concentration, dilute with Opti-MEM to prepare a solution of siRNA modifier, so that the concentration of the prepared modifier is 20 times the final transfection concentration, and the diluted solution is solution B; mix solution A and solution B at a ratio of 1:1 to obtain solution C, and after incubating at room temperature for 15 minutes, add it to the collagen-coated 96-well cell culture plate, and add 10 μL to each well.

[0480] Cell dilution and plating: After the PHH cells were counted, according to the counting results, plating medium was added to the cell suspension to adjust the cell concentration to 5×10 5 ~6×10 5 cells / mL, and mixed evenly; use a multi-channel pipette to dispense the cell suspension into the above collagen-coated 96-well cell culture plate, and add 90 μL of cell suspension to each well.

[0481] Culture: Place the culture plate in a 5% CO 2 incubator, with 95% relative humidity, and statically culture at 37 °C for 48 h.

[0482] 3) RNA extraction and reverse transcription

[0483] After 24 h of transfection, the medium was removed and the cells were collected for RNA extraction. According to the kit instructions, total RNA was extracted using the Rneasy Mini Kit (QIAGEN - 74106). Subsequently, cDNA was synthesized using the FastKing RT Kit (With gDNase) (TIANGEN - KR116 - 02) according to the instructions.

[0484] 4) RT - qPCR

[0485] According to the kit instructions, the mRNA of the target gene human LPA gene (Thermo, Hs00916691_m1) and the internal reference gene human GAPDH gene (Thermo, Hs02786624_g1) were amplified using TaqMan Fast Advanced Master Mix (Thermo, 4444557), respectively.

[0486] 5) Data analysis

[0487] Using the ΔΔCt relative quantification method, the RNA expression level of the target gene in the sample was calculated based on the Ct value of each sample. The relative expression of the target gene was expressed using 2 -ΔΔCt to represent.

[0488] The calculation formula is as follows:

[0489] ΔCT = average Ct value of the target gene - average Ct value of the internal reference gene;

[0490] ΔΔCT = ΔCT (drug - added group) - ΔCT (RNAiMAX control group);

[0491] Relative expression of target gene mRNA = 2 -ΔΔCt

[0492] Inhibition rate = (1 - relative expression of the sample / average expression of the RNAiMAX control) × 100%

[0493] The dose - effect relationship curve was fitted using GraphPad Prism software (Nonlinear four parameter logistic equations).

[0494] 3.2.3 Experimental results

[0495] After 3 times of qPCR detection, the inhibition rates of each siRNA modifier on the LPA gene of human primary hepatocytes at different concentrations are shown in Table 5 below. Each modifier had a certain inhibitory effect on LPA. Among them, the inhibition rate of B01023 - AL on LPA reached 90.0% at 10 nM. In addition, the IC40 Superior to the positive control APC-AL, for example, the IC of B01023-AL 40 is 0.10 nM, superior to 10.53 nM of the positive control.

[0496] Table 5 Inhibitory rates and IC of LPA in human primary hepatocytes byalternating modifiers at different concentrations 40 and IC 50

[0497]

[0498] Example 4: Inhibitory effect of modifiers on the LPA gene

[0499] In this example, 17 basic sequences screened in Examples 1 and 3, namelyB01001, B01012, B01023, B01011, B01040, B01042, B01047, B01801, B02460,B02458, B02416, B02417, B02459, B02457, B02434, B06001, and B06029, weremodified using modification templates. Among them, DV25P, DV26P, DV27P,DV29P, DV32P, DV34P, DV38P, DV25SP, DV26SP, DV27SP, DV29SP, DV32SP,DV34SP, DV38SP are new modification templates of the present disclosure,DV22 is the Advanced ESC modification template disclosed in the prior art(Foster, D. J., etal. (2018). "Advanced siRNA Designs Further Improve In VivoPerformance of GalNAc-siRNA Conjugates." Mol Ther 26(3): 708-717.), andDV22S is a modification template for siRNA modifiers or siRNA conjugates with20 and 22 bases for the sense and antisense strands respectively, based on theDV22 modification.

[0500] DV22 antisense strand 5'-3': Starting from the 5' end of the antisensestrand, the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th,17th, 18th, 19th, 20th, 21st, 22nd, and 23rd nucleotides are 2'-methoxy-modified nucleotides, and the 2nd, 6th, 14th, and 16th are 2'-fluoro-modified nucleotides, and the 1st, 2nd, 21st, and 22nd nucleotides are connected to their adjacent nucleotides on the right by 3',5'-thiophosphate ester bonds.

[0501] DV22 sense strand 5'-3': Starting from the 5'-end of the sense strand, the 1st, 2nd, 3rd, 4th, 5th, 6th, 8th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, 20th, and 21st nucleotides are 2'-O-methyl modified nucleotides, and the 7th, 9th, 10th, and 11th nucleotides are 2'-fluoro modified nucleotides, and there is a 3',5'-phosphorothioate bond between the 1st and 2nd nucleotides and their adjacent nucleotides on the right.

[0502] DV22S antisense strand 5'-3': Starting from the 5'-end of the antisense strand, the 1st, 3rd, 4th, 5th, 7th, 8th, 9th, 10th, 11th, 12th, 13th, 15th, 16th, 17th, 18th, 19th, 20th, 21st, and 22nd nucleotides are 2'-O-methyl modified nucleotides, and the 2nd, 6th, and 14th nucleotides are 2'-fluoro modified nucleotides, and there is a 3',5'-phosphorothioate bond between the 1st, 2nd, 20th, 21st nucleotides and their adjacent nucleotides on the right.

[0503] DV22S sense strand 5'-3': Starting from the 5'-end of the sense strand, the 1st, 2nd, 3rd, 4th, 5th, 7th, 11th, 12th, 13th, 14th, 15th, 16th, 17th, 18th, 19th, and 20th nucleotides are 2'-O-methyl modified nucleotides, and the 6th, 8th, 9th, and 10th nucleotides are 2'-fluoro modified nucleotides, and there is a 3',5'-phosphorothioate bond between the 1st and 2nd nucleotides and their adjacent nucleotides on the right.

[0504] Natural 5'-end phosphorylation or simple direct 5'-end phosphorylation may undergo dephosphorylation in cells. The directly 5'-end phosphorylated oligonucleotide strand may show 90% dephosphorylation after circulating in the blood for 2 hours and completely disappear after 24 hours. The 5'-end phosphorylation design (5'-E-VP) uses E-vinylphosphonate to replace the bridging oxygen, having improved phosphorylation effect and stability. The 5'-ends of the antisense strands of the modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure all contain 5'-vinylphosphonate groups.

[0505] 4.1 Sequence synthesis:

[0506] Synthesize the siRNA sequence according to the method in Example 1. When synthesizing the base (the last base) at the 5'-end of the antisense strand, use monomers containing a phosphonic acid group at the 5'-end, for example, vinyl-(E)-phosphonate-A-OMe phosphoramidite monomer (Formula 9), vinyl-(E)-phosphonate-U-OMe phosphoramidite monomer (Formula 10), and their structural examples are as follows:

[0507] Formula 9 Formula 10

[0508] 4.2 Modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP:

[0509] The modification rules of the modified templates in this disclosure are as follows:

[0510] For siRNA modifiers or siRNA conjugates with 21 and 23 bases for the sense and antisense strands respectively:

[0511] The antisense strand has any one of the modification methods shown in Table 6:

[0512] Table 6 Antisense strand modification

[0513]

[0514]

[0515] The sense strand has any one of the modification methods shown in Table 7:

[0516] Table 7 Sense strand modification

[0517]

[0518] Among them, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS means that starting from the 5' end, the nucleotide at this position is connected to the adjacent nucleotide on its right by a 3',5'-thio-phosphate ester bond.

[0519] The siRNA modification template with the antisense strand using modification method A and the sense strand using modification method a is named DV25P.

[0520] The siRNA modification template with the antisense strand using modification method B and the sense strand using modification method a is named DV26P.

[0521] The siRNA modification template with the antisense strand using modification method C and the sense strand using modification method a is named DV27P.

[0522] The siRNA modification template with the antisense strand using modification method C and the sense strand using modification method b is named DV29P.

[0523] The siRNA modification template with the antisense strand using modification method D and the sense strand using modification method b is named DV32P.

[0524] The siRNA modification template with the antisense strand using modification method E and the sense strand using modification method b is named DV38P.

[0525] The siRNA modification template with the antisense strand using modification method F and the sense strand using modification method b is named DV34P.

[0526] For siRNA modifiers or siRNA conjugates with 20 and 22 bases for the sense and antisense strands respectively:

[0527] The antisense strand adopts any one of the modification methods shown in Table 8:

[0528] Table 8 Antisense strand modification

[0529]

[0530] The sense strand has any one of the modification methods shown in Table 9:

[0531] Table 9 Sense strand modification

[0532]

[0533] Among them, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS means that starting from the 5' end, the nucleotide at this position is connected to the adjacent nucleotide on its right by a 3',5'-thio-phosphate ester bond;

[0534] The siRNA modification template with the antisense strand using modification method A' and the sense strand using modification method a' is named DV25SP;

[0535] The siRNA modification template with the antisense strand using modification method B' and the sense strand using modification method a' is named DV26SP;

[0536] The siRNA modification template with the antisense strand using modification method C' and the sense strand using modification method a' is named DV27SP;

[0537] The siRNA modification template with the antisense strand using modification method C' and the sense strand using modification method b' is named DV29SP;

[0538] The siRNA modification template with the antisense strand using modification method D' and the sense strand using modification method b' is named DV32SP;

[0539] The siRNA modification template with the antisense strand using modification method E' and the sense strand using modification method b' is named DV38SP;

[0540] The siRNA modification template with the antisense strand using modification method F' and the sense strand using modification method b' is named DV34SP.

[0541] Details of the template-modified siRNA modifiers are shown in Table 10, and the synthesis method refers to Example 1.

[0542] Using two methods, the dual-luciferase system and the transfection method of human primary hepatocytes, the template-modified siRNA modifiers in Table 10 were assayed for their inhibitory effects on the LPA gene.

[0543] 4.3 Detection of the inhibitory effect of template-modified siRNA modifiers on the LPA gene using the dual-luciferase method

[0544] Using the dual-luciferase method, 120 template-modified siRNA modifiers in Table 10 were assayed for their inhibitory effects on the LPA gene. Among them, the positive control APC-OL was the original modified sequence of Olpasiran with the GalNAc group removed, and the negative control ANC-DV29P was the nonsense sequence modified by the DV29-modified template.

[0545] The experimental materials and experimental methods were referred to 1.2.1 and 1.2.2 in Example 1.

[0546] After 3 repeated experiments, 3 parallel detection wells were set for each test substance. The inhibition rates of the modifiers of each template modification on LPA mRNA expression are shown in Table 10 below.

[0547] Table 10 Inhibition of LPA gene by siRNA modifiers modified with different templates

[0548]

[0549]

[0550]

[0551]

[0552]

[0553] APC-OL:

[0554] Sense strand (SEQ ID NO: 389): Cms-Ams-Gm-Cm-Cm-Cm-Cm-Um-Uf-Af-Uf-Um-Gm-Um-Um-Am-Um-Am-Cm-Gms-d’A

[0555] Antisense strand (SEQ ID NO: 390): Ums-Cfs-Gm-Uf-Am-Uf-Am-Am-Cm-Am-Am-Uf-Am-Af-Gm-Gf-Gm-Gf-Cms-Ufs-Gm

[0556] d’A: DNA linked by 3'-3' phosphodiester bond.

[0557] The above results indicate that:

[0558] (1) For the 17 siRNA motifs B01001, B01012, B01023, B01011, B01040, B01042, B01047, B01801, B02460, B02458, B02416, B02417, B02459, B02457, B02434, B06001 and B06029, after being modified by the modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP, the obtained modifiers have a significant inhibitory effect on the expression of the LPA gene. The inhibition rates of 91 siRNA modifiers modified by templates are all above 40%. For example, the inhibition rates of C01023-DV25P, C02417-DV38P and C01801-DV27P are 81.2%, 78.0% and 70.6% respectively.

[0559] (2) When the above 17 sequences are modified by the modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure, compared with the alternately modified sequences, the inhibition rate of the LPA gene expression is significantly improved. For example, the inhibition rate of the modifier C01023-DV25P obtained by modifying the siRNA motif B01023 with the template DV25P is increased by 9.9% compared with the alternately modified modifier, and the inhibition rate of the modifier C02417-DV38P obtained by modifying the siRNA motif B02417 with the template DV38P is increased by 15.7% compared with the alternately modified modifier.

[0560] (3) When the same sequence is modified by the modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure, compared with the modified templates disclosed in the prior art, the inhibition rate of the LPA gene expression is significantly improved. For example, when the siRNA motif B01023 is modified with the modified template DV25P of the present disclosure, compared with the sequence modified with the disclosed Advanced ESC template DV22, the inhibition rate is increased by 10.8%. When the siRNA motif B02417 is modified with the modified template DV38P of the present disclosure, compared with the sequence modified with the disclosed Advanced ESC template DV22, the inhibition rate is increased by 7.2%.

[0561] (4) The activities of different template-modified sequences vary greatly. For example, the siRNA motif B01023 with DV25P modification has a 21.3% higher inhibition rate than that with DV34 modification; the siRNA motif B01801 with DV27P modification has a 12.0% higher inhibition rate than that with DV32P modification. Thus, it is uncertain which modification template the siRNA sequence should adopt to achieve high activity.

[0562] 4.4 Detection of the inhibitory effect of template-modified sequences on the LPA gene by human primary hepatocyte transfection method

[0563] The inhibitory effects of the sequences with better activities among the 101 template-modified sequences in Table 10 (see Table 11) on the LPA gene were detected by the method of human primary hepatocyte transfection.

[0564] After each sequence was transfected into human primary hepatocytes by liposome (Lipofectamine RNAiMAX), the inhibitory rate of each sequence on the LPA gene was detected by qPCR technology, and the dose-effect relationship curve was fitted to calculate the IC 50 , and the siRNA transfection concentration was set starting from 2.5 nM, with 4-fold dilution, for a total of 6 concentration points (2.5 nM, 0.625 nM, 0.156 nM, 0.039 nM, 0.01 nM, 0.002 nM).

[0565] The experimental materials and methods refer to 3.2.1 and 3.2.2 in Example 3.

[0566] After 3 qPCR detections, the inhibitory rates of each sequence on the LPA gene of human primary hepatocytes at different concentrations are shown in Table 11 below. Each sequence modified with the modified template designed in the present disclosure has a certain inhibitory effect on LPA, and among them, 19 IC 50 values are in the range of 0.016 - 0.417 nM, indicating that these sequences can effectively inhibit the expression of the LPA gene at low concentrations. The IC 50 of some sequences is better than that of the positive control APC-OL (the original modified sequence of the Olpasiran sequence). For example, the IC 50 of C01023-DV25P is 0.025 nM, which is less than 2.178 nM of the positive control.

[0567] When the same sequence is modified with the modified templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP of the present disclosure, compared with the modified template Advanced ESC template DV22 disclosed in the prior art, the inhibitory effect on the LPA gene is significantly improved, and the IC 50Lower than the DV22 template disclosed in the prior art. For example, the siRNA motif B01023 uses the modified template DV25P of the present disclosure to modify the sequence. Compared with the sequence modified by the disclosed AdvancedESC template DV22, the highest inhibition rate on human primary hepatocytes is increased by 13.2%, and the IC 50 is reduced from 0.067 nM to 0.025 nM; the siRNA motif B02417 uses the modified template DV38P of the present disclosure to modify the sequence. Compared with the modified product modified by the disclosed AdvancedESC template DV22, the highest inhibition rate on the LPA gene of human primary hepatocytes is increased by 10.8%, and the IC 50 is reduced from 0.777 nM to 0.041 nM.

[0568] Table 11 Inhibition rate and IC of modified products modified by templates with different concentrations on LPA of human primary hepatocytes 50

[0569]

[0570] Example 5: Comparison of the inhibitory effect of the sequences disclosed in the prior art on the LPA gene

[0571] In this example, the alternately modified modified products corresponding to 8 siRNA motifs B01001, B01012, B01023, B01042, B01047, B01801, B02417, B06001 with better activities in the present disclosure and the modified products modified by templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP are compared with the siRNA motifs similar to the above 8 sequences disclosed in the prior art and the corresponding template-modified sequences in terms of the inhibition rate on the LPA gene.

[0572] 1. Experimental materials

[0573] Test samples:

[0574] (1) Unmodified motifs and modified products disclosed in the prior art, as shown in Table 12.

[0575] Table 12 Sequences disclosed in the prior art

[0576]

[0577] (2)Sequences in this application that are similar to the existing publicly disclosed sequences in Table 12, including the modifiers with alternating 2'-OMe and 2'-F modifications in Example 2, the siRNA sequences with terminal thiolation modification, the unmodified siRNA sequences in Example 1, and the siRNA sequences modified with the modification templates DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP in Example 4. The sequence numbers are shown in Table 13.

[0578] 2. Experimental methods and results

[0579] The dual-luciferase method was used to detect the inhibitory effects of the above siRNA motifs and modified sequences on the LPA gene at the cellular level.

[0580] The experimental materials and methods were referred to 1.2.1 and 1.2.2 in Example 1.

[0581] The experimental results are shown in Table 13.

[0582] Table 13 Inhibitory rates of sequences similar to the siRNA of the present disclosure in the prior art on the LPA gene

[0583]

[0584]

[0585]

[0586] The experimental results show that the siRNA motifs, alternately modified siRNA modifiers, and siRNA modifiers modified with specific modification templates of the present disclosure have significantly improved inhibitory activity on LPA compared with the similar siRNA motifs publicly disclosed in the prior art. For example, compared with B01023P publicly disclosed in the prior art, B01023 of the present disclosure has 4 more bases ACTT at the 3' end of the sense strand and 4 more bases AAGU at the 5' end of the antisense strand. However, the inhibition rate of B01023 of the present disclosure is increased by 22.7% compared with B01023P. The inhibition rate of the alternately modified modifier B01023-AL is 71.3%, which is increased by 26.1% compared with B01023P. The inhibition rate of C01023-DV25P modified with the present disclosure's modification template DV25 reaches 81.2%, which is increased by 36.0% compared with B01023P.

[0587] Example 6: Off-target effects of modifiers

[0588] In the actual application of siRNA, the expression of non-target mRNAs that are partially complementary to the antisense strand is inhibited. Some studies have shown that the hepatotoxicity of the conjugate obtained by conjugating siRNA with N-acetylgalactosamine (GalNAc) is mainly attributed to the inhibition of incorrect targets caused by off-target effects.

[0589] In this example, siRNA modifiers with higher activity in Example 4 were selected, and their inhibition rates on potential off-target genes in human primary hepatocytes (PHH) were measured and compared with the drug Olpasiran.

[0590] 1. Experimental materials

[0591] 1) Test samples:

[0592] 11 siRNA modifiers with higher activity in Example 4 and the positive control APC-OL (see Table 14), where APC-OL represents the corresponding sequence of Olpasiran.

[0593] 2. Experimental methods

[0594] qRT-PCR was used to detect the inhibition rates of the test samples on the expression of the LPA gene and potential off-target genes in PHH cells. Specifically, after each modifier was transfected into PHH cells using liposomes (Lipofectamine RNAiMAX), qPCR was used to detect the inhibition rates of each test sample on the LPA gene and potential off-target genes.

[0595] The experimental materials and methods for PHH cell resuscitation, siRNA transfection, RNA extraction, and reverse transcription refer to 3.2.2 in Example 3. The qPCR amplification of the target gene LPA and the internal reference gene GAPDH was performed using the probe method, and the method refers to 3.2.2 in Example 3. qPCR amplification of the potential off-target genes in Table 14 was performed according to the instruction manual of TB Green Premix Ex Taq (Takara, RR420W).

[0596] 3. Experimental results

[0597] The inhibition rates of the modifiers at concentrations of 40 nM, 10 nM, 2.5 nM, and 0.625 nM on the LPA gene and potential off-target genes, IC 50 As shown in Table 14.

[0598] Table 14 Inhibition rates and IC of modifiers at different concentrations on the LPA gene and potential off-target genes 50

[0599]

[0600]

[0601] Note: Each sequence pair's IC for the LPA gene 50 The data is from Table 11 in 4.4 of Example 4.

[0602] As can be seen from the above table:

[0603] (1) Each of the above sequences can inhibit the LPA gene.

[0604] (2) Only the C01011-DV27P sequence produced an off-target effect on the SPICE1 gene, and its IC for the LPA gene 50 The ratio < 2.2.

[0605] (3) Except for C01011-DV27P, the inhibition rates of other modifiers on potential off-target genes were all lower than 40.7% at a concentration of 40 nM. The IC of other modifiers for potential off-target genes 50 Compared with the IC for the target gene LPA gene 50 Is more than 167 times higher, indicating that the off-target effect of the modifiers of the present disclosure is not obvious.

[0606] Example 7: Inhibition of the LPA gene and potential off-target genes by siRNA modifiers with anti-off-target modifications

[0607] In the prior art, there is a modification method of replacing the 7th nucleotide of the antisense strand of siRNA with glycol nucleic acid (GNA) to disrupt the seed region of the antisense strand, thereby significantly reducing the off-target effect and achieving the reduction of hepatotoxicity. In addition, it has also been found that replacing all the base pairs of the sense and antisense strands at the 1st to 8th nucleotide positions starting from the 5' end of the antisense strand of siRNA with the corresponding DNA can significantly reduce the off-target effect of siRNA without affecting the activity of siRNA.

[0608] Therefore, in this example, in order to reduce the off-target effect, DV25P~DV27P, DV29P, DV32P, DV34P, DV38P, DV25SP~DV27SP, DV29SP, DV32SP, DV34SP, DV38SP modification templates were used to modify the siRNA motifs B01801, B01023, and B02417. The 7th nucleotide or the 5th and 7th nucleotides of the antisense strand were replaced with DNA, and the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand was also replaced with DNA to reduce the off-target effect.

[0609] d7B5 anti-off-target: The 5th and 7th nucleotides of the antisense strand are replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA.

[0610] d7B off-target prevention: The 7th nucleotide of the antisense strand is replaced with DNA, and at the same time, the nucleotide at the position complementary to the 7th nucleotide of the antisense strand in the sense strand is also replaced with DNA.

[0611] The experimental results show that at concentrations from 30 pM to 30 nM, the modified substances with off-target prevention modification have significant inhibitory effects on the target gene LPA, and the inhibition rate of the modified substances on potential off-target genes is significantly lower than that on the target gene. This indicates that the off-target prevention modification does not affect the inhibitory effect of the modified substances with alternating modification and template modification in the present disclosure on the LPA gene, but can inhibit the off-target effect of some sequences.

[0612] 1. Experimental materials

[0613] 1) Test samples:

[0614] The siRNA motifs B01801, B01023, and B02417 adopt the corresponding conjugates with template modification or with template modification + off-target prevention modification (the sequences are shown in Table 19 in Example 9 below).

[0615] 2) Sequence synthesis:

[0616] I. Synthesis of siRNA modified substances with template modification

[0617] The synthesis method refers to that in Example 2, the synthesis method of the alternately modified modified substances.

[0618] II. siRNA modified substances with DNA off-target prevention modification

[0619] Refer to the method for synthesizing siRNA similar to that in Example 2, but when synthesizing the 5th or 7th nucleotide at the 5' end of the antisense strand, or when synthesizing the nucleotide on the sense strand that matches the 7th base at the 5' end of the antisense strand, use the DNA monomer DMT-dA phosphoramidite monomer (Formula 15), DMT-dT phosphoramidite monomer (Formula 16), DMT-dC phosphoramidite monomer (Formula 17), or DMT-dG phosphoramidite monomer (Formula 18), and their respective structures are as follows:

[0620] Formula 15 Formula 16 Formula 17

[0621] Formula 18

[0622] 2. Experimental method

[0623] qRT-PCR was used to detect the inhibitory effects of the test samples on the mRNA expressions of LPA and potential off-target genes in PHH cells. The experimental materials and experimental methods refer to Example 6.

[0624] 3. Experimental Results

[0625] (1)After template modification and then off-target prevention modification, it has significant inhibitory activity on LPA gene expression. For example, after the siRNA motif B01023 was modified with the template DV25P, the inhibition rate of the conjugate D01023-DV25PG101 on the LPA gene expression in human primary hepatocytes reached 86.2%. The inhibition rate of the corresponding conjugate D01023-DV25Pd7B5G101 obtained after modification with the modified template DV25P + off-target prevention modification d7B5 was as high as 87.7%.

[0626] At concentrations of 30 nM, 1 nM, and 0.03 nM, the inhibition rates of each conjugate on LPA gene expression are as follows.

[0627] Table 15 Inhibition Rates of Conjugates Modified with Template and Off-Target Prevention on LPA Gene in Human Primary Hepatocytes

[0628]

[0629] (2)After modification with any one or more of the modification templates disclosed in the present disclosure and then off-target prevention modification, it has a significant off-target prevention effect on potential off-target genes, reducing the inhibitory effect of siRNA on potential off-target genes.

[0630] As shown in Table 16, the experimental results show that

[0631] Using the template modification + off-target prevention modification disclosed in the present disclosure can reduce the inhibitory effect on off-target genes, that is, it has an off-target prevention effect. At the same time, the modifiers / conjugates using the modification methods of the modification templates and off-target prevention modification methods disclosed in the present disclosure can significantly reduce the off-target effect, and the inhibition rate on off-target genes can be reduced by up to 50.7%.

[0632] Table 16 Inhibition Rates of Conjugates Modified with Template, Conjugates Modified with Template + Off-Target Prevention on LPA and Potential Off-Target Genes

[0633]

[0634] 1) Only template modification

[0635] After template modification, there is a certain off-target effect for some conjugates. For example, for the conjugate D01801-DV27PG101 corresponding to the siRNA motif B01801 modified with the DV27P modification template, its inhibition rate for the potential off-target gene ADCY10 is 50.0%; for the conjugate D02417-DV38PG101 corresponding to the siRNA motif B02417 modified with the DV38P modification template, its inhibition rate for the potential off-target gene TAGLN is 36.4%.

[0636] 2) Using template modification + off-target prevention modification (represented by "d7B5" or "d7B" in the siRNA ID numbering rule of the present disclosure)

[0637] For the conjugates simultaneously using template modification + off-target prevention modification, the inhibition rate for potential off-target genes is significantly reduced, showing a significant off-target prevention effect. For example, the inhibition rate of D01801-DV27Pd7BG101 for ADCY10 is reduced by 32.9%, which is significantly reduced; the inhibition rate of D02417-DV38Pd7B5G101 for TAGLN is reduced by 41.4%, which is significantly reduced.

[0638] Example 8: Inhibitory effect of siRNA modifiers and corresponding siRNA conjugates modified with the modification template of the present disclosure on LPA in human primary hepatocytes

[0639] In this example, the inhibition rates of the sequences with higher activities in Example 4 for potential off-target genes in human primary hepatocytes were measured and compared with Olpasiran. For the 8 motifs B01001, B01012, B01023, B01042, B01801, B02417, B06001, and B01047, they were respectively modified with the modification templates shown in Table 17 and conjugated with conjugation groups to prepare the corresponding siRNA conjugates. In the concentration range of 0.03 nM to 30 nM, these siRNA conjugates were used to treat human primary hepatocytes by liposome transfection, and the dose-effect relationship curve was fitted and the IC of each corresponding siRNA was calculated 50 .

[0640] 1. Experimental materials

[0641] 1) Test samples:

[0642] The conjugates in Table 17 include the conjugates modified with the template of the present application and the conjugates simultaneously using the template modification and off-target prevention modification of the present application, and a GalNAc conjugation group G103 is connected to the 3' end of the siRNA sense strand:

[0643]

[0644] The method for connecting the oligonucleotide with the conjugation group G103 can refer to Example 3 of Patent Application CN116854754A.

[0645] The oligonucleotide and the conjugation group form a conjugate as shown below:

[0646] 。

[0647] For the specific list of each conjugate and its corresponding motif, see Table 17. "G103" in the siRNA ID indicates connection with the GalNAc conjugation group G103.

[0648] Cell type: Human primary hepatocytes, provided by Liwo Biotechnology Co., Ltd. (Product number: LV-PHH001).

[0649] 2. Experimental methods

[0650] qRT-PCR was used to detect the inhibitory effect of the test sample on the mRNA expression of the LPA gene in human primary hepatocytes. For the specific experimental materials and methods, see 1.2.2 in Example 1.

[0651] 3. Experimental results

[0652] The inhibition rates of siRNAs at different concentrations on LPA are shown in Table 17 below. It can be seen that they all have an obvious inhibitory effect on LPA, and the IC 50 is between 0.005 nM - 0.030 nM. For example, the inhibition rate of D01023-DV25Pd7B5G103 at a concentration of 30 nM on LPA reached 86.4%, and the IC 50 was 0.016 nM. In addition, the IC 50 of some sequences is better than that of the positive control Olpasiran. For example, the IC 50 of D01023-DV25Pd7B5G103 is 0.016 nM, which is better than 0.027 nM of the positive control.

[0653] Table 17 Inhibition rates of siRNAs at different concentrations on LPA in human primary hepatocytes and IC 50

[0654]

[0655] Example 9: Inhibitory effect of the corresponding conjugate of the modified product modified with the template disclosed in this application on LPA in mouse serum

[0656] This example selects some sequences, including siRNA motifs B01001, B01012, B01023, B01042, B01047, B01801, B02417, and B06001, and modifies these motifs, for example, only using the template of the present application for modification, or using the template of the present application for modification + anti-off-target modification. The positive control is Olpasiran, a candidate drug currently in the clinical phase III stage. Using transgenic mice expressing the human LPA gene, ELISA was used to detect the inhibitory effect on LPA in serum at different time points.

[0657] 1. Experimental Materials

[0658] Tested drugs:

[0659] The sequences in Tables 18 and 19 are sequences using template modification and sequences using both template modification and anti-off-target design. The 3' end of the sense strand of these sequences is connected to the GalNAc conjugated group G101 or G103:

[0660] , .

[0661] For the method of connecting the oligonucleotide to G101 or G103, see Example 3 of patent application CN116854754A.

[0662] The oligonucleotide forms a conjugate with the conjugating group as shown below:

[0663] ,

[0664] .

[0665] The specific list of each conjugate is shown in Tables 18 and 19. "G103" in the siRNA ID indicates that it is connected to the GalNAc conjugated group G103, and G101 in the sequence number indicates that the sequence is connected to the GalNAc conjugated group G101. The sequence of Olpasiran is that the 5' end of the sense strand of APC-OL is connected to the GalNAc conjugated group NAG25 (i.e., GR1). The structure of the conjugated group NAG25 can be found in the content disclosed in CN113507920A, for example.

[0666] In this experiment, the corresponding conjugate of motif B01047 with template modification and off-target modification was compared with the conjugate sequence Geno-1-107M (see Qian Li et al., Application of improved GalNAc conjugation in development of cost-effective siRNA therapies targeting cardiovascular diseases, Molecular Therapy, Vol. 32, No. 3, 2024) disclosed in the prior art, which is similar to the B01047 basic sequence, in terms of in vivo effects.

[0667] Table 18 Examples of conjugate designs linking G103

[0668]

[0669]

[0670] Table 19 Examples of conjugate designs linking G101

[0671]

[0672] Solvent: Sterile PBS

[0673] 2. Experimental methods

[0674] C57BL / 6-hLPA transgenic mice aged 6 - 8 weeks (provided by Shanghai Model Organisms Center, Inc.), male, were placed in the breeding facility. After 7 days of adaptive feeding, blood was collected and serum was separated. The content of hLPA protein in the serum was detected using an ELISA kit (Abcam, ab212165). The mice were randomly grouped based on the content of hLPA protein in the serum, with 6 mice in each group. The mice were subcutaneously administered a single dose of 1 mg / kg or 0.5 mg / kg (the administration day was recorded as day 0, D0). Serum was collected from the mice every 7 days after administration to detect the expression level of hLPA protein in the serum. The inhibition rate of hLPA protein expression was calculated according to the following formula:

[0675] Inhibition rate % = [LPA content (PBS group) – LPA content (administered group)] / LPA content (PBS group) × 100%

[0676] 3. Experimental results

[0677] Table 20 Experiment on hLPA transgenic mice at 1 mg / kg - Inhibition rate

[0678]

[0679]

[0680] As can be seen from the above table, the conjugate formed by conjugating the modifier with the conjugate group has a significant inhibitory effect on the expression of LPA protein in serum after subcutaneous administration at a single dose of 1 mg / kg. For example, the inhibition rates of D01023-DV25Pd7B5G103 reached 76.1%, 72.0% and 73.4% on the 7th day, 14th day and 21st day, respectively.

[0681] Compared with Geno-1-107M disclosed in the prior art, the corresponding conjugates D01047-DV26SPG103, D01047-DV29SPd7BG103 and D01047-DV29SPG103 of the motif B01047 of the present disclosure have significantly improved inhibitory effects in mice.

[0682] Table 21 Inhibition rate of 0.5 mg / kg experiment on hLPA transgenic mice

[0683]

[0684] As can be seen from the above table, after subcutaneous administration at a single dose of 0.5 mg / kg, each conjugate has a significant inhibitory effect on the expression of LPA protein in serum. For example, the inhibition rates of D01023-DV25Pd7B5G101 reached 67.0%, 73.5% and 77.4% on the 7th day, 14th day and 21st day, respectively.

[0685] The above in-vivo experimental results show that the siRNA motifs of the present disclosure, such as B01001, B01012, B01023, B01042, B01047, B01801, B02417 and B06001, after being conjugated with the GalNAc conjugate group by using the template modification of the present disclosure or the template + off-target prevention modification of the present disclosure, can be efficiently delivered to the animal liver and significantly inhibit LPA expression.

[0686] Example 10: Inhibitory effect of the sequences modified with the modification template of the present disclosure on LPA in cynomolgus monkey serum

[0687] In this example, some sequences are exemplarily selected, including the siRNA motifs B01023, B01801, B02417, and these sequences are modified, for example, only using template modification, or using both template modification and off-target prevention design. The positive control drug is the siRNA drug Olpasiran currently in clinical phase III. After administration in cynomolgus monkeys, ELISA is used to detect the inhibitory effect of the above sequences on LPA in serum at different time points.

[0688] 1. Experimental materials

[0689] Test articles: D01023-DV25Pd7B5G101, D01801-DV27PG101, D01801-DV27Pd7BG101, D02417-DV38PG101, D02417-DV38Pd7B5G101 and the positive control Olpasiran. For the above 6 compounds, the specific sequence design rules are shown in Table 19. The synthesis method is shown in Example 9.

[0690] Solvent: Sterile normal saline.

[0691] 2. Experimental methods

[0692] Eighteen cynomolgus monkeys aged 2.5 to 6 years old, male, weighing 2 to 6 kg, were introduced into the breeding facility. After 7 days of adaptive feeding, blood was collected and serum was separated. The content of LPA protein in the serum was detected using an ELISA kit (Mercodia, Cat No. 10-1106-01). Random grouping was performed based on the serum LPA content, with 3 monkeys in each group. A single dose of 1 mg / kg was administered subcutaneously (the administration day was recorded as Day 0, D0). Serum of cynomolgus monkeys was collected every 7 days after administration to detect the expression level of LPA protein. The inhibition rate of LPA protein expression was calculated according to the following formula:

[0693] Inhibition rate % = [LPA content (before administration) – LPA content (after administration)] / LPA content (before administration) × 100%

[0694] On Day -9 before administration and Days 28 and 53 after administration, the animals were anesthetized. The puncture area was disinfected with povidone iodine and alcohol successively. After determining the positions of the liver and the puncture needle using a B-ultrasound machine, a biopsy puncture needle was inserted. After obtaining liver tissue, total RNA of the liver tissue was extracted. The mRNA of LPA and the internal reference gene GAPDH in the liver tissue were amplified using qPCR. The inhibition rate of LPA gene mRNA expression in the liver tissue of cynomolgus monkeys was calculated according to the following formula:

[0695] ΔCT = Average Ct value of the target gene - Average Ct value of the internal reference gene;

[0696] ΔΔCT = ΔCT (after administration) - ΔCT (before administration);

[0697] Relative expression level of the target gene mRNA = 2 -ΔΔCT

[0698] Inhibition rate = (1 – Relative expression level after administration / Relative expression level before administration) × 100%

[0699] 3. Experimental results

[0700] The inhibition rate detection results are shown in Table 22, Figure 1 .

[0701] Table 22 Inhibition Rate - Serum

[0702]

[0703] As can be seen from the above table, the conjugates formed by conjugating each sequence with the GalNAc compound had a significant inhibitory effect on the expression of LPA protein in serum after subcutaneous administration at a single dose of 1 mg / kg. For example, the inhibition rate of D01023-DV25Pd7B5G103 on serum LPA reached 92.9% on the 21st day, and the inhibition rate on serum LPA was still 92.0% on the 70th day after administration, indicating that the efficacy of this sequence lasted for a relatively long time in cynomolgus monkeys. Compared with the highest inhibition rate of 83.4% of the positive control, it had a significant efficacy advantage.

[0704] The data on the inhibition of LPA mRNA expression in the liver of cynomolgus monkeys by each test substance are shown in Table 23 and Figure 2 .

[0705] Table 23 Inhibition Rate - Liver

[0706]

[0707] The results showed that on the 28th and 53rd days after administration (D28, D53), compared with before administration (D-9), the five test substances significantly inhibited the expression of LPA mRNA in the liver tissue of cynomolgus monkeys. For example, for D01023-DV25Pd7B5G101, the inhibition rate of LPA was 93.4% on D28 and 95.5% on D53 after administration, which was significantly better than the inhibition rate of the positive control at the same time points (the LPA inhibition rate of the positive control Olpasiran was 62.8% on D28 and 78.7% on D53).

[0708] The above in-vivo experimental results of cynomolgus monkeys show that the siRNA motifs of the present disclosure, such as B01023, B01801, and B02417, whether they are siRNA modifiers obtained by modifying with the templates of the present disclosure or siRNA modifiers obtained after further off-target prevention modification, can be efficiently delivered to the liver of cynomolgus monkeys after conjugation with the conjugation group and significantly inhibit the expression of the LPA gene.

Claims

1. A siRNA duplex, characterized in that: The siRNA duplex includes a sense strand and an antisense strand forming a reverse complementary double-stranded region, and the antisense strand includes at least 15, 16, 17, 18 or 19 consecutive nucleotide fragments or modified fragments thereof that are complementary to the target sequence as shown in SEQ ID NO: 184, as shown in SEQ ID NO: 76, as shown in SEQ ID NO: 132, as shown in SEQ ID NO: 419 or as shown in SEQ ID NO:

420.

2. The siRNA duplex according to claim 1, wherein The antisense strand comprises at least 15, 16, 17, 18 or 19 consecutive nucleotide fragments or modified fragments thereof in a sequence as shown in any one of SEQ ID NOs: 194, 214, 232, 237, 269, 325, 377 and 379; and / or, the positive strand comprises at least 15, 16, 17, 18 or 19 consecutive nucleotide fragments or modified fragments thereof in a sequence as shown in any one of SEQ ID NOs: 1, 21, 39, 44, 76, 132, 184 and 186.

3. The siRNA duplex according to claim 1, wherein The siRNA duplex satisfies one or more of the following conditions: (1) The length of the reverse complementary double-stranded region is 17 to 21 bp; (2) The sense strand and antisense strand are independently 19-23 nucleotides in length; (3) at least one strand contains a 3' overhang of at least 1 or at least 2 nucleotides; and, (4) The siRNA duplex is an RNAi agent for inhibiting the expression of the LPA gene.

4. The siRNA duplex according to claim 1, wherein The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of sense strand and antisense strand pairs: (1) the sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence thereof; (2) the sense strand has a sequence as shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence thereof; (3) the sense strand has a sequence as shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence thereof; (4) the sense strand has a sequence as shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence thereof; (5) the sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence thereof; (6) the sense strand has a sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence thereof; (7) the sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence thereof; and, (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof.

5. The siRNA duplex according to claim 1, wherein The sense strand or the antisense strand comprises at least one modified nucleotide selected from deoxy-nucleotides, 3'-terminal deoxy-thymine (dT) nucleotides, 2'-O-methyl modified nucleotides, 2'-fluoro modified nucleotides, 2'-deoxy-modified nucleotides, locked nucleotides, unlocked nucleotides, conformationally restricted nucleotides, restricted ethyl nucleotides, abasic nucleotides, 2'-amino-modified nucleotides, 2'-O-allyl-modified nucleotides, 2'-C-alkyl-modified nucleotides, 2'-hydroxy-modified nucleotides, 2'-methoxyethyl-modified nucleotides, 2'-O-alkyl-modified nucleotides, morpholino nucleotides, phosphoramidates, nucleotides containing non-natural bases, tetrahydropyran-modified nucleotides, 1,5-anhydrohexitol-modified nucleotides, cyclohexenyl-modified nucleotides, nucleotides containing phosphorothioate groups, nucleotides containing methylphosphonate groups, nucleotides containing 5'-phosphates, and nucleotides containing 5'-phosphate mimetics, and combinations thereof.

6. The siRNA duplex according to claim 5, characterized in that All nucleotide modifications on the sense strand and the antisense strand are modifications of the 2' position of the nucleotide ribose.

7. The siRNA duplex according to claim 6, wherein The modification of the 2' position of the ribose of the nucleotide is selected from any one or a combination of 2'-methoxy, 2'-methoxyethyl, 2'-fluoro, 2'-benzyloxy, 2'-methylcarbonylamino and 2'-pyridinemethoxy.

8. The siRNA duplex according to claim 7, wherein The modification of the 2' position of the ribose of the nucleotide is selected from an alternating combination of 2'-methoxy and 2'-fluoro.

9. The siRNA duplex according to claim 8, wherein The modification mode of the 2' position of the nucleotide ribose is: the odd-numbered positions of the sense chain are all 2'-fluoro modified, and the even-numbered positions are all 2'-methoxy modified; and the odd-numbered positions of the antisense chain are all 2'-methoxy modified, and the even-numbered positions are all 2'-fluoro modified.

10. The siRNA duplex according to claim 1, wherein Nucleotide monomers are linked to each other by 3',5'-phosphodiester bonds or 3',5'-phosphothioate bonds.

11. The siRNA duplex according to claim 1, wherein The 3',5'-phosphodiester bonds between nucleotides at the sequence ends of the siRNA duplex contain thio modifications and form chirally pure 3',5'-phosphothioate diester bonds, wherein the 5' ends of the sense strand and the antisense strand contain 1-3 thio linkages, and the 3' end of the antisense strand contains 1-3 thio linkages.

12. The siRNA duplex according to claim 1, wherein The phosphorylation of the 5'-position carbon atom of the 5'-terminal nucleotide glycoside of the modified antisense strand, wherein the phosphorylation of the 5'-position carbon atom is selected from the following 5'-position phosphorylation groups: 5'-vinyl phosphonate group (5'-E-VP); 5'-methyl phosphonate group (5'-MP); 5'-C-methyl phosphate group; 5'-thiophosphate group (5'-PS) and 5'-phosphate group (5'-P), and their structures are shown below: ； Wherein, R is hydrogen, hydroxyl, amine, C 1-4 Alkyl, aromatic, C 1-4 Alkoxy, C 1-4 Alkylcarbonylamino or halogen; The base is selected from adenine, guanine, cytosine, thymine and uracil.

13. The siRNA duplex according to claim 1, wherein The siRNA duplex has the following modifications: The antisense strand has any one of the following modification modes A to F: ； And / or, the sense strand has any one of the following modification modes a or b: ； or, The antisense strand has any one of the following modifications A' to F': ； And / or, the sense strand adopts modification a' or b': ； Among them, 2'-OMe represents 2'-methoxy; 2'-F represents 2'-fluoro; PS means starting from the 5' end, the nucleotide at this position and the adjacent nucleotide on the right are connected by a 3',5'-phosphorothioate bond; EVP represents 5'-vinyl-(E)-phosphonate.

14. The siRNA duplex of claim 13, wherein: The antisense strand is modified using modification method A, and the sense strand is modified using modification method a; The antisense strand is modified using modification method B, and the sense strand is modified using modification method a; The antisense strand is modified using modification method C, and the sense strand is modified using modification method a; The antisense strand is modified using modification method D, and the sense strand is modified using modification method a; The antisense strand is modified using modification method E, and the sense strand is modified using modification method a; The antisense strand is modified using modification method F, and the sense strand is modified using modification method a; The antisense strand is modified using modification method A, and the sense strand is modified using modification method b; The antisense strand is modified by modification method B, and the sense strand is modified by modification method b; The antisense strand is modified by modification method C, and the sense strand is modified by modification method b; The antisense strand is modified by modification method D, and the sense strand is modified by modification method b; The antisense strand is modified using modification method E, and the sense strand is modified using modification method b; or, The antisense strand is modified by modification method F, and the sense strand is modified by modification method b; or, The antisense strand is modified by modification method A', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method B', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method C', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method D', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method E', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method F', and the sense strand is modified by modification method a'; The antisense strand is modified by modification method A', and the sense strand is modified by modification method b'; The antisense strand is modified by modification method B', and the sense strand is modified by modification method b'; The antisense strand is modified by modification method C', and the sense strand is modified by modification method b'; The antisense strand is modified by modification method D', and the sense strand is modified by modification method b'; The antisense strand is modified by modification method E', and the sense strand is modified by modification method b'; or, The antisense strand was modified using modification F', and the sense strand was modified using modification b'.

15. The siRNA duplex according to claim 1, wherein The antisense strand uses a modification group to modify nucleotides in the second to eighth positions from the 5' end, wherein the modification group is selected from UNA, GNA and DNA, wherein the structures of UNA and GNA are as follows: ； The base is selected from adenine, guanine, cytosine, thymine and uracil.

16. The siRNA duplex according to claim 1, wherein The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of sense strand and antisense strand pairs: (1) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method B, and the sense strand adopts modification method a; (2) The sense strand has a sequence as shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method A and the sense strand adopts modification method a; (3) The sense strand has a sequence as shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C' and the sense strand adopts modification method a'; (4) the sense strand has a sequence as shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C' and the sense strand adopts modification method b'; (5) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E and the sense strand adopts modification method b; (6) The sense strand has a sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method B and the sense strand adopts modification method a; (7) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C and the sense strand adopts modification method a; (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E and the sense strand adopts modification method b; (9) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method A, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced with DNA; (10) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced with DNA; and, (11) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E, and the sense strand adopts modification method b; the 5th and 7th nucleotides of the antisense strand are replaced by DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced by DNA.

17. A siRNA conjugate, characterized in that The conjugate comprises the siRNA duplex according to any one of claims 1 to 16, and a conjugated group connected thereto.

18. The conjugate according to claim 17, characterized in that The conjugated group is linked to the 3'-end or 5'-end of the sense strand of the oligonucleotide; and / or, the conjugated group is a GalNAc derivative attached using a divalent or trivalent branched linker.

19. The conjugate according to claim 17, characterized in that The conjugated group is: ， wherein X is a hydroxyl protecting group or H, wherein the hydroxyl protecting group is selected from acetyl, benzoyl or isobutyryl; Y is an amine protecting group or H, wherein the amine protecting group is selected from formyl, acetyl, propionyl, n-butyryl or isobutyryl; n is an integer of 0-20; and q, r and s are independently integers of 1-7.

20. The conjugate according to claim 19, characterized in that The conjugated group is: 。 21. The conjugate according to claim 17, characterized in that The conjugated group is: ， Wherein, X is oxygen, -N(Y)- or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 is hydrogen, -NH2, C 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g -, g is an integer from 1 to 6; Y1 is 0 or 1; Y2 is 0, 1 or 2; When Y3 is 1, X3 is CH2; when Y3 is 2, X3 is CH; when Y3 is 3, X3 is carbon; m is an integer from 0 to 4; n is an integer from 0 to 4.

22. The conjugate according to claim 21, characterized in that The conjugated group is G4, G5, G6 or G7, and its structure is shown below: ， ， ， 。 23. The conjugate according to claim 17, characterized in that The conjugate has any of the following structures: ， ， ， ,and 。 24. The conjugate according to claim 17, characterized in that The conjugated group is: ， Wherein, X is oxygen, -N(Y)- or sulfur; Y is C 1-4 Alkyl or C 6-10 Aryl; R1 is oxygen or sulfur; R2 is hydrogen, -NH2, C 1-4 Alkyl, C 6-10 Aryl, C 1-4 Alkoxy or halogen; A is -(CH2) a -、-(CH2CH2O) b -、-((CH2) c NHCO) d -or-((CH2) c CONH) d -, wherein a is an integer from 1 to 15, b is an integer from 1 to 7, c is an integer from 1 to 7, and d is an integer from 1 to 5; B is -(CH2) e -, where e is an integer from 0 to 7; L is -CONH- or -NHCO-; X1 is -(CH2) f -or-(CH2CH2O) f CH2-, f is an integer from 1 to 5; X2 is -(CH2) g -, g is an integer from 1 to 6; X3 is oxygen or sulfur; Y1 is 0 or 1; Y2 is 0, 1 or 2; When Y3 is 1, X4 is CH2; when Y3 is 2, X4 is CH; when Y3 is 3, X3 is carbon; m is an integer from 0 to 4; n is an integer from 0 to 4; q is an integer from 0 to 4.

25. The conjugate according to claim 24, characterized in that The conjugated group is G101, G102, G103, G105 or G106: , , , ,or .

26. The conjugate according to claim 25, characterized in that The conjugate has any of the following structures: ， ， ， ,or 。 27. The conjugate according to claim 17, characterized in that The siRNA duplex comprises any one or a combination of at least two of the following oligonucleotide duplexes consisting of sense strand and antisense strand pairs: (1) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method B, and the sense strand adopts modification method a; (2) The sense strand has a sequence as shown in SEQ ID NO: 1 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 194 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method A and the sense strand adopts modification method a; (3) The sense strand has a sequence as shown in SEQ ID NO: 39 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 232 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C' and the sense strand adopts modification method a'; (4) the sense strand has a sequence as shown in SEQ ID NO: 44 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 237 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C' and the sense strand adopts modification method b'; (5) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E and the sense strand adopts modification method b; (6) The sense strand has a sequence as shown in SEQ ID NO: 132 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 325 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method B and the sense strand adopts modification method a; (7) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C and the sense strand adopts modification method a; (8) The sense strand has a sequence as shown in SEQ ID NO: 186 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 379 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E and the sense strand adopts modification method b; (9) The sense strand has a sequence as shown in SEQ ID NO: 21 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 214 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method A, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced with DNA; (10) The sense strand has a sequence as shown in SEQ ID NO: 184 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 377 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method C, and the sense strand adopts modification method a; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced with DNA; (11) The sense strand has a sequence as shown in SEQ ID NO: 76 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; and the antisense strand has a sequence as shown in SEQ ID NO: 269 or a fragment thereof, or a modified sequence of the sequence or a fragment thereof; wherein the antisense strand adopts modification method E, and the sense strand adopts modification method b; the 5th and 7th nucleotides of the antisense strand are replaced with DNA, and the nucleotide at the complementary pairing position with the 7th nucleotide of the antisense strand is also replaced with DNA; Wherein, any one or both of the sense strand and the antisense strand are connected to the conjugated group G4, G5, G6, G7, G101, G102, G103, G105 or G106.

28. The conjugate according to claim 27, characterized in that The conjugated group is attached to the 3' end of the sense strand.

29. A nucleic acid-protein complex, characterized in that: The nucleic acid-protein complex comprises the double-stranded region of the siRNA duplex as described in any one of claims 1-16, and a nuclease; or, the nucleic acid-protein complex comprises the antisense strand of the double-stranded region of the siRNA duplex as described in any one of claims 1-16, and a nuclease.

30. The nucleic acid-protein complex according to claim 29, wherein The nuclease is AGO protein.

31. A pharmaceutical composition, characterized in that The pharmaceutical composition comprises the siRNA duplex according to any one of claims 1 to 16, the conjugate according to any one of claims 17 to 28, or the nucleic acid-protein complex according to claim 29 or 30, and a pharmaceutically acceptable carrier.

32. Use of the siRNA duplex according to any one of claims 1 to 16, the conjugate according to any one of claims 17 to 28, the nucleic acid-protein complex according to claim 29 or 30, or the pharmaceutical composition according to claim 31 in the preparation of a drug for preventing or treating a disease associated with LPA gene expression.

33. Use of the siRNA duplex according to any one of claims 1 to 16, the conjugate according to any one of claims 17 to 28, the nucleic acid-protein complex according to claim 29 or 30, or the pharmaceutical composition according to claim 31 in the preparation of a drug for preventing or treating cardiovascular and cerebrovascular diseases.

Images