Gstf13 gene, polypeptide, plasmid and their application
By cloning and overexpressing the GSTF13 gene, the problem of plant resistance to quizalofop-p-ethyl was solved, providing GSTF13 gene resources with independent intellectual property rights, and cultivating resistant transgenic crops, thereby improving the diversity and resistance level of transgenic crops.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- HUNAN AGRI UNIV
- Filing Date
- 2025-03-03
- Publication Date
- 2026-04-17
AI Technical Summary
No specific GST gene that can confer resistance to quizalofop-p-ethyl has been found in the existing technology, and foreign patent protection makes the industrialization of genetically modified organisms face obstacles in terms of patent rights.
By identifying and cloning the GSTF13 gene resistant to quizalofop-p-ethyl, overexpressing the gene in plants, constructing a plasmid vector, and achieving efficient expression of the GSTF13 gene in plants, transgenic plants resistant to quizalofop-p-ethyl were cultivated.
It provides GSTF13 gene resources with completely independent intellectual property rights, and cultivates transgenic crops with herbicide resistance, solving the problem of plant resistance to quizalofop-p-ethyl and improving the diversity and resistance level of transgenic crops.
Smart Images

Figure CN120118926B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of plant genetic engineering technology, specifically to the herbicide-resistant gene GSTF13 and its encoded protein, vectors, and their applications in herbicide resistance and in the breeding of herbicide-resistant transgenic plants. Background Technology
[0002] The mechanism of action of aryloxyphenoxypropinoate (APP) herbicides primarily involves inhibiting the activity of acetyl-CoA carboxylase (ACCase) in plants, thereby blocking fatty acid synthesis and leading to plant death. As a key enzyme catalyzing fatty acid synthesis, the inhibition of ACCase activity directly affects the synthesis of malonyl-CoA, a crucial metabolic intermediate in fatty acid synthesis and flavonoid biosynthesis. Blocked malonyl-CoA synthesis leads to disruption of plant membrane structure, increased permeability, and cell damage, ultimately causing plant death. In gramineous crops such as wheat and rice, specific ACCase site mutations have been shown to reduce sensitivity to APP herbicides. Expression of these mutant ACCase proteins in plants can confer resistance to APP herbicides. The expression of ACCase mutations at relevant sites in wheat and rice to acquire resistance has been patented (Chinese Patents: 112410308A, 109355264B). To improve the resistance level of genetically modified crops and increase the diversity of resistance genes, the field is still seeking new herbicide-resistant genes and their application in genetically modified herbicide-resistant plants.
[0003] Glutathione S-transferases (GSTs) are a family of multifunctional enzymes widely distributed in organisms, playing roles in various biological tissues, including animals, plants, and microorganisms. They catalyze the binding of glutathione (GSH) to various endogenous and exogenous electrophilic compounds, forming conjugates that are more easily excreted and less toxic. In medical research, GSTs play a crucial role in the development of resistance to anticancer drugs. This has also attracted the attention of pesticide researchers.
[0004] Fenoxaprop-P-ethyl is an aryloxyphenoxypropionate (APP) herbicide with advantages such as high efficiency, broad spectrum, low toxicity, and low residue, and has been widely used in agricultural production. As a selective systemic herbicide applied through foliar application, fenoxaprop-P-ethyl is absorbed by the stems and leaves and translocated to the leaf base, internode meristem, and root growth point. It inhibits fatty acid biosynthesis in weeds by suppressing acetyl-CoA carboxylase (ACCase) activity, damaging weed growth points and meristems, thereby inhibiting weed growth, causing chlorosis, browning, and death, thus reducing or eliminating the impact of weeds on crops and increasing crop yield.
[0005] To date, no specific GST gene capable of degrading quizalofop-p-ethyl and conferring plant resistance has been identified. This invention aims to fill this research gap by identifying and utilizing such GST genes to provide new molecular tools for breeding herbicide-resistant crops and managing pesticide resistance.
[0006] It is known that the endogenous resistance sites of major herbicide target genes such as EPSPS, ACCase, ALS, and HPPD are mostly protected by patents held by foreign commercial companies. A more serious issue is that these multinational corporations have been extending the protection of their core patents by making minor modifications to the gene sequences, effectively turning them into "new" patents and circumventing the so-called 20-year patent term, attempting to monopolize these functional genes and transformation technologies. In recent years, my country has also obtained some ACCase gene patent authorizations (Chinese patents: 109371000 B, 109082416 A), but most of our patents are based on foreign core patents. If we want to industrialize transgenic technology, the "patent usage rights" held by foreign companies are an unavoidable hurdle. Summary of the Invention
[0007] This invention first discovered a clethodim-resistant *Alopecurus aequalis* variety, then cloned its GST gene GSTF13 using its genomic sequence information, and further demonstrated the clethodim resistance of the GSTF13 gene in rice and its use in developing transgenic clethodim-resistant crops. The novel glutathione S-transferase gene GSTF13 involved in this invention has not been reported to possess clethodim resistance capabilities prior to this invention.
[0008] The primary objective of this invention is to provide a quizalofop-p-ethyl gene that can be efficiently expressed in plants, and this sequence can be transferred into plants to cultivate novel transgenic plants tolerant to quizalofop-p-ethyl.
[0009] A glutathione transferase gene GSTF13, the nucleotide sequence of which is SEQ ID NO:1 or has a sequence with not less than 80% identity with SEQ ID NO:1.
[0010] A secondary objective of the present invention is to provide a protein polypeptide encoded by the above-described nucleotide sequence.
[0011] A third objective of this invention is to provide a plasmid comprising an expression cassette formed by linking the nucleotide sequence molecule with a nucleotide sequence controlling expression.
[0012] A fourth object of the present invention is to provide the use of the glutathione transferase gene GSTF13, or the plasmid, to express the glutathione transferase gene GSTF13 in plants through transgenic expression, thereby enabling the plants to acquire herbicide resistance.
[0013] Furthermore,
[0014] The herbicides mentioned include aryloxyphenoxypropionates, and more specifically, quizalofop-p-ethyl.
[0015] The plants include rice, corn, soybeans, cotton, wheat, turfgrass, or pasture.
[0016] A fifth object of the present invention is to provide the application of the said gene, the said polypeptide, or the said plasmid in the breeding of herbicide-resistant transgenic plants.
[0017] The plants include: rice, corn, cotton, wheat, soybeans, turfgrass, or pasture.
[0018] The sixth objective of this invention is to provide a method for modifying plants, comprising using plant gene transformation technology to introduce an expression cassette containing the nucleotide sequence molecule and a nucleotide sequence controlling expression into plant cells, and then differentiating and cultivating the cassette into corresponding transgenic plants, the obtained plants having herbicide resistance.
[0019] Furthermore, the plants include: rice, corn, cotton, wheat, soybeans, turfgrass, or pasture.
[0020] Using the nucleotide sequence of the anti-quizalofop-p-ethyl gene provided by this invention, an artificial gene capable of being expressed in plants can be constructed. Similarly, the anti-quizalofop-p-ethyl protein polypeptide sequence provided by this invention can also be used to artificially synthesize nucleic acid sequences and further construct artificial gene vectors capable of being expressed in plants. The components of the artificial gene vector capable of being expressed in plants include a promoter, an anti-quizalofop-p-ethyl gene, and a terminator. For example, when transforming monocotyledonous plants, the promoter can be the maize Ubiqutin-1 promoter or the rice Actin promoter; and the terminator can be the Agrobacterium tumefaciens terminator (Nos) or other terminators. This expression component can be integrated into the plant genome using Agrobacterium (such as Agrobacterium strains), gene gun methods, or other methods to obtain transgenic plants resistant to quizalofop-p-ethyl. For example, it can be introduced into immature embryos, mature embryos, undifferentiated callus tissue, or protoplasts of plants using Agrobacterium or a gene gun. Then, selection culture is performed using 0.5 to 18 μM quizalofop-p-ethyl medium. Transformed shoots are then obtained through differentiation, and after culturing in rooting medium, transgenic seedlings suitable for planting can be obtained. Furthermore, transgenic plants resistant to quizalofop-p-ethyl can be screened by spraying with quizalofop-p-ethyl.
[0021] This invention is applicable to all plants, including dicotyledonous and monocotyledonous plants.
[0022] Beneficial effects of the invention
[0023] This invention elucidates the mechanism of weed resistance to herbicides, discovers a new herbicide resistance gene resource, glutathione-S-transferase gene GSTF13, with completely independent intellectual property rights, and cultivates herbicide-resistant crop germplasm materials with completely independent intellectual property rights based on the new functional gene, providing a guarantee for the cultivation of new herbicide-resistant transgenic crop varieties in my country to be independent of others. Attached Figure Description
[0024] The specific embodiments of the present invention will be further described in detail below with reference to the accompanying drawings.
[0025] Figure 1 Sensitivity (S) and resistance (R) were observed in the growth status of *Alopecurus aequalis* populations under treatment with quizalofop-p-ethyl.
[0026] Figure 2 Schematic diagram of plant expression vector construction. The expression frame consists of a promoter, the clematis-resistant herbicide gene AaGSTF13, and a terminator;
[0027] Figure 3 See the results of the tolerance test of rice callus to quizalofop-p-ethyl in the herbicide-resistant gene GSTF13 of wheatgrass;
[0028] Figure 4See the results of the herbicide resistance test on rice plants with the herbicide-resistant gene GSTF13 from *Alopecurus aequalis* to quizalofop-p-ethyl. Detailed Implementation
[0029] The present invention will be further described below with reference to specific embodiments, but the scope of protection of the present invention is not limited thereto. It should be understood that these embodiments are only used to illustrate the method of the present invention and are not intended to limit the scope of the present invention. All experimental methods not specifically described or otherwise specified are conventional conditions and methods well known to those skilled in the art.
[0030] Example 1: Resistance determination of quizalofop-p-ethyl against Alopecurus aestivum
[0031] *Alopecurus aequalis*, belonging to the Poaceae family, is an annual weed and a common, noxious weed found in farmland, widely distributed in rice-wheat stubble fields and rapeseed fields in the middle and lower reaches of the Yangtze River in my country. To determine the resistance level of *Alopecurus aequalis* to quizalofop-p-ethyl, a whole-plant assay was used to study the sensitivity of collected *Alopecurus aequalis* biotypes to quizalofop-p-ethyl. The results showed that the collected resistant *Alopecurus aequalis* biotype R was able to resist quizalofop-p-ethyl at 248.4 g aiha. -1 Normal growth was observed at 4 times the field recommended dose of quizalofop-p-ethyl (GR), while the medium dose of GR inhibited fresh weight growth. 50 The value is 155g aiha -1 The control group, based on the sensitivity of biotype S of *Alopecurus aequalis*, could not tolerate 31.05g of aiha. -1 Under conditions of 1 / 2 times the field recommended dose, its GR 50 The value is 9.7g aiha -1 The relative resistance multiple reached 16 times ( Figure 1 Therefore, the resistant *Alopecurus aequalis* biotype may contain genes resistant to quizalofop-p-ethyl.
[0032] Example 2 Cloning of the resistance gene
[0033] A plant's resistance to quizalofop-p-ethyl may involve multiple mechanisms, such as possessing a mutation or overexpression of the ACCase gene resistant to quizalofop-p-ethyl; possessing an enzyme capable of degrading quizalofop-p-ethyl; limiting the uptake of quizalofop-p-ethyl; or possessing an enzyme that modifies quizalofop-p-ethyl, rendering it inactive. To study the target resistance mechanism in resistant *Alopecurus aequalis* populations, 10 plants from each resistant population were selected for cloning the acetyl-CoA carboxylase (ACCase, EC. 6.4.1.2) fragment, a target gene for quizalofop-p-ethyl. The cloned gene sequence was compared with that of the susceptible *Alopecurus aequalis* population S. The results showed that population R had a target enzyme mutation, indicating that this population possesses a target enzyme resistance mechanism.
[0034] The mechanism of non-target resistance was investigated. Transcriptome sequencing was successfully used to obtain transcriptome data from two populations of *Alopecurus aequalis* (S and R). Statistical evaluation of the sequencing quality showed that the Q30 values were all above 90%, indicating highly reliable and successful sequencing results. Further analysis of the assembled gene expression levels revealed 1122 differentially expressed genes between S and R, of which 5 were related to non-target resistance. Quantitative real-time PCR was used to validate these 5 differentially expressed genes using RNA samples from the transcriptome sequencing. The results showed that, compared to the susceptible population S, the resistant population R had high expression of the glutathione transferase gene (AaGSTF13). Using the extracted total RNA from *Ophiopogon japonicus* as a template, and based on the EST sequence fragment of the *Ophiopogon japonicus* GSTF13 gene obtained from the transcriptome, two specific primers (F: ATGGCGCCGGTGAAGGTGTTCGGGC, R: CTACTTGGGCGGAGCCATGGTGGCG) were designed according to the 3' and 5' splicing sequences. Full-length amplification was performed using a high-fidelity 2×PrimeSTAR Max Premix (TaKaRa). The target PCR product was purified, recovered, cloned, and sequenced, and the full-length *Ophiopogon japonicus* GSTF13 gene (SEQ ID NO:1) was successfully obtained.
[0035] Example 3: Construction of AaGSTF13 gene overexpression vector and acquisition of transgenic rice resistant to quizalofop-p-ethyl.
[0036] 1) Construct an AaGSTF13 gene overexpression vector.
[0037] Design specific primers (pox-F: 5'-TGTTACTTCTGCAGGATGGCGCCGGTGAAGGTGTTCGGGC-3', pox-R: 5'-CGGATCCATAACGCGCTACTTGGGCGGAGCCATGGTGGCG-3') to extract the full-length sequence of the target gene from the T-cloning sequencing vector obtained in Example 2 using a high-fidelity enzyme ( The AaGSTF13 fragment with a pox homologous arm was obtained by PCR amplification and purification using Max DNA Polymerase (TaKaRa).
[0038] Simultaneously, the overexpression vector pox was double-digested using Thermo Fisher Scientific digestive enzymes (FastDigest KpnI: 5'GGTAC↓C 3' and FastDigest MluI: 5'A↓CGCGT 3'). The specific steps were as follows: 2 μL of 10X FastDigest Green Buffer, 1 μL of FastDigest KpnI, 1 μL of FastDigest MluI, 1000 ng of pox plasmid were added to a PCR tube, and sterile water was added to bring the volume to 20 μL. After reacting at 37°C for 5 minutes, the linearized vector was obtained.
[0039] Subsequently, the AaGSTF13 fragment with the pox homologous arm was mixed with the linearized vector pox and ligated using the In-Fusion Snap Assembly (Takara) seamless cloning kit. After ligation, the plasmid was transformed into DH5α competent cells (Qingke). The plasmid that amplified the expected target fragment was sequenced, and the overexpression vector pox-AaGSTF13 containing the full-length expression sequence of the AaGSTF13 gene was finally obtained. Figure 2 ).
[0040] 2) Agrobacterium was transformed with the overexpression vector pox-AaGSTF13.
[0041] Place an ice box in the clean bench, and inside the ice box are an air-dried electroporation cup, a 1.5mL centrifuge tube, YEP liquid culture medium, and Agrobacterium tumefaciens competent cells (EHA105 chemically competent cell, Qingke Company).
[0042] Add 1 μg of overexpression plasmid to 100 μL of Agrobacterium competent cells and gently mix with a pipette.
[0043] Transfer it to the shock cup, add it into the gap of the shock cup, and quickly administer an electric shock using the conductivity meter;
[0044] Add 1000 μL of YEP liquid culture medium and mix quickly by pipetting. Transfer the mixture to a 1.5 mL centrifuge tube.
[0045] Incubate at 28℃ and 180 rpm for 3 h, centrifuge at 4000 rpm for 3 min, and collect 800 μL of supernatant;
[0046] Transfer 100 μL of the remaining liquid from the centrifuge tube onto YEB solid medium and spread it evenly with a glass rod. Add (100 μL Kana (50 mg / L) + 100 μL Rifampin (50 mg / L)) to each 100 mL.
[0047] Two days later, single colonies were selected for PCR verification, and successful single colonies were enriched in YEP liquid medium (with the same concentration of antibiotics).
[0048] 3) Screening of resistant callus and determination of its sensitivity to quizalofop-p-ethyl.
[0049] Using seeds of the rice variety Zhonghua 11 (ZH11, bred by the Institute of Crop Science, Chinese Academy of Agricultural Sciences) as material, after removing the husks, the seeds were disinfected with 75% ethanol for 1 minute, then thoroughly washed with sterile water 3-5 times. Subsequently, 2.5% sodium hypochlorite and one drop of Tween 20 were added to the seeds, and the mixture was centrifuged in a 50mL tube at 200rpm for 15 minutes; this step was repeated twice. The rinsed seeds were then washed several times with sterile water in a laminar flow hood, blotted dry with sterile filter paper, and placed on N6D medium for incubation at 28℃ in the dark. After 3 weeks, dense callus particles were selected for transformation. Light yellow, dense, and vigorously growing callus tissue was selected as the Agrobacterium-mediated transformation material. Agrobacterium overexpression was cultured in 50 mL YEP liquid medium containing antibiotics for 2 days, centrifuged at 3500 rpm for 10 min, the supernatant was discarded, and Agrobacterium was resuspended in 40 mL AAM (+8 μL 100 mg / mL AS), and the OD600 value was measured to be between 0.6 and 1.0; the AAM containing bacterial suspension was used to inoculate the callus for 2 min; the callus was removed with a strainer, placed on sterile filter paper to absorb moisture and blow dry; the blow-dried callus was placed on 2N6-AS solid medium (a sterile filter paper was placed on the solid medium, and 0.5 mL of the above AAM+AS medium was added to moisten the filter paper) and incubated in the dark at 28℃ for 3 days. After co-culturing for 3 days, the callus tissue was washed several times with sterile water and then dried with filter paper. It was then placed in N6D medium for subculture (with antibiotics: 1 mL of hygromycin (50 mg / L) + 1 mL of thiazomycin (250 mg / L) + 0.6 mL of termethin (200 mg / L) for 1 L of medium).
[0050] Screening of resistant callus. Subcultured callus was placed on selection medium containing antibiotics and cultured in the dark for 14 days, then transferred to freshly prepared selection medium for another 14 days. From the resistant callus that grew after two rounds of screening, dense, milky-yellow resistant callus was selected for herbicide tolerance experiments. Using transgenic rice callus overexpressing pox-GFP as a control, the resistance of transgenic rice callus overexpressing pox-GSTF13 to quizalofop-p-ethyl was observed. Results showed that compared with GFP (control GFP-OE), GSTF13 overexpressing (AaGSTF13-OE) rice callus showed better growth at concentrations of 6, 12, and 18 μM quizalofop-p-ethyl. Figure 3 ).
[0051] Differentiation and screening of transgenic plants. From the resistant callus tissue that grew after two rounds of screening, dense, milky-yellow resistant callus tissue was selected and transferred to differentiation medium containing hygromycin (50 mg / L). It was first cultured in the dark for 3 days, then transferred to light conditions. After about 15-25 days, green spots appeared, and seedlings further differentiated after 30-40 days. When the shoots differentiated from the resistant callus tissue grew to about 2 cm, the seedlings were transferred to rooting medium and cultured for about two weeks. Seedlings about 10 cm tall with well-developed root systems were selected, the medium was washed off, and they were transplanted into soil in a greenhouse to obtain transformed plants. Transgenic rice was treated with quizalofop-p-ethyl, with transgenic rice overexpressing pox-GFP as a control, to observe its sensitivity to quizalofop-p-ethyl. Figure 4 The results in the middle right figure show that transgenic rice with pox-GFP overexpression (GFP-OE) achieved a concentration of quizalofop-p-ethyl at the field dose (62.1 g aiha). -1 The transgenic rice (AaGSTF13-OE) carrying the pox-AaGSTF13 gene overexpression died, while the transgenic rice (AaGSTF13-OE) died. #1 AaGSTF13-OE #2 AaGSTF13-OE #3 ) at 62.1g aiha -1 The rice continued to grow under the influence of quizalofop-p-ethyl, thus we concluded that overexpression of the AaGSTF13 gene in *Alopecurus aequalis* can induce resistance to quizalofop-p-ethyl in transgenic rice.
[0052] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. It should be pointed out that those skilled in the art can make various improvements and modifications without departing from the principles of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
[0053] The culture medium and formulation used in this invention are as follows: YEP liquid culture medium formulation:
[0054]
[0055] Adjust the pH to 7.0 and sterilize under high temperature and high pressure.
[0056] YEB solid culture medium formulation:
[0057]
[0058] Adjust the pH to 7.4 and sterilize under high temperature and high pressure.
[0059] N6D culture medium formulation:
[0060]
[0061]
[0062] Adjust the pH to 5.8 and add Gelzan. TM CM Gelrite (plant gel) 4g / L, sterilized by high temperature and high pressure.
[0063] 2N6-AS culture medium formulation:
[0064]
[0065] Adjust the pH to 5.2 and add Gelzan. TM CM Gelrite (plant gel) 4g / L, add 0.2ml / L of acetylsuccinone AS (100mg / mL) before use, and autoclave.
[0066] AAM medium formulation:
[0067]
[0068] Adjust the pH to 5.2 and sterilize under high temperature and high pressure.
[0069] Differentiation medium formulation:
[0070]
[0071]
[0072] Adjust the pH to 5.8 and add Gelzan. TM CM Gelrite (plant gel) 4g / L, sterilized by high temperature and high pressure.
[0073] Rooting medium formula:
[0074]
[0075] Adjust the pH to 5.8 and add Gelzan. TM CM Gelrite (plant gel) 4g / L, sterilized by high temperature and high pressure.
[0076] N6 vitamin and MS vitamin formula:
[0077]
[0078] Filter and sterilize; store at -20℃.
[0079] Hormone working solution formula:
[0080]
[0081] Filter and sterilize, store at -20°C.
[0082] Sequence List
[0083] SEQ ID NO:1
[0084] ATGGCGCCGGTGAAGGTGTTCGGGCCGGCCATGTCGACCAACGTGGCTCGGGTGGTACTCTGCCTGGAGGAGGTGGGCGCCGAGTACGAGGTCGTCAACGTCGACATGCAGGGCTTGGAGCACAAGAGCGCCGAGCACCTCGCCAGAAACCCGTTCGGGCAAATCCCTGCTTTCCAAGACGGGGATCTGCTTCTCTGGGAGTCCCGCGCGATCTCCAAGTACGTGCTCCGCAAATACAAGACGGACGAGGTGGACCTGCTGAGGGAGGGCAGCCTAGAGGAGGCGGCAATAGTGGACGTGTGGACAGAGGTGGACGCTCACACCTACAACCCGGCGTTGTCTCCCATCGTGTACCAGTGCCTCTTTAACCCCATGATGAAAGGCATCCCCGCCGACGAGAAAGTCGTGGCCGAGAGCTTGGAGAAGCTGAAGAAGGTGCTGGAGGTCTACGAGGCGCGCCTCTCCAAGCACAGCTACCTGGCCGGGGACTTCATCAGCTTCGCCGACCTCAACCACTTCCCCTACACCTTCTACTTCATGGTCACGCCCCACGCCGCGCTCTTCGACTCCTACCCGCACGTCAAGGCCTGGTGGGACCGCCTTATGGCCAGGCCCGCCATCAAGAAGGTCGCCGCCACCATGGCTCCGCCCAAGTAG。
Claims
1. A glutathione transferase gene GSTF13, characterized in that, The nucleotide sequence of this gene is: SEQ ID NO:
1.
2. A protein polypeptide, characterized in that, The protein polypeptide is encoded by the nucleotide sequence described in claim 1.
3. A plasmid, characterized in that, An expression frame comprising the nucleotide sequence molecule of claim 1 linked with a nucleotide sequence controlling expression.
4. The use of the glutathione transferase gene GSTF13 according to claim 1, or the plasmid according to claim 3, characterized in that, The plant acquires herbicide resistance by expressing the glutathione transferase gene GSTF13 through transgenic technology; the herbicide is quizalofop-p-ethyl; and the plant is rice.
5. The application of the gene of claim 1, the polypeptide of claim 2, or the plasmid of claim 3 in the breeding of herbicide-resistant transgenic plants; wherein the herbicide is quizalofop-p-ethyl; and the plant is rice.
6. A method for modifying plants, characterized in that, The invention includes using plant gene transformation technology to introduce an expression frame, comprising the nucleotide sequence molecule described in claim 1 and a nucleotide sequence controlling expression, into plant cells, and then differentiating and cultivating the cells into corresponding transgenic plants, wherein the obtained plants have herbicide resistance; the herbicide is quizalofop-p-ethyl; and the plant is rice.
Citation Information
Patent Citations
Herbicide-resistant ACCase mutant gene and protein and application thereof
CN109082416A
A rice ACCase mutant gene and its application in plant herbicide resistance
CN109371000B
Application of rice ACCase mutant gene and protein thereof in plant herbicide resistance
CN112410308A