Recombinant microorganism for producing adenosine as well as construction method and application of recombinant microorganism

Abstract

The invention relates to the technical field of microorganisms, and particularly discloses a recombinant microorganism for producing adenosine as well as a construction method and application of the recombinant microorganism. According to the method for constructing the recombinant microorganism, compared with an original strain, the recombinant microorganism has the transcriptional regulatory factor BkdR with enhanced activity, and the original strain can be fermented to produce adenosine. The invention further provides a BkdR protein mutant with improved transcriptional level. When the recombinant strain is applied to adenosine fermentation production, higher yield can be obtained, and the fermentation production efficiency is improved.

Description

Technical Field

[0001] The present invention relates to the technical field of microorganisms, and more specifically, to a recombinant microorganism for producing adenosine, a method for constructing the same, and an application thereof. Background Art

[0002] Nucleosides are a general term for a class of glycosides. Nucleosides are components of nucleic acids and nucleotides. Nucleosides are formed by the condensation of D-ribose or D-α-deoxyribose with pyrimidine bases or purine bases. Nucleosides are generally colorless crystals, insoluble in common organic solvents, soluble in hot water, and have a melting point of 160-240 °C. Nucleosides formed from D-ribose are called ribonucleosides and participate in the composition of RNA. Nucleosides formed from D-α-deoxyribose are called deoxyribonucleosides and participate in the composition of DNA. D-ribose condenses with adenine, guanine, cytosine, thymine, or uracil to form the corresponding adenosine ribonucleoside, guanosine ribonucleoside, cytidine ribonucleoside, thymidine ribonucleoside, and uridine ribonucleoside, which are abbreviated as adenosine (A), guanosine (G), cytidine (C), thymidine (T), and uridine (U), respectively.

[0003] Guanosine and inosine have extensive applications in the food and pharmaceutical industries. In the food field, guanosine and inosine are important precursors of disodium guanylate and disodium inosinate, respectively. The combination of disodium guanylate and disodium inosinate is used as a food flavor enhancer and is widely used in seasonings such as chicken essence and soy sauce. In the pharmaceutical field, guanosine and inosine can be used as pharmaceutical intermediates for various antiviral drugs. For example, acyclovir, ribavirin, sodium guanosine triphosphate, etc. all require guanosine as a synthesis raw material. Inosine is an important precursor of inosinic acid, and inosinic acid can be used as a precursor for the synthesis of adenylic acid (AMP) and guanylic acid (GMP). It is applicable to leukopenia, thrombocytopenia, various heart diseases, acute and chronic hepatitis, cirrhosis, etc. caused by various reasons. In addition, it can also treat central retinitis, optic nerve atrophy, etc.

[0004] Adenosine, namely adenosine ribonucleoside, has the chemical name of 6-amino-9-β-D-ribofuranosyl-9H-purine. It is the product after the dephosphorylation of adenosine monophosphate and belongs to an important nucleotide derivative. Adenosine is an endogenous nucleoside distributed throughout human cells. It can directly enter the myocardium and be phosphorylated to form adenosine monophosphate, participating in myocardial energy metabolism. At the same time, it also participates in dilating coronary blood vessels and increasing blood flow. Adenosine has physiological effects on the cardiovascular system and many other systems and tissues of the body. In addition to being used as a specific drug for treating the heart, adenosine is also an important intermediate for the synthesis of adenosine triphosphate (ATP), adenine, adenosine monophosphate, and vidarabine, and is widely used in industries such as pharmaceuticals.

[0005] At present, microbial fermentation is the main method for producing nucleosides. The main microorganisms used include Bacillus subtilis, Bacillus amyloliquefaciens, or Bacillus pumilus, etc. During the breeding and transformation of growth strains, high-yield nucleoside strains are directionally selected through the use of ultraviolet mutagenesis and diethyl sulfate mutagenesis breeding; or based on the metabolic pathways and regulatory mechanisms of nucleotides in bacteria, the genetic background and characteristics of the strains are deeply understood, and the strains are purposefully transformed through metabolic engineering means to obtain production strains with excellent traits and high nucleoside yields. However, the current fermentation performance of nucleoside strains is still poor, and the conversion rate of nucleosides is still low, which cannot meet the requirements of large-scale industrial production. Summary of the Invention

[0006] One of the objectives of the present invention is to provide a recombinant microorganism capable of efficiently producing adenosine, as well as its construction method and application.

[0007] To achieve this objective, the technical solution of the present invention is as follows:

[0008] In the first aspect, the present invention provides a method for constructing a recombinant microorganism, such that the recombinant microorganism has a transcription regulator BkdR with enhanced activity compared to the starting strain, and the starting strain can ferment and produce adenosine.

[0009] In the present invention, the reference sequence number of the transcription regulator BkdR on NCBI is NP_390290.1, which is encoded by the bkdR gene, Gene ID: 938666.

[0010] The present invention studies and discovers that by enhancing the activity of the transcription regulator BkdR in adenosine-producing strains, the yield of adenosine can be increased.

[0011] In the method of the present invention, the enhancement of the activity of the transcription regulator BkdR is achieved through any one or a combination of the following methods:

[0012] 1) By changing the promoter of the coding gene of the transcription regulator BkdR to enhance it;

[0013] 2) By changing the amino acid sequence of the transcription regulator BkdR to enhance it;

[0014] 3) By changing the nucleotide sequence encoding the transcription regulator BkdR to enhance it.

[0015] In the present invention, the enhancement of the activity of the transcription regulator BkdR includes, but is not limited to: promoter replacement, start codon replacement, point mutation, etc. Mutagenesis, site-directed mutagenesis, or homologous recombination methods can be used to enhance the expression of the coding gene of the transcription regulator BkdR.

[0016] Preferably, the enhancement of the activity of the transcriptional regulator BkdR is achieved by any one of the following methods:

[0017] A. Introducing a promoter with higher activity into the coding gene of the transcriptional regulator BkdR;

[0018] B. Mutating the 487th amino acid of the wild-type amino acid sequence of the transcriptional regulator BkdR into an amino acid other than glutamic acid;

[0019] More preferably, the promoter is the P43 promoter, and the nucleotide sequence of the P43 promoter is as shown in SEQ ID NO: 23; the other amino acid is lysine or arginine;

[0020] And / or, the starting strain is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, preferably B. subtilis 168 or B. subtilis A5.

[0021] In a second aspect, the present invention provides a recombinant microorganism constructed by the above method.

[0022] In a third aspect, the present invention provides the use of the above recombinant microorganism in the fermentation production of adenosine or adenosine derivatives or in increasing the fermentation yield of adenosine or adenosine derivatives; preferably, the adenosine derivative is adenosine triphosphate, adenine, adenylic acid or vidarabine.

[0023] In a fourth aspect, the present invention provides a method for fermenting and producing adenosine or adenosine derivatives, which includes the step of fermenting and producing using the above recombinant microorganism.

[0024] In a fifth aspect, the present invention provides a BkdR protein mutant. Taking the amino acid sequence of the wild-type BkdR protein as a reference sequence, the BkdR protein mutant contains a mutation in which the 487th glutamic acid is replaced by an amino acid other than glutamic acid.

[0025] In the BkdR protein mutant of the present invention, the BkdR protein mutant contains a mutation in which the 487th glutamic acid is replaced by lysine or arginine;

[0026] Preferably, the amino acid sequence of the BkdR protein mutant is as shown in SEQ ID NO: 2 or 3.

[0027] In a sixth aspect, the present invention provides nucleic acid encoding the above BkdR protein mutant, preferably as shown in SEQ ID NO: 5 or 6.

[0028] In a seventh aspect, the present invention provides a biological material containing the above nucleic acid, and the biological material is an expression cassette, a vector or a host cell.

[0029] In an eighth aspect, the present invention provides the use of the above BkdR protein mutant, nucleic acid or biological material in increasing the adenosine production of microorganisms.

[0030] The beneficial effects of the present invention are at least as follows:

[0031] The present invention provides a recombinant bacterium, in which the encoded transcriptional regulator BkdR is modified, so that the ability of the strain to produce adenosine is enhanced compared with the unmodified strain. Thus, a more efficient method for fermentative production of adenosine is provided.

[0032] The present invention also provides a BkdR protein mutant, which can improve the production efficiency when introduced into a microorganism capable of producing adenosine. Detailed Embodiments

[0033] The preferred embodiments of the present invention will be described in detail below in conjunction with the examples. It should be understood that the following examples are given only for the purpose of illustration and are not used to limit the scope of the present invention. Those skilled in the art can make various modifications and substitutions to the present invention without departing from the purpose and spirit of the present invention.

[0034] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials, reagents, etc. used in the following examples can be obtained from commercial sources or prepared by conventional methods in the art unless otherwise specified.

[0035] Unless otherwise specified, the examples are carried out under conventional experimental conditions, such as those described in the Molecular Cloning: A Laboratory Manual by Sambrook et al. (Sambrook J & Russell DW, Molecular Cloning: a Laboratory Manual, 2001), or under the conditions recommended by the manufacturer's instructions.

[0036] The amino acid sequence of the wild-type Bacillus subtilis transcriptional regulator BkdR is shown in SEQ ID NO: 1. The amino acid sequence of the mutant BkdR E487K is shown in SEQ ID NO: 2 (the 487th amino acid of BkdR is mutated from glutamic acid to lysine). The amino acid sequence of the mutant BkdR E487R is shown in SEQ ID NO: 3 (the 487th amino acid of BkdR is mutated from glutamic acid to arginine). The corresponding nucleotide sequences of the above wild-type BkdR and BkdR mutants are shown in SEQ ID NOs: 4-6, respectively.

[0037] The molecular biology reagents such as DNA polymerase, DNA purification kit, restriction endonuclease, DNA ligase, etc. used in the present invention were purchased from Beijing TransGen Biotech Co., Ltd. (https: / / www.transgen.com / ), and other biochemical reagents used were purchased from Sangon Biotech (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0038] The primer names and primer sequences involved in the following examples are shown in Table 1, and the primers were synthesized by Sangon Biotech (Shanghai) Co., Ltd. (http: / / www.sangon.com / ).

[0039] Table 1 Primer names and sequence information used in the examples of the present invention (SEQ ID NO: 7-22)

[0040] Primer Name Primer Sequence BkdR-1f ACAAAATAAGGATCCTCTAGATGCAGACACGAAAAGAACTGT BkdR-1r CTTTAGCAAGAGGGTGATGTTTGTCCCCGATACCCCTTTGTATGAAAAAAT P43-BkdR-f ATTTTTTCATACAAAGGGGTATCGGGGACAAACATCACCCTCTTGCTAAAG P43-BkdR-r GCACCTACTATCAGTACCTTTTGCATGTGTAAATTCCTCCCTTACCTTTAAT BkdR-2f ATTAAAGGTAAGGGAGGAATTTACACATGCAAAAGGTACTGATAGTAGGTGC BkdR-2r GCCAAGCTTGCATGCCTGCAGCTTCTGGTTGTATTCAGGCAC <![CDATA[BkdR E487K -1f]]> ACAAAATAAGGATCCTCTAGAGTGATCGTTAATGTAGCACCG <![CDATA[BkdR E487K -1r]]> CCGCCCACTCTGACGATTTCCTTTTTTTGAAGGACGCGTAGCAATTTGGCC <![CDATA[BkdR E487K -2f]]> GGCCAAATTGCTACGCGTCCTTCAAAAAAAGGAAATCGTCAGAGTGGGCGG <![CDATA[BkdR E487K -2r]]> GCCAAGCTTGCATGCCTGCAGTTCCGAATGCTGACACCGAGA <![CDATA[BkdR E487R -1f]]> ACAAAATAAGGATCCTCTAGAGTGATCGTTAATGTAGCACCG <![CDATA[BkdR E487R -1r]]> CCGCCCACTCTGACGATTTCCTTTCTTTGAAGGACGCGTAGCAATTTGGCC <![CDATA[BkdR E487R -2f]]> GGCCAAATTGCTACGCGTCCTTCAAAGAAAGGAAATCGTCAGAGTGGGCGG <![CDATA[BkdR E487R -2r]]> GCCAAGCTTGCATGCCTGCAGTTCCGAATGCTGACACCGAGA BkdR-F ATGCAAAAGGTACTGATAGTAGG BkdR-R TTATTGCATGCCTTCATTTGC

[0041] Example 1 Construction of BkdR promoter-enhanced strain

[0042] Using the method of scarless gene editing, an artificially synthesized P43 promoter was inserted in front of the start codon of the gene bkdR encoding the transcriptional regulator BkdR on the genome of the nucleoside-producing bacterium B. subtilis A5 (the construction method of strain B. subtilis A5 can be seen in the Chinese patent document: CN110257315B) to construct a P43-BkdR enhanced mutant strain.

[0043] Using the genome of strain B. subtilis A5 as a template, the upstream and downstream homologous arms BkdR-F and BkdR-R of the BkdR gene were amplified using the primer pairs BkdR-1f / BkdR-1r and BkdR-2f / BkdR-2r and pfu high-fidelity DNA polymerase. Using the PBE43 plasmid (the PBE43 plasmid was synthesized by total gene synthesis, see the literature Effects of overexpression of key enzyme genes on guanosine accumulation in Bacillus amyloliquefaciens) as a template, the P43 fragment (SEQ ID NO:23) was amplified using the primer pair P43-BkdR-f / P43-BkdR-r and pfu high-fidelity DNA polymerase. The BkdR-F, BkdR-R, and P43 fragments were gel-extracted and fused, and the P43-BkdR fragment was amplified, followed by gel extraction. The pKSU plasmid (the pKSU plasmid was kindly provided by Professor Wang Shufang of Nankai University, see A markerless gene replacement method for B. amyloliquefaciens LL3 and its use in genome reduction and improvement of poly-γ-glutamic acid production[J], Applied Microbiology and Biotechnology, 2014, 98(21):84873-8973. Zhang W, Gao W, Feng J, et al DOI:10.1007 / s00253-014-5824-2) was double-digested with XbaI / PstI and gel-extracted. The linearized plasmid after digestion and the P43-BkdR fragment were assembled using an assembly kit and transformed into TransT1 competent cells. Recombinant plasmid pKSU-P43-BkdR was obtained through subsequent identification and screening. It was transformed into B. subtilis A5 strain, and transformants were screened on LB plates containing 2.5 μg / mL chloramphenicol at 30 °C. The obtained transformants were inoculated into 5 ml of LB liquid medium and cultured at 42 °C and 200 rpm for 12 h and then passaged once. The culture was diluted and spread on LB plates containing 5 μg / mL chloramphenicol to obtain primary recombinants; the primary recombinants were inoculated into 5 ml of LB liquid medium and cultured at 42 °C and 200 rpm for 12 h and then passaged once. The culture was diluted and spread on LB plates containing 0.8 μM 5-fluorouracil (5-FU) to screen for secondary recombinants, and a mutant strain with enhanced BkdR promoter was obtained and named A861.

[0044] Example 2 BkdRE487K Construction of mutant strains

[0045] Using the method of scarless gene editing, the 487th amino acid of the transcription regulator BkdR encoded on the genome of the nucleoside-producing bacterium B. subtilis A5 was mutated from glutamate to lysine to construct BkdR E487K mutant strain.

[0046] Using the genome of strain B. subtilis A5 as a template, and using BkdR E487K -1f / BkdR E487K -1r, BkdR E487K -2f / BkdR E487K -2r primer pairs, and pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of the BkdR gene. The obtained fragments were subjected to gel recovery and fusion, and the BkdR E487K fragment was amplified, and gel recovery was performed. According to the construction method in Example 1, plasmid pKSU-BkdR E487K was constructed and transformed into B. subtilis A5 strain to obtain a mutant strain in which the 487th amino acid of BkdR was mutated from glutamate to lysine, named A866.

[0047] Example 3 Construction of BkdR E487R mutant strain

[0048] Using the method of scarless gene editing, the 487th amino acid of the transcription regulator BkdR encoded on the genome of the nucleoside-producing bacterium B. subtilis A5 was mutated from glutamate to arginine to construct BkdR E487R mutant strain.

[0049] Using the genome of strain B. subtilis A5 as a template, and using BkdR E487R -1f / BkdR E487R -1r, BkdR E487R -2f / BkdR E487R -2r primer pairs, and pfu high-fidelity DNA polymerase was used to amplify the upstream and downstream homologous arms of the BkdR gene. The obtained fragments were subjected to gel recovery and fusion, and the BkdR E487R fragment was amplified, and gel recovery was performed. According to the construction method in Example 1, plasmid pKSU-BkdR E487R was constructed and transformed into B. subtilis A5 strain to obtain a mutant strain in which the 487th amino acid of BkdR was mutated from glutamate to arginine, named A868.

[0050] Example 4 Gene transcription level test

[0051] The mutant strains obtained in the above Examples 1-3 and their parental strain B. subtilis A5 were cultured overnight in LB medium, and the cells were collected. Total RNA was extracted according to the instructions of the kit TakaRa RNAiso Plus Code No. 9108, and reverse transcription was carried out according to the instructions of the kit TakaRa PrimeScript TM RT reagent Kit Code No. RR037A to transcribe RNA into cDNA. Finally, the PCR reaction system was prepared according to the instructions of the kit TakaRa TB Premix Ex Taq TM IICodeNo. RR820A. The Real Time PCR reaction was carried out using the primer pair BkdR-F / BkdR-R. The results of data analysis are shown in Table 2.

[0052] Table 2 Relative values of transcription levels of mutant strains compared with the parental strain

[0053] Relative Transcription Level Improvement Range B.subtilis A5 1 - A861 1.46 46％ A866 1.24 24％ A868 1.17 17％

[0054] It can be seen from the results that the transcription level of BkdR changed significantly after modification, and the intensities were A861 > A866 > A868 > B. subtilis A5, that is, after modification by the methods described in Examples 1-3, the BkdR mutants were all enhanced.

[0055] Example 5 Shake-flask fermentation for the production of nucleosides

[0056] 1. Take 50 μL of glycerol stock stored at -80 °C and inoculate it into a test tube containing 5 mL of LB medium (g / L: yeast extract 10, peptone 5, sodium chloride 10, pH 7.0 - 7.2, sterilized at 121 °C for 20 min). Culture it at 37 °C and 220 r / min with rotary shaking for 16 h; pick the bacterial liquid from the test tube and streak it on an LB sterile plate, and culture it at 37 °C for 36 h to grow single colonies.

[0057] 2. Pick single colonies and inoculate them into 30 mL of seed medium (g / L: glucose 20, yeast extract 6, corn steep liquor dry powder 5, potassium dihydrogen phosphate 2, magnesium sulfate 0.5, ferrous sulfate 0.02, manganese sulfate 0.01, pH 7.0 - 7.2, sterilized at 121 °C for 20 min), and culture it at 34 °C and 110 rpm with reciprocating shaking for 5 - 6 h.

[0058] 3. Transfer to 30 ml of fermentation medium (g / L: glucose 80, yeast powder 3.5, potassium dihydrogen phosphate 5, ammonium sulfate 20, manganese sulfate 0.01, magnesium sulfate 5, sodium glutamate 13, corn steep powder dry 15, calcium carbonate 25, pH 7.2 - 7.4) at an inoculation amount of 10% (volume ratio), and sterilize at 121 °C for 20 min. Then, culture with reciprocating shaking at 35 °C and 130 rpm for 48 h.

[0059] 4. Use a liquid chromatograph to detect the production of nucleosides in the fermentation broth, and the results are shown in Table 3.

[0060] Table 3 Shake flask fermentation results

[0061] Strain Adenosine (g / L) Inosine (g / L) Guanosine (g / L) <![CDATA[OD 562 > B.subtilis A5 7.6 0.8 0.1 24.9 A861 8.9 1.1 0.2 25.6 A866 8.3 1.0 0.2 25.2 A868 8.0 1.0 0.3 25.4

[0062] After introducing the synthetic P43 promoter into the coding gene of the transcriptional regulator BkdR, the adenosine production capacity increased by 17.1%; when the 487th amino acid was mutated to lysine or arginine other than glutamate, the adenosine production capacity increased by 9.2% and 5.3% respectively.

[0063] Example 6 Construction of BkdR mutant strains and production of nucleosides in Bacillus subtilis 168 model strain

[0064] Using the genome of Bacillus subtilis 168 model strain as a template, according to the same methods in Examples 1 - 3, construct the BkdR promoter-enhanced strain B385, construct the BkdR E487K mutant strain B388, and construct the BkdR E487R mutant strain B389.

[0065] Using the same method as in Example 5, the data of nucleoside production by shake flask fermentation are shown in Table 4 below.

[0066] Table 4 Shake flask fermentation results

[0067] Strain Adenosine (g / L) Inosine (g / L) Guanosine (g / L) <![CDATA[OD 562 > B.subtilis 168 1.6 0.1 0.1 26.5 B385 2.2 0.2 0.3 25.2 B388 2.0 0.2 0.2 25.3 B389 1.9 0.3 0.2 25.1

[0068] Although the present invention has been described in detail above with general descriptions and specific embodiments, based on the present invention, some modifications or improvements can be made, which are obvious to those skilled in the art. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection required by the present invention.

Claims

1. A method for constructing a recombinant microorganism, characterized in that, the recombinant microorganism has a transcription regulator BkdR with enhanced activity compared to the parental strain, and the parental strain can ferment and produce adenosine.

2. The method according to claim 1, characterized in that, the enhanced activity of the transcription regulator BkdR is achieved by any one or a combination of the following methods: 1) Enhanced by changing the promoter of the encoding gene of the transcription regulator BkdR; 2) Enhanced by changing the amino acid sequence of the transcription regulator BkdR; 3) Enhanced by changing the nucleotide sequence encoding the transcription regulator BkdR. Preferably, the enhanced activity of the transcription regulator BkdR is achieved by any of the following methods: A. Introducing a promoter with higher activity into the encoding gene of the transcription regulator BkdR; B. Mutating the 487th amino acid of the wild-type amino acid sequence of the transcription regulator BkdR to an amino acid other than glutamate; More preferably, the promoter is the P43 promoter, and the nucleotide sequence of the P43 promoter is as shown in SEQ ID NO: 23; the other amino acid is lysine or arginine; and / or, the parental strain is Bacillus subtilis, Bacillus amyloliquefaciens, Bacillus pumilus or Escherichia coli, preferably B. subtilis 168 or B. subtilis A5.

3. A recombinant microorganism, characterized in that, it is constructed by the method according to any one of claims 1-2.

4. Use of the recombinant microorganism according to claim 3 in the fermentation production of adenosine or adenosine derivatives or in increasing the fermentation yield of adenosine or adenosine derivatives; preferably, the adenosine derivative is adenosine triphosphate, adenine, adenosine monophosphate or vidarabine.

5. A method for fermenting and producing adenosine or adenosine derivatives, characterized in that, it includes: the step of fermenting and producing using the recombinant microorganism according to claim 3.

6. A BkdR protein mutant, characterized in that, using the amino acid sequence of the wild-type BkdR protein as a reference sequence, the BkdR protein mutant contains a mutation in which the 487th glutamate is replaced by an amino acid other than glutamate.

7. The BkdR protein mutant according to claim 6, characterized in that, the BkdR protein mutant contains a mutation in which the 487th glutamate is replaced by lysine or arginine; Preferably, the amino acid sequence of the BkdR protein mutant is as shown in SEQ ID NO: 2 or 3.

8. Nucleic acid encoding the BkdR protein mutant according to claim 6 or 7, preferably as shown in SEQ ID NO: 5 or 6.

9. A biological material containing the nucleic acid according to claim 8, and the biological material is an expression cassette, a vector or a host cell.

10. Use of the BkdR protein mutant according to claim 6 or 7, the nucleic acid according to claim 8, or the biological material according to claim 9 in increasing the adenosine production of microorganisms.