Application of apple MdWRI1 gene in regulating wax content of plant fruits and leaves
By constructing the overexpression vector of the apple MdWRI1 gene and infecting apple plants, the problem of unknown effect of the MdWRI1 gene in wax synthesis of apple fruits and leaves was solved, significantly improving the wax content of apple fruits and leaves, enhancing drought resistance and pest resistance.
Patent Information
- Application Number
- CN202510339436.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-21
- Publication Date
- 2025-06-10
- Estimated Expiration
- 2045-03-21
AI Technical Summary
The prior art has not yet clarified the specific role of the MdWRI1 gene in wax synthesis of apple fruits and leaves, which has led to the inability to effectively improve the wax content of apple fruits and leaves.
By constructing the overexpression vector of the apple MdWRI1 gene, it was transformed into Agrobacterium and infecting the apple plants, which significantly increased the wax content of apple fruits and leaves.
Overexpressing the MdWRI1 gene can significantly improve the wax content on the surface of apple fruits, enhance the drought resistance and pest resistance of apple plants, extend the shelf life of the fruits, and reduce postharvest rot and premature aging problems.
Smart Images

Figure CN120118946A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of plant genetic engineering, and particularly relates to the application of an apple MdWRI1 gene in regulating the wax content of plant fruits and leaves. Background Art
[0002] Apples are economically important crops widely cultivated worldwide. As the world's largest producer and consumer of apple resources, the apple industry occupies an important position in China's fruit and vegetable industry. The apple industry is of great significance in promoting the income increase of fruit farmers and the development of rural economy. The quality of fruits directly affects the economic value of apples and the income of fruit farmers. Apple epidermal wax, as a protective barrier on the fruit surface, is of great significance for improving fruit quality and resistance.
[0003] Fruit wax is like a natural protective barrier. On the one hand, it can effectively reduce water loss, maintain the freshness and plumpness of fruits, reduce post-harvest shrinkage, withering and other adverse phenomena caused by water loss, and greatly extend its shelf life. On the other hand, the dense wax layer can resist the invasion of pathogenic bacteria, block the attachment and invasion of external harmful microorganisms, reduce the occurrence of post-harvest rot, ensure fruit quality, and reduce economic losses. For leaves, sufficient wax helps to regulate the stomatal conductance of leaves, optimize water use efficiency, and enable leaves to maintain normal photosynthesis and physiological metabolism under adverse conditions such as drought or high temperature. Moreover, wax can also reflect part of the strong light, reduce leaf photo-inhibition damage, enhance the overall stress resistance of apple plants, ensure the healthy growth of the tree body, and lay a foundation for high-quality and high-yield fruits.
[0004] Previous studies have focused on various factors affecting apple growth and development, and at the same time explored key functional genes that can specifically increase the wax content of apple fruits and leaves. It is currently known that the synthesis of plant wax involves a series of complex biochemical pathways and is co-regulated by multiple genes. However, it is not clear how the transcription factor MdWRI1 acts on the improvement of apple fruit and leaf wax. Therefore, in-depth exploration and analysis of this functional gene are of great significance for revealing the apple wax synthesis mechanism, optimizing apple quality, and enhancing stress resistance. Summary of the Invention
[0005] The object of the present invention is to provide the application of an apple MdWRI1 gene in regulating the wax content of plant fruits and leaves, so as to solve the problems existing in the above-mentioned prior art. The present invention discovers the key role of the MdWRI1 gene in apple wax synthesis, and overexpression of the MdWRI1 gene can significantly increase the wax content on the surface of apple fruits.
[0006] To achieve the above object, the present invention provides the following solutions:
[0007] The present invention provides the application of an apple MdWRI1 gene in any one of the following:
[0008] (1) Use in regulating the wax content of plant fruits and / or leaves;
[0009] (2) Use in cultivating transgenic plants with high wax content in fruits and / or leaves;
[0010] (3) Use in preparing products for increasing the wax content of plant fruits and / or leaves;
[0011] The nucleotide sequence of the MdWRI1 gene is shown as SEQ ID NO.1.
[0012] Preferably, up-regulating the expression level of the apple MdWRI1 gene in plants can increase the wax content of the fruits and / or leaves of the plants;
[0013] The plant is an apple.
[0014] Preferably, the method for up-regulating the expression level of the apple MdWRI1 gene in plants includes the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plants.
[0015] The present invention also provides the use of a recombinant vector containing the apple MdWRI1 gene described above in any one of the following:
[0016] (1) Use in regulating the wax content of plant fruits and / or leaves;
[0017] (2) Use in cultivating transgenic plants with high wax content in fruits and / or leaves;
[0018] (3) Use in preparing products for increasing the wax content of plant fruits and / or leaves.
[0019] The present invention also provides the use of an engineered bacterium containing the recombinant vector described above in any one of the following:
[0020] (1) Use in regulating the wax content of plant fruits and / or leaves;
[0021] (2) Use in cultivating transgenic plants with high wax content in fruits and / or leaves;
[0022] (3) Use in preparing products for increasing the wax content of plant fruits and / or leaves.
[0023] The present invention also provides a method for increasing the wax content of plant fruits and / or leaves, including the step of up-regulating the expression level of the apple MdWRI1 gene in plants to increase the wax content of the fruits and / or leaves of the plants;
[0024] The nucleotide sequence of the MdWRI1 gene is shown as SEQ ID NO.1;
[0025] The plant is an apple.
[0026] Preferably, the method for up-regulating the expression level of the apple MdWRI1 gene in a plant includes the steps of constructing an over-expression vector of the apple MdWRI1 gene, transforming the over-expression vector into Agrobacterium, and then infecting the plant.
[0027] The present invention also provides a breeding method for transgenic plants with high wax content in fruits and / or leaves, comprising the following steps:
[0028] Over-expressing the apple MdWRI1 gene in plant cells, then culturing the plant cells, and regenerating plants using the plant cells, thereby obtaining the transgenic plants with increased wax content in fruits and / or leaves;
[0029] The nucleotide sequence of the MdWRI1 gene is shown as SEQ ID NO.1;
[0030] The plant is an apple.
[0031] The present invention also provides an application of the apple MdWRI1 gene in improving the drought resistance and / or pest and disease resistance of plants, and the nucleotide sequence of the MdWRI1 gene is shown as SEQ ID NO.1.
[0032] Preferably, the apple MdWRI1 gene improves the drought resistance and / or pest and disease resistance of the plant by increasing the wax content in the fruits and / or leaves of the plant.
[0033] The present invention discloses the following technical effects:
[0034] The present invention helps to deeply analyze the molecular regulation network of apple wax synthesis, and provides a new theoretical support and key gene resources for the genetic engineering strategy of apple quality improvement. Apple transient injection experiments, wax component determination and gene expression analysis show that over-expression of the MdWRI1 gene can significantly increase the wax content on the surface of apple fruits, while silencing the MdWRI1 gene results in a significant decrease in the wax content on the surface of apple fruits, which further verifies the key role of the MdWRI1 gene in apple wax synthesis.
[0035] Observation on the appearance of transgenic apple plants, determination of wax content, gene expression analysis, and analysis of leaf permeability showed that overexpression of the MdWRI1 gene can significantly increase wax deposition in leaves and significantly reduce permeability, while interfering with the MdWRI1 gene leads to a significant reduction in leaf wax deposition and disrupted permeability. This invention provides new possibilities for improving the drought resistance and pest and disease resistance of apple plants through genetic engineering means.
[0036] Proceeding from the actual benefits of agricultural production, the application of the MdWRI1 gene of this invention can effectively reduce the yield losses caused by problems such as post-harvest fruit water loss, disease infection, and premature leaf senescence, reduce the input costs of irrigation, plant protection, etc. in orchard management, and significantly improve the economic and ecological benefits of apple cultivation. Brief Description of the Drawings
[0037] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.
[0038] Figure 1 It is a diagram of the expression change of the MdWRI1 gene during fruit development and the subcellular localization of the MdWRI1 gene expression; among them, A is the phenotypic observation result during the development of rusty / non-rusty fruits; B is the change in the expression of the MdWRI1 gene during the development of rusty / non-rusty fruits; C is the subcellular localization of the MdWRI1 gene expression;
[0039] Figure 2 It is a diagram of the phenotypic, wax composition, and gene expression analysis results after the overexpression vector of the MdWRI1 gene infects apple fruits; among them, A is the phenotype of the fruits of MdWRI1 overexpressing apples and control group apples, scale bar = 1 cm; B is the wax content in the peels of MdWRI1 overexpressing apples and control group apples; C is the content of four common wax components; D is the content of fatty aldehydes; E is the content of fatty alcohols; F is the content of alkanes; G is the content of fatty acids; H is the expression level of wax biosynthesis-related genes in the fruits of MdWRI1 overexpressing apples and control group apples;
[0040] Figure 3Figure showing the phenotypic, wax composition and gene expression analysis results after infection of apple fruits with the MdWRI1 gene interference vector; among them, A shows the phenotypes of MdWRI1-silenced apples and control apples, scale bar = 1 cm; B shows the wax content in the peels of MdWRI1-silenced apples and control apples; C shows the contents of four common wax components; D shows the fatty aldehyde content; E shows the fatty alcohol content; F shows the alkane content; G shows the fatty acid content; H shows the expression levels of wax biosynthesis-related genes in MdWRI1-silenced apples and control apples;
[0041] Figure 4 Figure showing the phenotypic and related index measurement results after leaf disc transformation of apple 'GL-3' tissue culture seedlings with the MdWRI1 gene overexpression vector; among them, A shows the leaf phenotypes of WT and MdWRI1-overexpressing apple lines; B shows the leaf wax content of WT and MdWRI1-overexpressing apple lines; C shows the main wax component contents; D shows the alkane content; E shows the fatty acid content; F shows the phenol content; G shows the results of the chlorophyll leaching experiment; H shows the toluidine blue staining results; I shows the water drop experiment results; J shows the expression levels of wax synthesis-related genes in WT and MdWRI1-overexpressing apple lines;
[0042] Figure 5 Figure showing the phenotypic and related index measurement results after leaf disc transformation of apple 'GL-3' tissue culture seedlings with the MdWRI1 gene interference vector; among them, A shows the leaf phenotypes of WT and MdWRI1-interfered apple lines; B shows the leaf wax content of WT and MdWRI1-interfered apple lines; C shows the main wax component contents; D shows the alkane content; E shows the fatty acid content; F shows the phenol content; G shows the results of the chlorophyll leaching experiment; H shows the toluidine blue staining results; I shows the water drop experiment results; J shows the expression levels of wax synthesis-related genes in WT and MdWRI1-interfered apple lines. Detailed implementation manners
[0043] The various exemplary implementation manners of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, characteristics and implementation schemes of the present invention.
[0044] It should be understood that the terms used in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.
[0045] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.
[0046] Various modifications and variations of the specific embodiments of the present invention can be made without departing from the scope or spirit of the present invention, which will be apparent to those skilled in the art. Other embodiments obtained from the description of the present invention will be apparent to those skilled in the art. The description and examples of the present invention are merely exemplary.
[0047] Regarding the use of "comprising", "including", "having", "containing", etc. herein, they are all open-ended terms, meaning including but not limited to.
[0048] Currently, the related reports on the WRI1 gene mainly focus on oil accumulation, and there is no relevant report on wax regulation. It is of great significance to explore the apple WRI1 gene and conduct functional research.
[0049] The present invention has conducted in-depth research and found a significantly different transcription factor MdWRI1 gene from the transcriptome sequencing results of the fruits of the full-rust and rust-free lines of the hybrid generation of 'Fuji' × 'Golden Delicious' apples. During fruit development, the expression level of the MdWRI1 gene in the rust-free line is higher than that in the full-rust line. The full-length cDNA is 1212 bp, and its nucleotide sequence is shown in Sequence Listing SEQ ID NO.1.
[0050] SEQ ID NO.1:
[0051]
[0052] To study the function of the MdWRI1 gene, the present invention constructs an overexpression vector, a silencing vector and an interfering vector of the MdWRI1 gene. The construction method of the gene overexpression vector is as follows:
[0053] Forward and reverse primers of the MdWRI1 gene were designed, and then the gene sequence was cloned from the cDNA of the fruit of the rust-free strain, and constructed onto the plant overexpression vector pCAMBIA2300 using the double restriction enzyme digestion sites of XbaⅠ and SmaⅠ to form the fusion plasmid MdWRI1-pCAMBIA2300, and it was transformed into Agrobacterium tumefaciens GV3101 by the freeze-thaw method. The primer sequences are as follows:
[0054] MdWRI1(XbaⅠ)-F: TCTAGAATGATGGTGAAGAATGAAGAAAACCCT(SEQ ID NO.2); MdWRI1(SmaⅠ)-R: CCCGGGAGAAAAGAAAAATATAGAGTCTG(SEQ ID NO.3).
[0055] The construction of the gene silencing vector is as follows:
[0056] A 400bp fragment of the non-conserved region of the cDNA of this gene was selected as the specific fragment, and its sequence is as shown in SEQ ID NO.4.
[0057] SEQ ID NO.4:
[0058] ATCCTTCTCACACACCAATCCTTTTGCCTCTGACTACCTGAACTCTCCGCGGAACCAAGAAGTCACCCGAAGCAGCACCAATCTTAACACGGGCAGCAAGTCGTCCTCTCCCACCGCACTTGGCCTCCTTCTTCAATCTTCAATTTTCCGAGAGCTGGTTCAGAAGAACTTGAATCTCTCCGAGGATGACAGCACTGACGACGAAGAACCAAAGAACCAACCGCAGGCTGGCAGCGATGATGAGTATGGTGGGATCTTCTATGCTGGAACCGGCGAAAACCCTTTTGTTTGCTCCTCCGGCACTGACGGCAACAATCCATGGAACAACATCGCAAGCACTATTTTGCTCAATCAACCCACAAAGGCAAATGCTTCAGACTCTATATTTTTCTTTTCTTAG.
[0059] Then, using the double restriction enzyme cleavage sites of XbaⅠ and KpnⅠ, the specific fragment was constructed onto the virus silencing vector pTRV2 to construct the recombinant plasmid pTRV2-MdWRI1, which was then transformed into Agrobacterium tumefaciens GV3101 by the freeze-thaw method. The primer sequences are as follows:
[0060] pTRV2-MdWRI1(BamHⅠ)-F:
[0061] GGATCCCTAAGAAAAGAAAAATATAGAGTCTGAAGCATTTGC(SEQ ID NO.5);
[0062] pTRV2-MdWRI1(XhoⅠ)-R:
[0063] CTCGAGATCCTTCTCACACACCAATCCTT(SEQ ID NO.6).
[0064] The construction of the interference vector is as follows:
[0065] A 400-bp fragment of the non-conserved region of the cDNA of this gene was selected as the specific fragment, and its sequence is shown in SEQ ID NO.4. Then, using the double restriction enzyme cleavage sites of SpeⅠ and BamHⅠ, and AscI and SwaI, SEQ ID NO.4 was constructed onto the interference vector pFGC1008 to construct the recombinant plasmid pFGC1008-MdWRI1, which was then transformed into Agrobacterium tumefaciens LBA4404 by the freeze-thaw method. The primer sequences are as follows:
[0066] MdWRI1-RNAi-AscⅠ-F: GGCGCGCCATCCTTCTCACACACCA(SEQ ID NO.7);
[0067] MdWRI1-RNAi-SwaⅠ-R: ATTTAAATCTAAGAAAAGAAAAATATAGAGT(SEQ ID NO.8).
[0068] MdWRI1-RNAi-SpeⅠ-F: ACTAGTATCCTTCTCACACACCAA(SEQ ID NO.9);
[0069] MdWRI1-RNAi-BamHⅠ-R: GGATCCCTAAGAAAAGAAAAATATAGAGTCT(SEQ ID NO.10).
[0070] Apple transient injection experiments, genetic transformation of apple tissue culture seedlings, wax component analysis, physiological data determination, and gene expression analysis showed that overexpression of the MdWRI1 gene can improve fruit quality by promoting wax biosynthesis and enhance leaf stress resistance at the same time; while silencing the MdWRI1 gene will reduce the wax content and damage leaf permeability. This indicates that the MdWRI1 gene plays an obvious role in regulating apple wax.
[0071] Example 1 Cloning of the full-length and specific fragments of the apple MdWRI1 gene
[0072] 1. RNA extraction and reverse transcription of fruits of rust-free apple strains
[0073] 1.1 Total plant RNA extraction
[0074] Use the RNAprep Pure Polysaccharide and Polyphenol Total Plant RNA Extraction Kit (Tiangen Biochemical Technology Co., Ltd., Beijing) to extract the total RNA content of apple fruit samples. The specific steps are as follows:
[0075] 1) Homogenization treatment. 50 - 100 mg of plant leaves or fruit pulp are quickly ground into powder in liquid nitrogen, add 500 μL of lysis buffer SL (please check whether β-mercaptoethanol has been added before use), and immediately vortex vigorously to mix evenly.
[0076] 2) Centrifuge at 12000 rpm for 2 min.
[0077] 3) Transfer the supernatant to the filter column CS in the collection tube, centrifuge at 12000 rpm for 2 min, carefully aspirate the supernatant in the collection tube into a new RNase-Free centrifuge tube, and try to avoid the pipette tip contacting the cell debris precipitate in the collection tube.
[0078] 4) Slowly add 0.4 times the volume of the supernatant of absolute ethanol, mix well, transfer the obtained solution and precipitate together into the adsorption column CR3, centrifuge at 12000 rpm for 15 s, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0079] 5) Add 350 μL of protein removal solution RW1 to the adsorption column CR3, centrifuge at 12000 rpm for 15 s, pour out the waste liquid in the collection tube, and put the adsorption column CR3 back into the collection tube.
[0080] 6) Preparation of DNase I working solution: Take 10 μL of DNase I stock solution and put it into a new RNase-Free centrifuge tube, add 70 μL of RDD buffer, and gently mix well.
[0081] 7) Add 80 μL of DNase I working solution to the center of the adsorption column CR3, and place it at room temperature for 15 min.
[0082] 8) Add 350 μL of deproteinized solution RW1 to adsorption column CR3, centrifuge at 12,000 rpm for 15 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube.
[0083] 9) Add 500 μL of washing solution RW to adsorption column CR3, centrifuge at 12,000 rpm for 15 s, pour out the waste liquid in the collection tube, and put adsorption column CR3 back into the collection tube.
[0084] 10) Repeat step 9).
[0085] 11) Centrifuge at 12,000 rpm for 2 min, put adsorption column CR3 into a new RNase-Free centrifuge tube, suspend and add 30 - 50 μL of RNase-Free ddH 2 O dropwise to the middle part of the adsorption membrane, let it stand at room temperature for 2 min, and centrifuge at 12,000 rpm for 1 min to obtain the RNA solution.
[0086] Store it in a -80 °C refrigerator. Before storage, detect the integrity of RNA by agarose gel electrophoresis and measure the concentration of RNA on an Agilent 2100 Bioanalyzer (Santa Clara, California, USA).
[0087] 1.2 Reverse transcription of RNA into cDNA
[0088] Use the HiScript II Q RT SuperMix for qPCR kit (Vazyme, Nanjing) to perform reverse transcription on the samples. The specific steps are as follows:
[0089] 1) Genomic DNA removal
[0090] Prepare the following mixture in an RNase-free centrifuge tube: 4 μL of 4×gDNA wiper Mix, 1 pg - 1 μg of template RNA, and make up to 16 μL with RNase-free ddH 2 O; gently pipette and mix well. React at 42 °C for 2 min.
[0091] 2) Prepare the reverse transcription reaction system
[0092] Add the following reagents to the reaction tube in step 1: 4 μL of 5×HiScript II qRT SuperMix II, 16 μL of the reaction solution in step 1. Gently pipette and mix well.
[0093] 3) Perform reverse transcription reaction: 50°C for 15 min, 85°C for 5 s. Obtain the reverse transcription product. The product can be immediately used for qPCR reaction, or stored at -20°C and used within half a year; for long-term storage, it is recommended to aliquot and store at -70°C. cDNA should be avoided from repeated freezing and thawing.
[0094] 2. Cloning of the full-length MdWRI1 gene
[0095] Using the cDNA in "1.2 RNA reverse transcription into cDNA" as a template, amplify with Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme. The upstream and downstream gene primers of MdWRI1 are as follows:
[0096] MdWRI1-F: ATGATGGTGAAGAATGAAGAAAAC (SEQ ID NO.11);
[0097] MdWRI1-R: CTAAGAAAAGAAAAATATAGAGTCTGA (SEQ ID NO.12).
[0098] The amplification steps are as follows:
[0099] 1) PCR reaction system
[0100] Upstream primer (10 μM) 2.5 μL, downstream primer (10 μM) 2.5 μL, 2×Phanta Max Buffer 25 μL, template DNA x μL, ddH 2 O make up to 50 μL.
[0101] Among them, the template usage includes: genomic DNA 50 - 400 ng, plasmid or viral DNA 10 pg - 30 ng, cDNA 1 - 5 μL (not exceeding 1 / 10 of the total PCR reaction volume).
[0102] 2) PCR reaction program: Pre-denature at 95°C for 3 min; the cycling parameters are denaturation at 95°C for 15 s, annealing at 58°C for 15 s, extension at 72°C for 70 s, for 35 cycles; fully extend at 72°C for 5 min.
[0103] After the PCR reaction, the PCR products were recovered, ligated to the cloning vector pMD18-T, transformed into Escherichia coli DH5α, spread on LB solid medium supplemented with 50 mg / L ampicillin, cultured overnight at 37 °C, and single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. The sequencing results were blasted and compared in the JGI database (https: / / phytozome-next.jgi.doe.gov), and the cloned sequence was identical to the MD09G1047600 sequence.
[0104] 3. Cloning of the specific fragment of the MdWRI1 gene
[0105] Using the cDNA in "1.2 Reverse transcription of RNA into cDNA" as a template, amplification was performed using the Phanta Max Super-Fidelity DNA Polymerase (P505) (Vazyme, Nanjing) high-fidelity enzyme.
[0106] The amplification steps and PCR reaction program were the same as those in "2. Cloning of the full-length MdWRI1 gene".
[0107] After the PCR reaction, the PCR products were recovered, ligated to the cloning vector pMD18-T, transformed into Escherichia coli DH5α, spread on LB solid medium supplemented with 50 mg / L ampicillin, cultured overnight at 37 °C, and single colonies were selected and sent to Shanghai Sangon Biotech Co., Ltd. for sequencing. Plasmids were extracted from the single colonies with correct sequencing to determine the specific fragment sequence of the MdWRI1 gene.
[0108] Example 2 Changes in the expression level of the MdWRI1 gene during development
[0109] 1) The pericarps of the fully rusted and non-rusted plant lines at different developmental stages were sampled and quickly fixed in liquid nitrogen. Total RNA was extracted from the pulp at the above different developmental stages and reverse transcribed into cDNA using the same method as in "1. RNA extraction and reverse transcription of apple fruits of non-rusted plant lines" in Example 1.
[0110] 2) Specific primers for MdWRI1 and the internal reference primers MdActin-F and MdActin-R of apples were designed in the non-conserved region of MdWRI1.
[0111] The sequences are as follows:
[0112] MdWRI1-qRT-F: CGACCTTCACCAACTTCC (SEQ ID NO.13);
[0113] MdWRI1-qRT-R: TCTTGCTTCCCATCTGCC (SEQ ID NO.14);
[0114] MdActin-F: TGACCGAATGAGCAAGGAAATTACT (SEQ ID NO.15);
[0115] MdActin-R: TACTCAGCTTTGGCAATCCACATC (SEQ ID NO.16);
[0116] 3) Using the cDNA obtained in step 2) as a template, adjust these cDNA templates with the apple internal reference primers MdActin-F and MdActin-R to make the concentrations of each cDNA template consistent.
[0117] 4) Perform qRT-PCR with the cDNA templates of consistent concentration to detect the expression level of the MdWRI1 gene.
[0118] The results showed that the expression level of the MdWRI1 gene was significantly higher in non-rusty fruits at 30 days and 60 days than in fully rusty fruits. It may positively regulate fruit wax synthesis ( Figure 1 in A and B), so the MdWRI1 gene was further studied later.
[0119] Example 3 Construction of the vector related to the MdWRI1 gene
[0120] Amplify the full-length cDNA sequence of the MdWRI1 gene obtained in "2. Cloning of the full length of the MdWRI1 gene" in Example 1 using the primer sequences of SEQ ID NO.2 and SEQ ID NO.3 respectively with XbaⅠ and SmaⅠ restriction enzyme sites. Refer to the gene cloning method in "2. Cloning of the full length of the MdWRI1 gene" in Example 1 and ligate it to the cloning vector pMD18-T to obtain the fusion plasmid MdWRI1-pMD18-T (XbaⅠ, SmaⅠ).
[0121] Then, digest the empty vector pCAMBIA2300 and MdWRI1-pMD18-T (XbaⅠ, SmaⅠ) with the restriction endonucleases XbaⅠ and SmaⅠ respectively, perform agarose gel electrophoresis, gel recovery, ligate the linear pCAMBIA2300 vector and the target gene MdWRI1 fragment with T4-DNA ligase, transform it into Escherichia coli DH5α, and extract the recombinant plasmid MdWRI1-pCAMBIA2300 from the single colony with correct sequencing.
[0122] The cDNA specific fragment of the MdWRI1 gene obtained in "3. Cloning of the specific fragment of the MdWRI1 gene" in Example 1 was amplified using the primer sequences of SEQ ID NO.9 and SEQ ID NO.10 respectively with SpeⅠ and BamHⅠ restriction enzyme sites. Referring to the gene cloning method in "2. Cloning of the full-length MdWRI1 gene" in Example 1, it was ligated to the cloning vector pMD18-T to obtain the fusion plasmid lower-MdWRI1-pMD18-T (SpeⅠ, BamHⅠ). It was amplified using the primer sequences of SEQ ID NO.7 and SEQ ID NO.8 respectively with Asc I and Swa I restriction enzyme sites. Referring to the gene cloning method in "2. Cloning of the full-length MdWRI1 gene" in Example 1, it was ligated to the cloning vector pMD18-T to obtain the fusion plasmid upper-MdWRI1-pMD18-T (Asc I, Swa I).
[0123] Then, the empty vector pFGC1008 and lower-MdWRI1-pMD18-T (SpeⅠ, BamHⅠ) were respectively digested with the restriction endonucleases SpeⅠ and BamHⅠ, subjected to agarose gel electrophoresis, gel recovery, and ligated with the linear pFGC1008 vector and the target gene MdWRI1 fragment using T4-DNA ligase. It was transformed into Escherichia coli DH5α, and the correct single colonies were sequenced, and the recombinant plasmid lower-MdWRI1-pFGC1008 was extracted.
[0124] Subsequently, lower-MdWRI1-pFGC1008 and upper-MdWRI1-pMD18-T (Asc I, Swa I) were respectively digested with the restriction endonucleases Asc I and Swa I, subjected to agarose gel electrophoresis, gel recovery, and ligated with the linear pFGC1008 vector and the target gene MdWRI1 fragment using T4-DNA ligase. It was transformed into Escherichia coli DH5α, and the correct single colonies were sequenced, and the recombinant plasmid MdWRI1-pFGC1008 was extracted.
[0125] Similarly, the cDNA specific fragment of the MdWRI1 gene obtained in "3. Cloning of the MdWRI1 gene specific fragment" in Example 1 was amplified using the primer sequences of SEQ ID NO.5 and SEQ ID NO.6 respectively with BamH I and XhoⅠ restriction enzyme sites. Referring to the gene cloning method in "2. Cloning of the full-length MdWRI1 gene" in Example 1, it was ligated to the cloning vector pMD18-T to obtain the fusion plasmid MdWRI1-VIGS-pMD18-T (BamH I, XhoⅠ). Then, the empty vector pTRV2 and MdWRI1-VIGS-pMD18-T (BamH I, XhoⅠ) were digested with the restriction endonucleases BamH I and XhoⅠ respectively, followed by agarose gel electrophoresis, gel extraction, and ligation with T4-DNA ligase of the linear pTRV2 vector and the specific fragment of the target gene MdWRI1. It was transformed into Escherichia coli DH5α, and the recombinant plasmid MdWRI1-pTRV2 was extracted from the single colony with correct sequencing.
[0126] The two recombinant plasmids MdWRI1-pCAMBIA2300 and MdWRI1-pTRV2 were transferred into Agrobacterium tumefaciens GV3101 by the freeze-thaw method respectively. The recombinant plasmid MdWRI1-pFGC1008 was transferred into Agrobacterium tumefaciens LBA4404 by electroporation.
[0127] Example 4 Transient transformation of the MdWRI1 gene into apple fruits
[0128] 1. Injection of the overexpression vector containing the MdWRI1 gene
[0129] 1) The bacterial solution of the MdWRI1-pCAMBIA2300 vector containing the target gene fragment, which had been shaken until golden yellow, was centrifuged at 5000 rpm for 10 min at 20°C, and the supernatant was discarded.
[0130] 2) The cells were resuspended with ddH 2 O, centrifuged at 5000 rpm for 10 min at room temperature, and the supernatant was discarded.
[0131] 3) The cells were resuspended with 10 mM MgCl 2 , centrifuged at 5000 rpm for 10 min at room temperature, and the supernatant was discarded.
[0132] 4) The cells were resuspended with 10 mM MgCl 2 , and the OD 600nm was adjusted to 0.6 - 0.8.
[0133] 5) 10 mM MES and 150 mM acetosyringone (AS) were added.
[0134] 6) After standing in the dark for 2 - 3 h, the apples were injected, and the phenotypes were observed 3 - 5 days later.
[0135] 2. Injection of the silencing vector containing the MdWRI1 gene
[0136] 1) Centrifuge the pTRV2 and pTRV1 helper vector bacterial solutions containing the target gene fragment that have been shaken until golden at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0137] 2) Resuspend the bacterial cells with ddH 2 O, centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0138] 3) Resuspend the bacterial cells with 10 mM MgCl 2 , centrifuge at 5000 rpm for 10 min at room temperature, and discard the supernatant.
[0139] 4) Resuspend the bacterial cells with 10 mM MgCl 2 , adjust OD 600nm = 0.6 - 0.8.
[0140] 5) Mix the pTRV2 vector ligated with the gene and the pTRV1 helper vector in equal volumes at a ratio of 1:1.
[0141] 6) Add 10 mM MES and 150 mM acetosyringone.
[0142] 7) Inject apples after standing in the dark for 2 - 3 h, and observe the phenotype 3 - 5 days later.
[0143] Example 5 Subcellular localization of the MdWRI1 gene
[0144] In the same way as the above transient overexpression method for fruits, insert the digested MdWRI1 fragment into the pCAMBIA2300 - GFP vector (Sma I / Xba I) to generate a MdWRI1 - green fluorescent protein (GFP) fusion protein construct. Transfer the obtained construct into Agrobacterium tumefaciens GV3101 and infect fresh onion scales. Observe the infected onion scales using EVOS FL AUTO2 (Thermo Fisher Scientific, Massachusetts, USA). The specific steps are as follows:
[0145] 1) Use fresh onions, first remove the outer scales, then on a clean bench, cut the inner epidermis of the onions into small pieces with a sterilized blade, pick up the inner epidermis with sterilized forceps, lay it flat on a solid medium of 1 / 2MS without any hormones, and culture it in the dark in an incubator at 28°C for about 24 h.
[0146] 2) In the dark environment, add the previously transformed pCAMBIA2300-GFP-MdWRI1 Agrobacterium liquid to the LB liquid medium (containing 100 mg / L kanamycin and 100 mg / L rifamycin), and culture it on a constant temperature shaker at 28 °C with an oscillation speed of 200 rpm to obtain the optimal strain growth environment. Measure OD 600 to be around 0.8 - 1.0. At the same time, culture Mcherry (nuclear localization marker) to an OD 600 value of around 0.8 - 1.0. According to the final concentration of the Agrobacterium of the target gene and Mcherry, calculate the dosage of each bacterial liquid, transfer it to a 50 mL centrifuge tube, centrifuge at a speed of 5000 rpm for 10 min, then discard the supernatant, retain the bacterial cells, and resuspend them with 1 / 2 MS liquid medium containing acetosyringone.
[0147] 3) Put the pre-treated inner epidermis of the onion into the pre-prepared infection solution for 15 min, and stir regularly to improve the impregnation effect. Then, use sterile filter paper to remove the impregnation solution, and place it on a 1 / 2 MS solid medium containing acetosyringone, and incubate at 28 °C for 16 h (operate throughout on a clean bench).
[0148] 4) Under the AUTO2 microscope, first immerse the onion epidermis in 1 / 2 MS liquid medium, then wash it in sterile water, and finally spread out the epidermis on a clean glass slide, cover it with a coverslip to remove air bubbles, and finally observe the localization of the target protein at the subcellular level.
[0149] The results showed that MdWRI1-GFP was localized in the nucleus ( Figure 1 in C), and the scale bar was 125 μm.
[0150] Example 6 Analysis of the phenotype and wax components of transiently transformed apple fruits
[0151] 1. Photographing the phenotype of apple fruits
[0152] Place the apple fruits of the four experimental groups in a small photography studio respectively, and use a camera to take pictures of the injection holes. Obvious injection holes can be observed on the surfaces of the fruits in the four experimental groups. See the pCAMBIA2300 apple fruits and MdWRI1-pCAMBIA2300 fruits in Figure 2 A; See the pTRV2 and MdWRI1-pTRV2 fruits in Figure 3 A.
[0153] 2. Analysis diagram of wax components
[0154] 1) Fruit wax extraction: Immerse fruit slices in chloroform. Concentrate the combined extracts using a rotary evaporator under a nitrogen stream at 55 °C, and determine the wax yield by gravimetry. The wax content is calculated by the following equation:
[0155] Wax content (μg / dm 2 ) = wax weight / peeled sample area.
[0156] 2) GC-MS analysis of wax components:
[0157] For the wax extraction of the injected sample peel, the wax content in the peel of MdWRI1-pCAMBIA2300 fruits increased significantly and was twice that of pCAMBIA2300 fruits ( Figure 2 in B); the wax content in the peel of MdWRI1-pTRV2 fruits decreased significantly ( Figure 3 in B).
[0158] GC-MS was used to determine the wax components. The main wax components, alkanes, fatty acids, fatty aldehydes, and fatty alcohols, were all detected ( Figure 2 in C). In MdWRI1-pCAMBIA2300 fruits, 15 monomer components of alkanes were mainly detected. Among them, the components with carbon chain lengths of 9, 11, 13, 14, 16, 20, 26, 30, and 36 were significantly increased, and the even-carbon chains were dominant; the contents of C10 and C32 decreased relatively, and C15 and C29 were only detected in the peel of MdWRI1-pCAMBIA2300 fruits ( Figure 2 in F). Four monomer components of fatty acids, C9, C19, C21, and C36, were detected, and their contents all increased significantly after overexpressing the MdWRI1 gene ( Figure 2 in G). A small amount of fatty aldehydes and fatty alcohols were detected, and their contents were twice that of pCAMBIA2300 fruits ( Figure 2 in D, E).
[0159] In MdWRI1-pTRV2, except that the total amount of fatty alcohols was significantly down-regulated, the total amounts of the other three components decreased less ( Figure 3 in C); further determination of the changes in the contents of each component in the injected sample found that among the 15 monomer components of alkanes detected, the components with carbon chain lengths of 9, 13, 17, and 30 decreased significantly, and the odd-carbon chains were dominant ( Figure 3 in F). The content of the fatty alcohol monomer with a carbon chain length of 27 was detected to decrease, with no significant difference ( Figure 3 in D). The content of the fatty alcohol monomer with a carbon chain length of 31 was detected to decrease by about 1.5 times ( Figure 3 in E). Four monomer components of fatty acids, C9, C19, C21, and C36, were detected, and their contents decreased in MdWRI1-pTRV2, with no significant difference ( Figure 3 in G).
[0160] Example 7 Expression levels of wax-related genes in transiently transformed apple fruits
[0161] 1) Samples of apple pulp from 4 experimental groups were taken separately and quickly fixed in liquid nitrogen. Total RNA of the pulp from different groups above was extracted separately and reverse transcribed into cDNA using the same method as "1. RNA extraction and reverse transcription of apple fruits of rust-free lines" in Example 1.
[0162] 2) The specific primer sequences of the MdWRI1 gene are shown in SEQ ID NO.13 and SEQ ID NO.14. Specific primers were designed in the non-conserved regions of the MdCER1, MdCER2, MdKCS7, MdLTPG1, and MdLACS2 genes, and the sequences are as follows:
[0163] MdCER1-qRT-F: CTTGGAAGCTTTAAGCATGTGG (SEQ ID NO.17);
[0164] MdCER1-qRT-R: GGAGGAATGGTGATGTGAGTGG (SEQ ID NO.18);
[0165] MdCER2-qRT-F: ATCCGGATAACCGAAACGGG (SEQ ID NO.19);
[0166] MdCER2-qRT-R: AGGCAGAAAACGCATCTCCA (SEQ ID NO.20);
[0167] MdKCS7-qRT-F: CCCTAAAAACCAACATCACCAC (SEQ ID NO.21);
[0168] MdKCS7-qRT-R: AGGCACCTCTACAGGAAACTCA (SEQ ID NO.22);
[0169] MdLTPG1-qRT-F: AAATGATTGCGGTGTTGTT (SEQ ID NO.23);
[0170] MdLTPG1-qRT-R: TCCAGTAGTGGGAGTTGCT (SEQ ID NO.24);
[0171] MdLACS2-qRT-F: CTCCCACAAGAAAAAGCAGCACC (SEQ ID NO.25);
[0172] MdLACS2 - qRT - R: CTCTCAGGCAAATCTCTCCACGG (SEQ ID NO.26).
[0173] 3) Using the cDNA obtained in step 1) as a template, adjust these cDNA templates with the apple internal reference primers MdActin - F (SEQ ID NO.15) and MdActin - R (SEQ ID NO.16) to make the concentrations of each cDNA template consistent.
[0174] 4) Perform qRT - PCR using cDNA templates with consistent concentrations to detect the expression differences of MdCER1, MdCER2, MdKCS7, MdLTPG1, MdLACS2, and MdWRI1 genes in fruits of different experimental groups.
[0175] It was found that the expression level of the MdWRI1 gene in MdWRI1 - pCAMBIA2300 fruits was significantly higher than that in the control fruits (empty vector pCAMBIA2300); while the expression levels of wax - related genes in MdWRI1 - pCAMBIA2300 fruits were significantly up - regulated ( Figure 2 in H). Compared with the control fruits (empty vector pTRV), the expression level of the MdWRI1 gene in MdWRI1 - pTRV fruits was significantly decreased, while in MdWRI1 - pTRV2 fruits, the expression levels of wax - related genes were significantly down - regulated ( Figure 3 in H). These results fully indicate that the MdWRI1 gene plays a positive regulatory role in fruit wax synthesis, and the MdWRI1 gene plays a positive regulatory role in fruit wax by promoting wax biosynthesis.
[0176] Example 8 Phenotype, Wax Component Analysis and Expression Levels of Wax - Related Genes in Apple Tissue - Cultured Seedlings Transformed with Leaf Disks
[0177] 1. Photographing the phenotype of apple tissue - cultured seedlings
[0178] Take pictures of wild - type 'GL - 3' and transgenic apple tissue - cultured seedlings ( Figure 4 in A, Figure 5 in A);
[0179] 2. Diagram of wax component analysis
[0180] The results showed that the total wax content in the leaves of MdWRI1 - pCAMBIA2300 plants was significantly higher than that in the control group, reaching 1.5 - 2 times ( Figure 4 in B). The GC - MS results showed that the main components of wax in apple 'GL - 3' tissue - cultured seedlings were mainly phenols, fatty acids, and alkanes, and the content of alkane compounds increased particularly significantly ( Figure 4In (C). Eleven monomeric components of alkanes were screened out, and the carbon chain lengths of 10, 12, 13, 15, and 22 were all significantly increased in the three MdWRI1-pCAMBIA2300 strains ( Figure 4 In (D). The fatty acid monomeric components C19, C21, C36 and the phenolic monomeric component C31 were significantly increased in OE-4 and OE-6 ( Figure 4 In (E, F).
[0181] The total wax content in the leaves of MdWRI1-pFGC1008 plants was significantly lower than that of the control group ( Figure 5 In (B). The GC-MS results showed that the contents of phenolic, fatty acid and alkane compounds all decreased significantly ( Figure 5 In (C). Twelve monomeric components of alkanes were screened out, and the carbon chain lengths of 9, 10, 12, 13, 14, 15, and 17 were all significantly decreased in the three MdWRI1-pFGC1008 strains ( Figure 5 In (D). The fatty acid monomeric components C19, C21 and the phenolic monomeric components C30 and C31 all decreased significantly ( Figure 5 In (E, F).
[0182] Therefore, we speculate that in apple 'GL-3', the MdWRI1 transcription factor not only promotes wax synthesis, but also affects the composition of wax components. Among them, alkanes are the main components, accompanied by a small number of fatty acids and phenolic substances.
[0183] 3. Expression levels of wax-related genes in transgenic plants
[0184] By measuring the expression levels of genes related to the wax synthesis pathway in transgenic apple plants, it was found that compared with their respective controls, the expression levels of the wax synthesis genes KCS1, KCS7, LTPG1, and LACS2 in MdWRI1-pCAMBIA2300 plants were significantly up-regulated ( Figure 4 In (J). The expression levels of the wax synthesis genes KCS1, KCS7, LTPG1, and LACS2 in MdWRI1-RNAi plants were significantly down-regulated ( Figure 5 In (J). We infer that the MdWRI1 gene may affect the wax synthesis in transgenic plants by regulating the expression of these key genes.
[0185] Example 9 Determination of physiological indexes of transgenic plants
[0186] 1) TB staining: The leaves of four-week-old tissue culture seedlings were cut and completely immersed in 0.05% toluidine blue solution for 2 h. Then the materials were removed and rinsed 2-3 times with deionized water.
[0187] 2) Chlorophyll extraction: Weigh the leaves of 6-week-old tissue culture seedlings and place them in 30 mL of 80% ethanol with slow stirring at room temperature (in the dark). Take out the extract from each sample every 10 min and repeat ten times. Measure the absorbance at wavelengths of 664 nm and 647 nm, and calculate the micromolar concentration of total chlorophyll per gram of fresh weight using the following formula: Total micromolar chlorophyll = 7.93(A 664 ) + 19.53(A 647 ).
[0188] 3) Hydrophobicity determination: Lay the leaves of 4-week-old tissue culture seedlings flat, drop the same volume of water droplets on the surface and measure the contact angle of the water droplets.
[0189] The TB staining test was used to observe the changes in wax permeability. The experimental results showed that compared with wild-type plants, the leaves of MdWRI1-pCAMBIA2300 showed lower permeability during the staining process ( Figure 4 in H), and the leaves of MdWRI1-RNAi showed higher permeability during the staining process ( Figure 5 in H), indicating that MdWRI1 can change the permeability of the epidermis. In addition, through the chlorophyll extraction experiment, we found that the process of extracting chlorophyll from MdWRI1-pCAMBIA2300 plants was significantly slower ( Figure 4 in G), and the process of extracting chlorophyll from MdWRI1-RNAi plants was significantly faster ( Figure 5 in G), which further confirmed the change in the cuticular membrane permeability of its leaves. To verify the hydrophobicity of the leaves, we applied the same volume of water droplets on the leaves. It was observed that the contact area of the water droplets on the leaves of MdWRI1-pCAMBIA2300 plants was smaller, indicating that the leaves of MdWRI1-pCAMBIA2300 plants had higher hydrophobicity ( Figure 4 in I). The contact area of the water droplets on the leaves of MdWRI1-RNAi plants was larger, indicating that the leaves of MdWRI1-RNAi plants had reduced hydrophobicity ( Figure 5 in I). These findings provide a new perspective for understanding the role of the MdWRI1 gene in regulating the characteristics of the leaf wax layer.
[0190] According to the above technology, a transcription factor MdWRI1 was isolated from apples. It can be seen from the functional verification in apple transient injection experiments and the functional verification in transgenic plants that the MdWRI1 gene plays an obvious role in promoting the wax synthesis of apple fruits. The discovery of the MdWRI1 gene provides a basis for improving the quality of apple fruits and has important economic and social benefits for improving apple quality.
[0191] The embodiments described above are only descriptions of the preferred embodiments of the present invention and do not limit the scope of the present invention. Without departing from the spirit of the present invention's design, various deformations and improvements made by those of ordinary skill in the art to the technical solutions of the present invention shall fall within the protection scope determined by the claims of the present invention.
Claims
1. Use of an apple MdWRI1 gene in any of the following: (1) Application in regulating the wax content of plant fruits and / or leaves; (2) Application in cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products for increasing the wax content of plant fruits and / or leaves; The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.
1.
2. The use according to claim 1, characterized in that Up-regulating the expression level of the apple MdWRI1 gene in plants to increase the wax content in fruits and / or leaves of the plants; The plant is apple.
3. The use according to claim 2, characterized in that The method for up-regulating the expression level of the apple MdWRI1 gene in plants comprises the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.
4. Use of a recombinant vector comprising the apple MdWRI1 gene of claim 1 in any of the following: (1) Application in regulating the wax content of plant fruits and / or leaves; (2) Application in cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products for increasing the wax content of plant fruits and / or leaves.
5. Use of an engineered bacterium comprising the recombinant vector according to claim 4 in any of the following: (1) Application in regulating the wax content of plant fruits and / or leaves; (2) Application in cultivating transgenic plants with high wax content in fruits and / or leaves; (3) Application in the preparation of products for increasing the wax content of plant fruits and / or leaves.
6. A method for increasing the wax content of plant fruits and / or leaves, characterized in that: The method comprises the steps of up-regulating the expression level of the apple MdWRI1 gene in the plant to increase the wax content of the fruit and / or leaves of the plant; The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1; The plant is apple.
7. The method according to claim 6, characterized in that The method for up-regulating the expression level of the apple MdWRI1 gene in plants comprises the steps of constructing an overexpression vector of the apple MdWRI1 gene, transforming the overexpression vector into Agrobacterium, and then infecting the plant.
8. A method for breeding transgenic plants with high wax content in fruits and / or leaves, characterized in that: The following steps are involved: Overexpressing the apple MdWRI1 gene in plant cells, then cultivating the plant cells, and using the plant cells to regenerate plants, thereby obtaining transgenic plants with increased wax content in fruits and / or leaves; The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.1; The plant is apple.
9. An application of the apple MdWRI1 gene in improving plant drought resistance and / or disease and insect pest resistance, characterized in that: The nucleotide sequence of the MdWRI1 gene is shown in SEQ ID NO.
1.
10. The use according to claim 9, characterized in that The apple MdWRI1 gene improves the drought resistance and / or disease and insect pest resistance of the plant by increasing the wax content in the fruit and / or leaves of the plant.
Citation Information
Patent Citations
Cloning and application of wax-synthesis-related gene MdCER1 in apple
CN108823220A
Application of apple MdMYS1 gene in regulation and control of wax content of plant fruits and leaves
CN121320380A
Nucleic acid molecules encoding wrinkled1-like polypeptides and methods of use in plants
US20070199103A1