Method for constructing mango core germplasm based on SSR fluorescence labeling

Abstract

The invention belongs to the technical field of plant germplasm resource evaluation, and particularly relates to a method for constructing mango core germplasm based on SSR fluorescent labeling. According to the method, mango sample genetic diversity analysis is carried out through an SSR molecular marker technology, and related parameters of germplasm resource molecular data are calculated; carrying out overall clustering sampling on the mangoes by using a UPGMA clustering method according to the genetic distance, and specifically, adopting a site-first sampling strategy and Neiamp; and the Li genetic distance is used for gradually clustering and sampling the whole mango germplasm resources to construct the core germplasm. The constructed mango core germplasm has rich genetic diversity, the number of lost alleles is small, the genetic diversity of the original germplasm can be represented to the maximum extent with the minimum number of resources, and a theoretical basis is provided for preservation of mango germplasm, breeding of new varieties and development and utilization of the mango germplasm.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant germplasm resource evaluation, and particularly relates to a method for constructing a mango core germplasm based on SSR fluorescence markers. Background Art

[0002] Mango (Mangifera indica Linnaeus.) belongs to the genus Mangifera of the Anacardiaceae family and is widely cultivated in tropical and subtropical regions.

[0003] Germplasm resources are an important material basis for new variety breeding and research. Although valuable resources provide a large number of materials for mango genetic improvement research, the large quantity brings difficulties to resource preservation, evaluation, identification, and utilization. Core germplasm represents the diversity of the entire genetic resources to the greatest extent with the smallest resource quantity and genetic repetition. Its establishment not only ensures genetic diversity but also reduces the resource quantity. Therefore, it is very urgent and necessary to establish a core germplasm for the preserved mango resources.

[0004] The data sources for constructing core germplasm mainly include two categories: based on morphological markers and molecular markers. Compared with morphological markers, molecular markers based on DNA polymorphism are not affected by the growth period and environment of plants and are more suitable for genetic diversity evaluation and core germplasm construction. SSR fluorescence technology is a detection system for fluorescence sequencing of SSR amplification products. It can obtain the accurate size of the target DNA fragment, can distinguish differential fragments with only a 2bp difference, has the advantages of high accuracy and good repeatability, and can construct high-throughput DNA fingerprint maps.

[0005] Tang Yujuan et al. published a paper titled "Genetic Diversity Analysis and Molecular Identification Card Construction of Mango Germplasm Resources Based on SSR Fluorescence Markers". The TP-M13-SSR markers developed in this paper can conduct genetic diversity analysis and molecular identification card construction on 145 mango local varieties, cultivated varieties, and their related wild species preserved in the Guangxi Innovation Base Nursery for Mango Germplasm Resource Protection.

[0006] Patent document CN115992279A discloses an SSR molecular marker primer and its application in identifying true and false hybrids of mango F1 and analyzing genetic characteristics. The SSR molecular marker primer includes primer MG-023, primer MG-030, primer MG-039, primer MG-046, primer MG-187, primer MG-055, primer MG-063, primer MG-079, primer MG-114, primer MG-146, primer MG-150, primer MG-177, and / or primer MG-061. These 13 pairs of mango core primers can effectively reveal the genetic diversity of mango seedlings and better identify existing main cultivars, providing theoretical guidance for the selection of parents in mango cross-breeding, etc.

[0007] However, currently, there is still relatively little research on the construction of mango core germplasm at home and abroad, which is not conducive to the preservation, breeding of new varieties, and development and utilization of mango germplasm. Therefore, studying and constructing a suitable method for constructing mango core germplasm is of great guiding significance for the exploration and utilization of excellent mango germplasm resources and the breeding of new mango varieties. Summary of the Invention

[0008] The purpose of the present invention is to provide a method for constructing mango core germplasm based on SSR fluorescence labeling. The present invention screens out 12 pairs of SSR fluorescence primers with high stability and good repeatability through polyacrylamide gel electrophoresis, and uses the 12 pairs of screened SSR fluorescence primers to analyze the genetic diversity of 431 mango germplasm; according to the SSR fluorescence labeling data, by comparing different genetic distances, sampling scales, and sampling strategies, the most suitable method for constructing mango core germplasm is determined, and mango core germplasm is constructed, providing a theoretical basis for the preservation, breeding of new varieties, and development and utilization of mango germplasm.

[0009] The present invention provides a primer for constructing mango core germplasm based on SSR fluorescence labeling, including 12 pairs of SSR primers, and the sequences of the 12 pairs of SSR primers are shown as SEQ ID NO.1 to SEQ ID NO.24.

[0010] Specifically, the 12 pairs of SSR primers provided by the present invention are MG027, MG037, MG070, MG085, MG106, MG129, MG131, MG145, MG150, MG158, MG166, MG178;

[0011] The forward primer of MG027 is GAGGCCAACTCAAACAAGGA (SEQ ID NO.1), and the reverse primer is TGGCTTCTGTCTCTCTGGGT (SEQ ID NO.2); the forward primer of MG037 is CAAAATCCGACTTACCCGAA (SEQ ID NO.3), and the reverse primer is TCCACCATCATCTTCACCAA (SEQ ID NO.4); the forward primer of MG070 is TGGAATTGTGGTTGCAGTGT (SEQ ID NO.5), and the reverse primer is GTTCACCTGCAGATGGGTTT (SEQ ID NO.6); the forward primer of MG085 is ATGGTGGTTCAAGATTCGGA (SEQ ID NO.7), and the reverse primer is CGTTTCTGGGTTTCTGCAAT (SEQ ID NO.8); the forward primer of MG106 is AATCTTTCTCAGCAGGGGGT (SEQ ID NO.9), and the reverse primer is ATCTCCACCAATGAAGTCCG (SEQ ID NO.10); the forward primer of MG129 is CATAAGCAGAGCGAAGGGAG (SEQ ID NO.11), and the reverse primer is TTGGTACTTGATCTGCGTGG (SEQ ID NO.12); the forward primer of MG131 is TTAACTTGCTCCACCCAACC (SEQ ID NO.13), and the reverse primer isGGGACCTTGTTTCTTGGACA (SEQ ID NO.14); the forward primer of MG145 is CATGGGAAAATTTGGGACAC (SEQ ID NO.15), and the reverse primer is TCAGAATCCCATGCACAAAA (SEQ ID NO.16); the forward primer of MG150 is GAGGATAGCCACTTCCACCA (SEQ ID NO.17), and the reverse primer is ACCTTCACCCACCTCCTTCT (SEQ ID NO.18); the forward primer of MG158 is ACTTTCGCTACCGCTGAAGA (SEQ ID NO.19), and the reverse primer is TTTAGGATGATGAGGTCGGC (SEQ ID NO.20); the forward primer of MG166 is TTCATGAGGTGCTGGTGAAG (SEQ ID NO.21), and the reverse primer is ACGAACCAGGATCAGGAAGA (SEQ ID NO.22); the forward primer of MG178 is ACACCTCCCTGGGAACTTTT (SEQ ID NO.23), the reverse primer is CTTGAGCAAAGGGTGCAAAT (SEQ ID NO. 24).

[0012] The present invention provides a method for constructing a mango core germplasm based on SSR fluorescence labeling, comprising the following steps:

[0013] Step S1, DNA extraction and amplification: Extract the genomic DNA of the mango samples in the original population, perform SSR-PCR amplification using the above primers, and collect the original data;

[0014] Step S2, genetic diversity data analysis: Analyze the capillary electrophoresis data, and calculate the polymorphism information content, number of alleles, effective number of alleles, Shannon-Weaver diversity index, and Nei's gene diversity index of the molecular data of the germplasm resources;

[0015] Step S3, construction of the core germplasm: Calculate the genetic distance, perform cluster analysis using the UPGMA clustering method, and conduct a t-test on the core germplasm and the initial germplasm.

[0016] Further, the mango samples in step S1 are the genomic DNA of young mango leaves.

[0017] Further, a fluorescent label FAM is added to the 5' end of each pair of primers in step S1.

[0018] Further, the SSR-PCR amplification system in step S1 is as follows:

[0019] 2 μL of 10×Ex Taq Buffer, 1.6 μL of 25 mmol / L MgCl 2 、0.25 μL of 4×dNTP Mixture, 1 μL of 10 μmol / L Forward primer, 1 μL of 10 μmol / L Reverse primer, 2 μL of 20 ng / μL genomic DNA, 0.15 μL of 5 U / μL Taq DNA polymerae, 12 μL of ddH 2 O

[0020] Further, the SSR-PCR amplification program in step S1 is as follows:

[0021] Pre-denaturation at 94°C for 2.5 min; denaturation at 94°C for 30 s, annealing at 48 - 54.4°C for 45 s, extension at 72°C for 1 min; the number of cycles is 35, and finally extension at 72°C for 5 min, and preservation at 4°C.

[0022] Further, the clustering analysis in step S3 adopts a multi - clustering method, and constructs the core collection by using the Nei&Li genetic distance and the locus - first sampling strategy.

[0023] Further, the sampling ratio of the method is 19 - 20%, and the present invention extracts 85 germplasm samples from 431 mango germplasm resources at a ratio of 19.7% to form the mango core collection.

[0024] Compared with the prior art, the method for constructing the mango core collection based on SSR fluorescence markers provided by the present invention has the following advantages:

[0025] (1) The 12 pairs of SSR fluorescence - labeled primer screened by the present invention have the advantages of clear bands, good repeatability, high stability and high polymorphism in the amplification of 431 mango germplasms. The genetic diversity of the 431 mango germplasm resources based on SSR markers is as follows: the average observed number of alleles of the 12 pairs of primers is 7.5833, the average number of effective alleles is 4.0993, the average value of the variation range of the shannon index (I) is 1.534, the average value of the Nei's gene diversity index (Na) is 0.7361, and the average value of the distribution range of the polymorphic information content PIC is 0.6962, indicating that the 12 pairs of SSR fluorescence - labeled primers screened by the present invention are suitable for the construction of the mango core collection.

[0026] (2) When the present invention adopts the locus - first sampling strategy and the Nei&Li genetic distance to select samples at a ratio of 19 - 20%, the constructed core collection has rich genetic diversity and fewer lost alleles, and can represent its genetic diversity to the greatest extent with the smallest number of resource copies, indicating that the method for constructing the mango core collection based on SSR fluorescence markers provided by the present invention is effective and has good reliability.

[0027] (3) The observed number of alleles, the number of effective alleles, Nei's diversity number and Shannon's information index of the core collection constructed by using the method for constructing the mango core collection based on SSR fluorescence markers provided by the present invention have no significant difference from those of the original germplasm, and its representativeness to the original germplasm is better than that of the reserved germplasm, indicating that the core mango collection constructed by the present invention is representative, and this core collection can provide a theoretical basis for the preservation, new variety breeding and development and utilization of mango germplasm. Description of the Drawings

[0028] Figure 1 It is a diagram of the number of polymorphic loci retained by two sampling strategies and two genetic distances under different sampling conditions.

[0029] Figure 2 It is a principal coordinate diagram of the core collection constructed by the locus - first sampling strategy and the original germplasm. Detailed Embodiment

[0030] The present invention will be further described below through the description of specific embodiments. However, this is not a limitation of the present invention. Those skilled in the art can make various modifications or improvements based on the basic idea of the present invention. As long as they do not depart from the basic idea of the present invention, they are within the scope of the present invention. The test methods used in the experiments involved in the present invention are all conventional methods unless otherwise specified; the materials and reagents used in the examples of the present invention are all commercially available materials for biochemical experiments unless otherwise specified.

[0031] Example 1: Primers for constructing the core germplasm of mango based on SSR fluorescence labeling

[0032] The present invention has successfully developed mango SSR markers through transcriptome sequencing, screened 200 pairs of ordinary SSR primers with the amplified product fragment lengths between 100 and 300 bp, and added the fluorescence label FAM (6-carboxy-fluorescein) to the 5′ end of each pair of the screened ordinary SSR primers. The fluorescence primers used in the experiment were synthesized by Shanghai Invitrogen Biotechnology Co., Ltd.

[0033] The present invention screened 12 pairs of SSR fluorescence primers with clear amplified bands, good repeatability and high stability from the developed 200 pairs of ordinary SSR primers. The specific 12 pairs of primers are shown in Table 1.

[0034] Table 1 Primers for constructing the core germplasm of mango based on SSR fluorescence labeling

[0035]

[0036]

[0037] Example 2: Mango germplasm resource materials

[0038] 431 mango germplasm resources were selected, and all of the 431 germplasms were taken from the Guangxi Innovation Base for the Conservation of National Mango Germplasm Resources. Specifically, it is shown in Table 2.

[0039] Table 2 List of 431 mango germplasm test materials

[0040]

[0041]

[0042]

[0043]

[0044]

[0045]

[0046]

[0047] Example 3. A method for constructing a core collection of mango based on SSR fluorescence labeling

[0048] 1. Test time and location:

[0049] The test was carried out in the Key Laboratory of the Subtropical Crops Research Institute of Guangxi Zhuang Autonomous Region from 2022 to 2023.

[0050] 2. Test materials:

[0051] 431 mango germplasm resources taken from the Guangxi Innovation Base for the Conservation of National Mango Germplasm Resources in Example 2.

[0052] 3. Test method:

[0053] Step S1. DNA extraction and amplification:

[0054] The genomic DNA of the young leaves of the test materials in Example 2 was extracted using the DNeasy Plant Mini Kit from QIAGEN, Germany, and SSR-PCR amplification was carried out using the primers in Table 1 of Example 1.

[0055] The PCR reaction system of the SSR primers is as follows: 2 μL of 10×Ex Taq Buffer, 1.6 μL of 25 mmol / L MgCl 2 , 0.25 μL of 4×dNTP Mixture, 1 μL of 10 μmol / L Forward primer, 1 μL

[0056] 10 μmol / L Reverse primer, 2 μL of 20 ng / μL genomic DNA, 0.15 μL of 5 U / μL Taq DNA polymerase, 12 μL of ddH 2 O.

[0057] The amplification program is: pre-denaturation at 94°C for 2.5 min; denaturation at 94°C for 30 s, annealing at 48 - 54.4°C for 45 s, extension at 72°C for 1 min; the number of cycles is 35, and finally extension at 72°C for 5 min, and stored at 4°C for standby.

[0058] The PCR reaction was carried out on a Bio-Rad PTC-200; the purification system of the SSR fluorescent primers and amplification products was referred to the method of Gao Yuan et al. (2015) and modified appropriately. The SSR fluorescently labeled products after PCR amplification on a Bio-Rad PTC-200 and purification were subjected to fluorescence detection on an ABI 3730 genetic sequencer in the United States, and the original data were collected.

[0059] Step S2, Genetic diversity data analysis:

[0060] Analyze capillary electrophoresis data using the software Gene marker 2.2.0; calculate the polymorphism information content, number of alleles, effective number of alleles, Shannon-Weaver diversity index, and Nei's gene diversity index of the molecular data of germplasm resources using the POPGENE V1.31 software.

[0061] Step S3, Construction of core germplasm:

[0062] Adopt Jaccard similarity coefficient and Nei&Li similarity coefficient to estimate the genetic distance. According to the genetic distance, use the UPGMA clustering method and perform clustering analysis using the NTSYSpc-2.10e software. Conduct overall clustering sampling on mangoes. Refer to the multiple clustering methods of Hu et al., take the random sampling strategy as the control, and adopt the locus priority sampling strategy to construct the core germplasm. Among the two strains at the lowest taxonomic level, preferentially select the strain with the largest number of rare alleles (allele frequency less than 5%) to enter the next round of clustering; if the number of rare alleles of the two strains is equal, preferentially select the strain with a smaller allele frequency value of the rare alleles between the two. If this value is still the same, randomly select the two strains; the random sampling strategy is to randomly select a genetic material from the two strains at the lowest taxonomic level to enter the next round of clustering. If there is only one genetic material in the group, this material directly enters the next round of clustering. After each sampling, enter the next round of clustering and screening until the set sampling ratio.

[0063] 4. Experimental results:

[0064] 4.1 Results of mango genetic diversity analysis:

[0065] The results of genetic diversity analysis of 431 mango germplasm resources based on SSR markers are shown in Table 3:

[0066] Table 3 Genetic diversity of 431 mango germplasm resources based on SSR markers

[0067]

[0068] As can be seen from Table 3, the observed number of alleles of the 12 pairs of primers provided by the present invention ranges from 4 to 11. Among them, the primer MG145 has the most, which is 11, and the average number of alleles is 7.5833; the effective number of alleles ranges from 2.4785 to 6.3256, with an average value of 4.0993; the Shannon index variation range (I) is between 1.003 and 1.9459, with an average value of 1.534; the Nei gene diversity index (Na) is between 0.5965 - 0.8419, with an average value of 0.7361. The polymorphism information content PIC ranges from 0.5243 to 0.8226, with an average value of 0.6962. The above results indicate that the 12 pairs of primers screened in this study have high polymorphism in 431 germplasms, indicating that mango germplasms have rich genetic diversity.

[0069] 4.2. Comparison results of locus - priority sampling strategy and random sampling strategy:

[0070] Using the random sampling strategy and the locus - priority sampling strategy, the core collections of mango germplasm resources were constructed by step - by - step clustering sampling of the whole with SM genetic distance and Nei&Li genetic distance respectively.

[0071] The comparison results of the locus - priority sampling strategy and the random sampling strategy are as Figure 1 shown. Figure 1 It is the number of polymorphic loci retained by two sampling strategies and two genetic distances under different sampling conditions, where: D1. SM genetic distance; D2. Nei&Li genetic distance; S1. Locus - priority sampling method; S2. Random sampling method.

[0072] From Figure 1 it can be seen that the number of polymorphic loci lost in the core collections constructed by the locus - priority sampling strategy is slightly less than that of the random sampling strategy. After the first sampling, the two core collections constructed by the locus - priority sampling strategy and the random sampling strategy lost 2 - 3 and 5 - 6 polymorphic loci respectively; after the second sampling, the two core collections constructed by the locus - priority sampling strategy and the random sampling strategy lost 6 and 13 polymorphic loci respectively; after the third sampling, the two core collections constructed by the locus - priority sampling strategy and the random sampling strategy lost 10 - 13 and 21 polymorphic loci respectively; after the fourth sampling, the two core collections constructed by the random sampling strategy both lost 29 polymorphic loci, and the number of polymorphic loci lost in the two core collections constructed by the locus - priority sampling strategy differed greatly, which were 15 and 28 respectively. The present invention uses the locus - priority sampling strategy to select the two core collections after the third clustering as the primary candidate core collections. The core collections constructed have fewer alleles lost and can represent their genetic diversity to the greatest extent with the smallest number of resource copies.

[0073] Example 4. Evaluation and confirmation of mango core collections

[0074] 1. Test method:

[0075] 1.1 Representativeness of the core collection of mango:

[0076] The genetic diversity of two core collections was constructed using the locus - priority sampling strategy in Example 3. Then, t - tests were respectively conducted on the observed number of alleles, effective number of alleles, Nei's diversity index, and Shannon's information index of the core collection and the original germplasm. Comparative analysis of the genetic diversity of the original germplasm, core collection, and reserved germplasm was also carried out.

[0077] 1.2 Confirmation of the core collection of mango:

[0078] The core collection was determined according to the optimal sampling strategy for the core collection. The retention ratio of genetic parameters such as the average observed number of alleles (Na) among the core collection, reserved germplasm, and original germplasm was used as an evaluation index, and further representative confirmation of the core collection was carried out by combining the principal coordinate analysis method.

[0079] 2. Test results:

[0080] 2.1 Representativeness of the core collection of mango:

[0081] 2.1.1 The representative results of the core collection of mango constructed using the locus - priority sampling strategy based on SSR data are shown in Table 4:

[0082] Table 4 Representativeness of the core collection of mango constructed using the locus - priority sampling strategy based on SSR data

[0083]

[0084] As can be seen from Table 4, there are no significant differences in the 12 loci of CoreS1D1 and CoreS1D2 from the original germplasm in terms of Nei's gene diversity and Shannon's information index. Therefore, both of the two core germplasms can represent the genetic diversity of the original germplasm, retaining all the genetic diversity of the original germplasm. The sampling numbers of the preliminarily determined candidate core germplasms S1D1 and S1D2 are 88 and 85 respectively. The effective number of alleles and Shannon's information index of S1D1 are 4.2418 and 1.5761 respectively, slightly lower than those of S1D2, which are 4.2603 and 1.5854 respectively. The genetic diversity indices of S1D1 and S1D2 are 0.7486 and 0.7468 respectively. Thus, it can be seen that when 85 samples are selected using the locus-priority sampling strategy and Nei&Li genetic distance, the constructed core germplasm has the richest genetic diversity and can represent the genetic diversity of the original germplasm to the greatest extent with the smallest number of resource copies. It is preliminarily determined as the most suitable sampling method and sampling amount for constructing the core germplasm of mango germplasm.

[0085] 2.1.2. The list of core germplasms constructed by selecting 85 samples using the locus-priority sampling strategy and Nei&Li genetic distance is shown in Table 5:

[0086] Table 5 List of core germplasms

[0087] Serial number Germplasm name Serial number Germplasm name Serial number Germplasm name 1 Tianding 20-2 29 Naguang Zihua 57 Hongping Mango 2 Baidong 18-4 30 Nongnan Power Station Native Mango 58 Mengdi Hongmang 3 Longxu 20-1 31 Baise 20-4 59 Xingre 1 4 Baidong 18-15 32 Tianlin Enlin Liangyu 60 Huangyu 5 Baidong 19-32B 33 Layu 14-4 61 Jinlong Mango 6 Baidong 18-21 34 Deng'a 4 62 Coconut Aroma 7 Baise 20-21 35 Yunxian 1 63 Shuiyingda 8 Baidong 18-16 36 Yunxian 2 64 Autumn Mango 9 Pingmeng 20-2 37 Apple Mango 65 Wacheng Hongmang 10 Funing 20-7 38 White Ivory Mango 66 Jinshuixian 11 Baidong 19-32 39 Bailan Seedling 1 67 Thai Introduction 3 12 India 903 40 Baiyu 1 68 Palayindra 13 Baidong 18-31 41 Baiyu 2 69 Xindelong Mango 14 Tianding 20-4 42 Ganzhuang 13-1 70 India Mango 2 15 Wangmo 20-29 43 Guiremang 272 71 Longzhou Thai Mango 16 Bailin Avenue West 20-2 44 Guiremang 276 72 Dukou Luzon Mango 17 Wangmo 20-4 45 Guiremang 282 73 String Mango 18 Mengxing Guanzhai 19-4 46 Guiremang 71 74 Dasannianmang 1 19 Wangmo 20-5 47 Guiremang 78-1 75 Fragrant Flower Mango 20 Mandajiu New 18-2 48 Red Flower 76 Green Skin Mango 21 Baicheng 1 49 Golden Honey Aroma Mango 77 White Skin Mango 22 Ganzhuang 18-2 50 Grape Mango 78 Jade Mango 23 Wangmo 20-12 51 Sanhe 2 79 Tiandong 20-13 24 Baidong 19-33 52 Yunxia Mango 80 Baidong 19-26 25 Baidong 18-14Z 53 Hayden 81 Wangmo 20-25 26 Baidong 19-5 54 Gil 82 Bao'an 19-2 27 Yuanjiang 21-4 55 Bruce 83 Henggong 19-7 28 Baise 21-6 56 Tainong 1 84 Dongping 19-5 85 Hengning Square 19-2

[0088] 2.1.3. Conduct t-tests on the observed number of alleles, effective number of alleles, Nei's diversity index, and Shannon's information index of the core germplasm and the original germplasm respectively. The t-test results of the core germplasm and the original germplasm are shown in Table 6:

[0089] Table 6 t-test results of the core germplasm and the original germplasm

[0090] Core germplasm Original germplasm t value Na 7.0833±2.0207 7.5833±2.3916 0.553 Ne 4.2603±1.2234 4.0933±1.2086 0.324 I 1.5855±0.3022 1.5340±0.3073 0.413 H 0.7468±0.0734 0.7361±0.0767 0.349

[0091] As can be seen from Table 6, there are no significant differences in the observed number of alleles, effective number of alleles, Nei's diversity number, and Shannon's information index of the core germplasm from those of the original germplasm, but the values of the effective number of alleles, Nei's diversity number, and Shannon's information index of the core germplasm are all greater than those of the original germplasm.

[0092] 2.1.4. The results of the comparative analysis of the genetic diversity of the original germplasm, core germplasm, and reserved germplasm are shown in Table 7:

[0093] Table 7 Comparison of the genetic diversity of the original germplasm, core germplasm, and reserved germplasm

[0094]

[0095] As can be seen from Table 7, the core collection retained 19.72% of the samples of the original collection. The retention rates of the number of effective alleles, Nei's genetic diversity index, and Shannon's information index were 103.93%, 101.45%, and 103.35% respectively. It can be seen that the core collection can well represent the original collection. The retained collection retained 80.28% of the samples of the original collection, and the retention rates of the number of effective alleles, Nei's genetic diversity index, and Shannon's information index were 98.41%, 99.39%, and 98.52% respectively. There were no significant differences in the observed number of alleles, the number of effective alleles, Nei's diversity number, and Shannon's information index between the core collection and the original collection. However, the values of the three indexes of the core collection were all greater than those of the retained collection, indicating that the representativeness of the core collection for the original collection was better than that of the retained collection. Therefore, the core collection should be given priority when constructing the mango core collection.

[0096] 2.2. Confirmation of the mango core collection:

[0097] The confirmation results of the representativeness of the core collection constructed by the principal coordinate-based locus priority sampling strategy are as Figure 2 shown. As can be seen from Figure 2 , the core collection covered the entire principal coordinate graph, ensuring the representativeness of the core collection.

[0098] The above embodiments merely illustrate the principles and effects of the present invention, rather than limiting the present invention. Any person familiar with this technology can modify or change the above embodiments without departing from the spirit and scope of the present invention. Therefore, all equivalent modifications or changes completed by those with ordinary knowledge in the technical field without departing from the spirit and technical ideas disclosed by the present invention should still be covered by the claims of the present invention.

Claims

1. A primer for constructing mango core germplasm based on SSR fluorescent markers, characterized in that: It comprises 12 pairs of primers, and the sequences of the 12 pairs of SSR primers are shown as SEQ ID NO.1 to SEQ ID NO.

24.

2. A method for constructing mango core germplasm based on SSR fluorescent markers, characterized in that: The following steps are involved: Step S1, DNA extraction and amplification: extracting genomic DNA from mango samples of the original population, performing SSR-PCR amplification using the primers described in claim 1, and collecting original data; Step S2, genetic diversity data analysis: analyzing capillary electrophoresis data, calculating the polymorphism information content, number of alleles, number of effective alleles, Shannon-Weaver diversity index, and Nei's gene diversity index of germplasm resource molecular data; Step S3, construction of core germplasm: calculate genetic distance, perform cluster analysis using UPGMA clustering method, and perform t-test on core germplasm and initial germplasm.

3. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: The mango sample in step S1 is genomic DNA of young mango leaves.

4. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: In step S1, a fluorescent marker FAM is added to the 5′ end of each pair of primers.

5. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: The SSR-PCR amplification system in step S1 is: 2μL 10×Ex Taq Buffer, 1.6μL 25mmol / L MgCl2, 0.25μL 4×d NTP Mixture, 1μL 10μmol / L Forward primer, 1μL 10μmol / LReverse primer, 2μL 20ng / μL genomic DNA, 0.15μL 5U / μL Taq DNApolymerae, 12μL dd H2O.

6. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: The SSR-PCR amplification procedure in step S1 is: Pre-denaturation at 94℃ for 2.5min; denaturation at 94℃ for 30s, annealing at 48-54.4℃ for 45s, extension at 72℃ for 1min; number of cycles is 35, finally extension at 72℃ for 5min, and storage at 4℃.

7. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: The cluster analysis in step S3 adopts a multiple clustering method, and uses Nei & Li genetic distance and site-priority sampling strategy to construct core germplasm.

8. The method for constructing mango core germplasm based on SSR fluorescent markers according to claim 2, characterized in that: The sampling ratio of the method is 19-20%.

Images