Biomarker related to lutein content character of sweet corn and application of biomarker

Abstract

The invention relates to the technical field of molecular markers, in particular to a biomarker related to the lutein content character of sweet corn and application of the biomarker. Sweet corn selfing lines SHL01 and SHL03 are used as parents to construct an RIL population, the character data of the lutein content of the sweet corn kernels are detected through high performance liquid chromatography, QTL positioning is performed by using the character of the lutein content of the kernels, and an analysis result shows that a major QTL for regulating the lutein content of the kernels exists on a sixth chromosome of the corn, and the major QTL is used for regulating the lutein content of the kernels. The main effect QTL is located between the SNP loci Schr6: 82134355 and Schr6: 83130639, the phenotype contribution rate to the grain xanthophyll content is 27.14%, the molecular marker can be used for screening or auxiliary screening of sweet corn with relatively high xanthophyll content, the result is more accurate, a technical support is provided for molecular marker-assisted breeding, and the molecular marker has important significance for improving the taste quality of the sweet corn.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly to biomarkers related to the lutein content trait of sweet corn and their applications. Background Art

[0002] Sweet corn (Zea mays var. saccharata) has become an important economic crop and healthy food globally due to its unique flavor and rich nutritional value. As one of the main carotenoids in sweet corn kernels, lutein has physiological functions such as antioxidant, anti-inflammatory, and protecting visual health, and particularly plays a significant role in preventing eye diseases such as age-related macular degeneration (AMD). However, the lutein content in sweet corn is generally low, making it difficult to meet human dietary requirements. Therefore, improving the lutein content of sweet corn through genetic improvement means is of great significance for enhancing its nutritional quality and market competitiveness.

[0003] The lutein content in corn kernels is a quantitative trait controlled by multiple genes, with a complex genetic mechanism, being easily affected by environmental factors, and requiring precise instrument detection. The efficiency of improving the lutein content through phenotypic selection by traditional breeding methods is low, and the cycle is long and the cost is high. With the development of molecular marker technology, molecular marker-assisted selection (MAS) based on quantitative trait locus (QTL) mapping has become the key technology to break through this bottleneck. Single nucleotide polymorphism (SNP) markers have become the core tools for QTL fine mapping and molecular breeding due to their characteristics of high density, strong stability, and efficient detection. However, there are few SNP markers closely linked to the lutein content of sweet corn publicly reported at home and abroad, and most of them are located in minor QTL regions, making it difficult to be directly used for efficient breeding. Therefore, developing functional SNP markers closely linked to major QTLs can not only reveal the molecular regulatory mechanism of lutein synthesis but also provide precise technical support for the directional breeding of sweet corn varieties with high lutein content.

[0004] Previous studies have conducted QTL mapping on the traits of carotenoid content in sweet corn kernels and detected some quantitative trait loci controlling the carotenoid content in corn kernels. However, due to the influence of marker density, population type, accuracy of genetic linkage maps, and different phenotypic detection methods for kernel traits, the QTL results related to the carotenoid content trait in kernels obtained from the studies are not the same, and there is a lack of major QTLs related to the lutein content in sweet corn kernels. Summary of the Invention

[0005] To solve the above problems, the present invention provides biomarkers related to the lutein content trait of sweet corn and their applications. The biomarkers provided by the present invention are major QTLs related to the lutein content in sweet corn kernels, which can be used to screen or assist in screening sweet corn with relatively high lutein content, and the results are more accurate.

[0006] To achieve the above object, the present invention provides the following technical solutions:

[0007] The present invention provides biomarkers related to the lutein content trait of sweet corn, and the biomarkers include SNP01 and SNP02;

[0008] SNP01 is located at position 82134355 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G; SNP02 is located at position 83130639 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G;

[0009] When the genotypes of SNP01 and SNP02 are both GG, the lutein content of sweet corn is relatively high.

[0010] Preferably, the biomarker includes a first nucleic acid molecule containing the information of SNP01 and a second nucleic acid molecule containing the information of SNP02; the nucleotide sequence of the first nucleic acid molecule is as shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is as shown in SEQ ID NO.2.

[0011] The present invention provides the application of the biomarker described in the above technical solution or the product for detecting the biomarker described in the above technical solution in 1) and / or 2):

[0012] 1) Screening or assisting in screening sweet corn with relatively high lutein content;

[0013] 2) Cultivating or assisting in cultivating sweet corn varieties with high lutein content;

[0014] When the genotypes of SNP01 and SNP02 in the biomarker are both GG, the lutein content of sweet corn is relatively high.

[0015] Preferably, the lutein content is the lutein content in sweet corn kernels.

[0016] Preferably, the product includes a primer set and / or a kit.

[0017] The present invention provides a primer set for detecting the biomarker described in the above technical solution, and the primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is as shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is as shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is as shown in SEQ ID NO.6.

[0018] The present invention provides a method for screening or assisting in screening sweet corn with relatively high lutein content, comprising the following steps:

[0019] Determine the genotypes of SNP01 and SNP02 in the biomarker described in the above technical solution of the sweet corn to be tested;

[0020] According to the determined genotype results, screen the sweet corn with the genotypes of both SNP01 and SNP02 being GG as the sweet corn with relatively high lutein content.

[0021] Preferably, the determination includes: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification product.

[0022] Preferably, the primer set for PCR amplification includes the primer set described in the above technical solution.

[0023] Preferably, the lutein content is the lutein content in the sweet corn kernels.

[0024] Beneficial effects:

[0025] The present invention provides biomarkers related to the lutein content trait of sweet corn, and the biomarkers include SNP01 and SNP02; SNP01 is located at position 82134355 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G; SNP02 is located at position 83130639 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G; when the genotypes of both SNP01 and SNP02 are GG, the lutein content of sweet corn is relatively high. The present invention uses the sweet corn inbred lines SHL01 and SHL03 as parents to construct an RIL population (permanent population), detects the trait data of lutein content in sweet corn kernels by high-performance liquid chromatography, performs QTL mapping using the trait of lutein content in kernels, and through the analysis results, it is found that there is a major QTL regulating the lutein content in kernels on chromosome 6 of maize, and the major QTL is located between the SNP sites S_chr6:82134355 and S_chr6:83130639, and the phenotypic contribution rate to the lutein content in kernels is 27.14%. It can be used to screen or assist in screening sweet corn with relatively high lutein content, and the results are more accurate, providing technical support for molecular marker-assisted breeding and having important significance for improving the taste quality of sweet corn. Description of the Drawings

[0026] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required to be used in the embodiments.

[0027] Figure 1 It is the QTL mapping result diagram of the lutein trait of sweet corn kernels;

[0028] Figure 2 It is the position diagram of SNPs closely linked to the major QTL related to the lutein content in sweet corn kernels on the maize chromosome. Detailed implementation mode

[0029] The present invention provides biomarkers related to the lutein content trait of sweet corn, and the biomarkers include SNP01 and SNP02;

[0030] The SNP01 is located at position 82134355 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G; the SNP02 is located at position 83130639 bp on chromosome 6 of the maize B73RefGen_V3 genome, and the base is A or G;

[0031] When the genotypes of the SNP01 and SNP02 are both GG, the lutein content of sweet corn is relatively high.

[0032] The present invention uses high-performance liquid chromatography to detect the data of the lutein content trait of sweet corn kernels, performs QTL mapping using the lutein content trait of kernels, and through the analysis results, it is found that there is a major QTL regulating the lutein content on chromosome 6 of maize. The major QTL is located between the SNP sites S_chr6:82134355 and S_chr6:83130639, and the phenotypic contribution rate to the lutein content of kernels is 27.14%. It can be used to screen or assist in screening sweet corn with relatively high lutein content. Only by detecting the SNP bases of SNP01 and SNP02, the lutein content trait of sweet corn kernels can be predicted. The identification method is simple, the selection efficiency is high, the selection target is clear, and it is not affected by the environment. The SNP marker can also achieve high-throughput detection. It can be used for molecular marker-assisted breeding of the lutein content trait of sweet corn kernels at the seedling stage of sweet corn, and can also be used for molecular pyramiding breeding of traits.

[0033] As an implementation mode, the biomarker includes a first nucleic acid molecule containing the information of the SNP01 and a second nucleic acid molecule containing the information of the SNP02; the nucleotide sequence of the first nucleic acid molecule is as shown in SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is as shown in SEQ ID NO.2, specifically as follows:

[0034] SEQ ID NO.1:

[0035] 5'-ATACATGAAAATGGCGCAAATTGGCGGTGCTGGTAGAACCGAAAC GATTTATTACCTGTTTCTTACATGATTTGAGTTTTCCAAGCTTTTATGCTTCTCTRTTTCCTACTTGGCCATATCTGTCAGATGTTTTGACAGCCAGCCAGGTTATTGTTTCACCGCCGTTAGTAGGTTGCGTACACTCTTGTACTCAAACTCTTC-3';

[0036] SEQ ID NO.2:

[0037] 5'-AGGCCTACTCTAGAGCAAGGCAGATAATCACCACGCACATCGACA TCCTCCACAAGCTCGCCCAGCTCCTGATCGAGAAGGAGACCGTGGACGGGGAGGARTTCATGAGCTTGTTCATTGACGGCCAGGCCGAGCTGTTTGTCGCTTGAGATGTCACAAGGCTTGCGGTGCGTATGCTTTTCGGTGTTTTGTGTCAGAGCG-3';

[0038] Wherein, the base R is A / G.

[0039] In the first nucleic acid molecule of the present invention, the 101st base R is at the physical position located by SNP01, and in the second nucleic acid molecule, the 101st base R is at the physical position located by SNP02. Those skilled in the art can screen or assist in screening sweet corn with relatively high lutein content by detecting the genotypes of SNP01 and SNP02, or by detecting the genotype at the 101st position of the first nucleic acid molecule and the second nucleic acid molecule.

[0040] Based on the above advantages, the present invention provides the application of the biomarker described in the above technical solution or the product for detecting the biomarker described in the above technical solution in 1) and / or 2):

[0041] 1) Screening or assisting in screening sweet corn with relatively high lutein content;

[0042] 2) Cultivating or assisting in cultivating sweet corn varieties with high lutein content;

[0043] When the genotypes of SNP01 and SNP02 in the biomarker are both GG, the lutein content of sweet corn is relatively high.

[0044] The present invention can cultivate or assist in cultivating sweet corn varieties with high lutein content by discarding sweet corn with the genotype of AA for both SNP01 and SNP02 in the biomarker and retaining sweet corn with the genotype of GG for both SNP01 and SNP02 in the biomarker.

[0045] As an implementation manner, the lutein content is the lutein content in sweet corn kernels.

[0046] As an implementation manner, the product includes a primer set and / or a kit.

[0047] Based on the above advantages, the present invention provides a primer set for detecting the biomarker described in the above technical solution. The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is as shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is as shown in SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is as shown in SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is as shown in SEQ ID NO.6, specifically as follows:

[0048] SEQ ID NO.3: 5'-ATACATGAAAATGGCGCAAA-3';

[0049] SEQ ID NO.4: 5'-GAAGAGTTTGAGTACAAGAG-3';

[0050] SEQ ID NO.5: 5'-AGGCCTACTCTAGAGCAAGG-3';

[0051] SEQ ID NO.6: 5'-CGCTCTGACACAAAACACCG-3'.

[0052] The primer set provided by the present invention can specifically amplify the first nucleic acid molecule and the second nucleic acid molecule in the above technical solution. Then, by sequencing and analyzing the first nucleic acid molecule and the second nucleic acid molecule, sweet corn with the genotype of GG for both SNP01 and SNP02 in the biomarker is selected, so as to screen out sweet corn with relatively high lutein content. The identification method is simple, the selection efficiency is high, the selection target is clear, it is not affected by the environment, and the SNP marker can also achieve high-throughput detection.

[0053] Based on the above advantages, the present invention provides a method for screening or assisting in screening sweet corn with relatively high lutein content, including the following steps:

[0054] Determine the genotypes of SNP01 and SNP02 in the biomarker of the sweet corn to be tested described in the above technical solution;

[0055] According to the measured genotype results, sweet corn with the genotypes of both SNP01 and SNP02 being GG was screened as sweet corn with relatively high lutein content.

[0056] As an implementation manner, the measurement includes: performing PCR amplification on the to-be-detected sweet corn, and sequencing the obtained PCR amplification product.

[0057] As an implementation manner, the amplification system for the PCR amplification is: 2×PCRmix 25 μL, ddH 2 O2 22 μL, 1 μL each of the upstream and downstream primers, and 1 μL of DNA template.

[0058] As an implementation manner, the procedure for the PCR amplification is: denaturation at 95°C for 3 min; denaturation at 95°C for 30 s, annealing at 50°C for 30 s, extension at 72°C for 30 s, with a total of 35 cycles; finally, extension at 72°C for 5 min.

[0059] As an implementation manner, the primer group for the PCR amplification includes the primer group described in the above technical solution.

[0060] As an implementation manner, the lutein content is the lutein content in sweet corn kernels.

[0061] To further illustrate the present invention, the biomarkers related to the lutein content trait of sweet corn provided by the present invention and their applications will be described in detail below in conjunction with the accompanying drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0062] Example 1

[0063] 1. Construction of the genetic map of the sweet corn recombinant inbred line population.

[0064] Using sweet corn inbred lines SHL01 and SHL03 as parents to construct a recombinant inbred line (RIL) population, which was planted in the base of Zhuanghang Experimental Station of Shanghai Academy of Agricultural Sciences. After emergence, leaf tissues of the RIL population were collected to extract DNA. Using the genotyping by target sequencing (GBTS) technology, 236 individual plants of the F 7 generation were genotyped, and a total of 10,000 SNP locus data were obtained. Using the PLINK software for quality control filtering, SNPs with a missing rate less than 20%, a minor allele frequency greater than 0.05, and a heterozygosity rate less than 20% were screened out. The constructed genetic map had 4,253 high-quality SNP markers, which were divided into 10 linkage groups. The total genetic distance of the genetic map was 3,052.3 cM, and the average genetic distance between SNP markers was 0.7 cM.

[0065] 2. Measurement of lutein traits in sweet corn kernels

[0066] An RIL population constructed using sweet corn inbred lines SHL01 and SHL03 as parents was planted in the experimental base of Zhuanghang Experimental Station of Shanghai Academy of Agricultural Sciences using a randomized block experimental design. Each RIL family was planted in a 2-row plot with three replicates and normal field management. After harvesting the sweet corn kernels, the lutein content traits of the kernels were detected using a high-performance liquid chromatograph. For each replicate, three ears were taken, and 15 intact kernels without pest and disease infection were selected from each ear for lutein extraction and determination. Finally, the average value of the three replicates was taken as the phenotypic data.

[0067] Table 1 Comparison results of phenotypic variation and heritability of the RIL population

[0068] Character Average value (μg / g) Range Skewness Kurtosis Coefficient of variation (%) Lutein 1.95 0.31～8.92 0.69 -0.90 0.78

[0069] 3. Obtaining major QTLs for lutein content traits in sweet corn kernels

[0070] QTL analysis was performed on the average value of lutein content in the kernels of the RIL population using QTL IciMapping 4.2 software and the composite interval mapping (CIM) method. At a significance level of P<0.05, 1000 random tests were performed to determine the logarithm of the odds (LOD) of the likelihood function ratio. The 2-LOD interval method was used to determine the confidence interval (QTL interval) of the QTL, and the format for naming the QTL was: the prefix is "q" + the abbreviated English name of the trait + the chromosome number where the QTL is located + the serial number of the QTL on the same chromosome, and this number is connected to the chromosome number with "-". QTL analysis was performed on the lutein content in the kernels. As Figure 1 shown, a total of 3 QTLs were detected, distributed on chromosomes 6 and 9, with LOD values between 2.55 and 10.92, and the contribution rate of a single QTL to phenotypic variation was between 5.45% and 27.14%. A single QTL with a contribution rate to phenotypic variation ≥10% was considered a major QTL. Among them, qLUT6-2 on chromosome 6, with a contribution rate of 27.14%, was a major QTL; qLUT9 on chromosome 9, with a contribution rate of 15.57%, was a major QTL.

[0071] Table 2 QTL results for lutein content traits in kernels

[0072]

[0073] 4. Development and application of SNP markers tightly linked to lutein content traits in sweet corn kernels

[0074] qLUT6-2 is a major QTL regulating the lutein content in maize kernels located on chromosome 6, between SNP sites S_chr6:82134355 and S_chr6:83130639 ( Figure 2 ), SNP site S_chr6:82134355 mutated to A / G, SNP site S_chr6:83130639 mutated to A / G, and the physical location was corn B73RefGen_V3 genome chr6:82134355-83130639. These two SNP sites can be used to predict the lutein content in sweet corn kernels.

[0075] A primer set for screening sweet corn with a relatively high lutein content in grains is designed based on two SNP sites, the primer set consisting of a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown in SEQ ID NO.1, and the nucleotide sequence of the downstream primer of the first primer pair is shown in SEQ ID NO.2; the nucleotide sequence of the upstream primer of the second primer pair is shown in SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the second primer pair is shown in SEQ ID NO.4; the screening method is as follows:

[0076] DNA was extracted from corn plant leaves using conventional methods, and PCR amplification was performed using the first primer pair and the second primer pair, respectively. The amplification system for PCR amplification was: 2×PCRmix 25 μL, ddH 2 O 22μL, 1μl of upstream and downstream primers, 1μl of DNA template. PCR reaction conditions are: 95℃ denaturation for 3min; 95℃ denaturation for 30s, 50℃ annealing for 30s, 72℃ extension for 30s, 35 cycles in total; finally 72℃ extension for 5min; obtain PCR product amplification products for sequencing. When the sequencing bases S_chr6:82134355 and S_chr6:83130639 are both G, the plant candidate is a material with a high lutein content in the grain and is retained. If the conditions of these two sites cannot be met, the plant will be discarded.

[0077] PCR amplification and sequencing were performed on 114 maize materials from the sweet corn population of the Maize Center of Shanghai Academy of Agricultural Sciences, and the lutein content in the grains was determined. The results are shown in Table 3.

[0078] When the bases of SNP loci S_chr6:82134355 and S_chr6:83130639 are both G, the lutein content of the tested sweet corn kernels is relatively high (average value is 4.28 μg / g). When the bases of SNP loci S_chr6:82134355 and S_chr6:83130639 are both A, the lutein content of the tested sweet corn kernels is relatively low (average value is 1.21 μg / g). The average values of the two phenotypes show a highly significant difference (P = 1.90×10 -11 ).

[0079] Table 3 Corresponding results of SNP genotypes of tested sweet corn materials and phenotypes of lutein content in kernels

[0080]

[0081]

[0082] Note: The blank tables in Table 4 have no data.

[0083] Using the major QTL closely linked SNP markers related to the lutein content of sweet corn above can assist in selecting maize with high lutein content. Among them, SNP loci S_chr6:82134355 and S_chr6:83130639 can be used to select the lutein content trait of sweet corn kernels. By performing molecular marker-assisted selection with the SNP markers disclosed in the present invention, only the SNP bases at specific loci of the PCR amplification products need to be detected to predict the lutein content trait of sweet corn kernels.

[0084] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all of them. People can also obtain other embodiments based on this embodiment without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A biomarker associated with the lutein content of sweet corn, characterized in that: The biomarkers include SNP01 and SNP02; The SNP01 is located at 82134355bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is A or G; the SNP02 is located at 83130639bp of chromosome 6 of the maize B73 RefGen_V3 genome, and the base is A or G; When the genotypes of SNP01 and SNP02 are both GG, the lutein content of sweet corn is relatively high.

2. The biomarker according to claim 1, characterized in that The biomarker includes a first nucleic acid molecule containing the SNP01 information and a second nucleic acid molecule containing the SNP02 information; the nucleotide sequence of the first nucleic acid molecule is shown as SEQ ID NO.1; the nucleotide sequence of the second nucleic acid molecule is shown as SEQ ID NO.

2.

3. Use of the biomarker according to claim 1 or 2 or a product for detecting the biomarker according to claim 1 or 2 in 1) and / or 2): 1) Screening or assisting in screening sweet corn with relatively high lutein content; 2) Cultivate or assist in cultivating sweet corn varieties with high lutein content; When the genotypes of SNP01 and SNP02 in the biomarkers are both GG, the lutein content of the sweet corn is relatively high.

4. The use according to claim 3, characterized in that: The lutein content is the lutein content in sweet corn kernels.

5. The use according to claim 3, characterized in that: The products include primer sets and / or kits.

6. A primer set for detecting the biomarker according to claim 1 or 2, characterized in that: The primer set includes a first primer pair and a second primer pair; the nucleotide sequence of the upstream primer of the first primer pair is shown as SEQ ID NO.3, and the nucleotide sequence of the downstream primer of the first primer pair is shown as SEQ ID NO.4; the nucleotide sequence of the upstream primer of the second primer pair is shown as SEQ ID NO.5, and the nucleotide sequence of the downstream primer of the second primer pair is shown as SEQ ID NO.

6.

7. A method for screening or assisting in screening sweet corn with relatively high lutein content, characterized in that: The following steps are involved: Determining the genotypes of SNP01 and SNP02 in the biomarker of claim 1 or 2 of the sweet corn to be tested; According to the genotype results, the sweet corns with the genotypes of SNP01 and SNP02 both being GG are the sweet corns with relatively high lutein content.

8. The method according to claim 7, characterized in that The determination comprises: performing PCR amplification on the sweet corn to be tested, and sequencing the obtained PCR amplification products.

9. The method according to claim 8, characterized in that The primer set for PCR amplification includes the primer set according to claim 6.

10. The method according to claim 7, characterized in that The lutein content is the lutein content in sweet corn kernels.

Images