KASP primer combination for construction of garlic DNA fingerprint database and application of KASP primer combination

Abstract

The invention discloses a KASP primer combination for construction of a garlic DNA fingerprint spectrum database and application of the KASP primer combination. Based on a simplified genome sequencing technology, 77 garlic varieties are subjected to genetic typing by adopting a KASP (competitive allele-specific PCR (Polymerase Chain Reaction), and SNP fingerprint spectrums of all the garlic varieties are constructed; finally, it is determined that 77 garlic varieties can be efficiently and accurately distinguished and identified through 15 specific SNP markers. The 15 SNP markers not only enrich molecular markers of garlic varieties, but also can be applied to genetic typing, identification, auxiliary identification and similarity detection of the garlic varieties. The 15 SNP markers provided by the invention not only enrich molecular markers of garlic varieties, but also can be applied to genetic typing, identification, auxiliary identification and similarity detection of the garlic varieties.

Description

Technical Field

[0001] The present invention relates to the technical field of molecular markers, and particularly relates to a KASP primer combination for constructing a garlic DNA fingerprint library and its application. Background Art

[0002] Garlic (Allium sativum L.) is an important economic crop, widely used in the fields of food, medicine, and industry. Since it mainly relies on asexual reproduction, there are rich variety resources during the long-term cultivation process. However, this has also led to problems such as chaotic variety naming, different plants with the same name, and the same plant with different names, seriously affecting the sustainable development of the garlic seed industry. In addition, the origin of some garlic seeds on the market is unknown, affecting the standardization of breeding work and the market supervision of varieties. Traditional garlic variety identification methods mainly rely on morphological characteristics, such as bulb color, size, plant height, etc. However, these traits are easily affected by the environment and cannot provide stable and accurate variety identification criteria. In addition, although biochemical analysis methods can provide a certain degree of resolution, their operation is complex and the cost is high, making it difficult to promote on a large scale. Therefore, there is an urgent need for an efficient, accurate, and stable molecular marker technology to solve the garlic variety identification problem.

[0003] In recent years, molecular marker technology has been widely used in the fields of crop variety identification and genotyping. Among them, single nucleotide polymorphism (SNP) has become the mainstream marker type for plant variety identification due to its high throughput, strong stability, easy automated detection, etc. KASP (Kompetitive Allele Specific PCR) technology is a genotyping method based on SNP loci, with advantages such as low cost, high sensitivity, and simple operation, and has achieved remarkable results in variety identification research of multiple crops. However, the development of SNP molecular markers for garlic varieties is still limited at present, and an efficient and standardized SNP fingerprint has not been established, restricting the application of molecular markers in garlic variety identification.

[0004] Based on the reduced-representation genome sequencing technology, the present invention develops efficient and stable garlic KASP-SNP molecular markers, screens out core SNP loci, and constructs a fingerprint, providing a precise tool for garlic variety identification, breeding improvement, and market supervision. Summary of the Invention

[0005] The purpose of the present invention is to provide a KASP primer combination for constructing a garlic DNA fingerprint library and its application, which can efficiently and accurately distinguish 77 garlic varieties by using only 15 core SNP markers.

[0006] The first purpose of the present invention is to provide core SNP markers for garlic variety identification.

[0007] The second object of the present invention is to provide the application of the above core SNP markers in constructing SNP fingerprint maps.

[0008] The third object of the present invention is to provide substances for detecting the above core SNP markers.

[0009] The fourth object of the present invention is to provide the application of the above substances in genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties.

[0010] The fifth object of the present invention is to provide a set of PCR reagents for genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties.

[0011] The sixth object of the present invention is to provide the application of the above set of PCR reagents in genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties.

[0012] The seventh object of the present invention is to provide a kit containing the above set of PCR reagents.

[0013] The eighth object of the present invention is to provide the application of the above kit in genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties.

[0014] The above objects of the present invention are achieved by the following technical solutions:

[0015] The present invention first provides a KASP primer combination for constructing a garlic DNA fingerprint library, which contains 15 SNP markers, and the 15 SNP markers are SNP markers 1 to 15;

[0016] Among them: the SNP marker 1 is the base at the 1189998355th position on chromosome 1 of the garlic genome, which is N or G;

[0017] The SNP marker 2 is the base at the 372057825th position on chromosome 2 of the garlic genome, which is A or G;

[0018] The SNP marker 3 is the base at the 439366133rd position on chromosome 1 of the garlic genome, which is T or C;

[0019] The SNP marker 4 is the base at the 885164743rd position on chromosome 1 of the garlic genome, which is C or A;

[0020] The SNP marker 5 is the base at the 983174590th position on the garlic genome contig, which is A or G;

[0021] The SNP marker 6 is the base at the 1134535486th position on chromosome 2 of the garlic genome, which is A or G;

[0022] The SNP marker 7 is the base at position 1205498582 on chromosome 2 of the garlic genome, which is C or A;

[0023] The SNP marker 8 is the base at position 252730951 on chromosome 3 of the garlic genome, which is T or C;

[0024] The SNP marker 9 is the base at position 73234679 on chromosome 5 of the garlic genome, which is A or G;

[0025] The SNP marker 10 is the base at position 969401364 on chromosome 5 of the garlic genome, which is A or G;

[0026] The SNP marker 11 is the base at position 1328456370 on chromosome 5 of the garlic genome, which is A or C;

[0027] The SNP marker 12 is the base at position 1165001766 on chromosome 6 of the garlic genome, which is A or G;

[0028] The SNP marker 13 is the base at position 480253207 on chromosome 8 of the garlic genome, which is C or T;

[0029] The SNP marker 14 is the base at position 1154271274 on chromosome 8 of the garlic genome, which is C or T;

[0030] The SNP marker 15 is the base at position 831291085 on chromosome 5 of the garlic genome, which is C or T;

[0031] The garlic varieties are: garlic varieties numbered G1, G2, G3, G4, G5, G7, G10, G11, G14, G15, G16, G18, G22, G23, G24, G25, G27, G29, G30, G32, G35, G37, G39, G40, G41, G42, G44, G45, G46, G47, G48, G55, G56, G58, G60, G65, G66, G67, G68, G69, G72, G73, G79, G83, G84, G86, G87, G91, G93, G94, G99, G101, G103, G104, G106, G107, G108, G109, G110, G111, G112, G113, G117, G120, G122, G123, G124, G126, G127, G128, G130, G131, G133, G134, G135, G136, G138.

[0032] Based on the reduced-representation genome sequencing technology, the present invention genotyped 77 garlic varieties using the KASP (Kompetitive Allele-Specific PCR) system, constructed SNP fingerprint maps of each garlic variety, and finally determined that 77 garlic varieties can be efficiently and accurately distinguished and identified through 15 specific SNP markers. These 15 SNP markers not only enrich the molecular markers of garlic varieties, but also can be applied to genotyping, identification, assisted identification and similarity detection of garlic varieties. Therefore, the applications of the above-mentioned core SNP markers in constructing SNP fingerprint maps, the substances for detecting the above-mentioned core SNP markers, and the applications of the above substances in genotyping, identifying, assisted identifying and / or similarity detecting garlic varieties should all be within the protection scope of the present invention.

[0033] The substance contains one or more of primers 1 to 30, and the nucleotide sequences of primers 1 to 30 are as shown in SEQ ID NO:1 to SEQ ID NO:30.

[0034] The substance contains one or more of primer combinations 1 to 15. Primer combination 1 contains a primer combination with nucleotide sequences shown in SEQ ID NO:1 to SEQ ID NO:2; primer combination 2 contains a primer combination with nucleotide sequences shown in SEQ ID NO:3 to SEQ ID NO:4; primer combination 3 contains a primer combination with nucleotide sequences shown in SEQ ID NO:5 to SEQ ID NO:6; primer combination 4 contains a primer combination with nucleotide sequences shown in SEQ ID NO:7 to SEQ ID NO:8; primer combination 5 contains a primer combination with nucleotide sequences shown in SEQ ID NO:9 to SEQ ID NO:10; primer combination 6 contains a primer combination with nucleotide sequences shown in SEQ ID NO:11 to SEQ ID NO:12; primer combination 7 contains a primer combination with nucleotide sequences shown in SEQ ID NO:13 to SEQ ID NO:14; primer combination 8 contains a primer combination with nucleotide sequences shown in SEQ ID NO:15 to SEQ ID NO:16; primer combination 9 contains a primer combination with nucleotide sequences shown in SEQ ID NO:17 to SEQ ID NO:18; primer combination 10 contains a primer combination with nucleotide sequences shown in SEQ ID NO:19 to SEQ ID NO:20; primer combination 11 contains a primer combination with nucleotide sequences shown in SEQ ID NO:21 to SEQ ID NO:22; primer combination 12 contains a primer combination with nucleotide sequences shown in SEQ ID NO:23 to SEQ ID NO:24; primer combination 13 contains a primer combination with nucleotide sequences shown in SEQ ID NO:25 to SEQ ID NO:26; primer combination 14 contains a primer combination with nucleotide sequences shown in SEQ ID NO:27 to SEQ ID NO:28; primer combination 15 contains a primer combination with nucleotide sequences shown in SEQ ID NO:29 to SEQ ID NO:30.

[0035] Based on this, the present invention also provides a set of PCR reagents for genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties, the application of the above set of PCR reagents in genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties, a kit containing the above set of PCR reagents, and the application of the above kit in genotyping, identifying, assisting in identifying and / or detecting similarity of garlic varieties. Among them, the set of PCR reagents contains one or more of primers 1 to 30, and the nucleotide sequences of primers 1 to 30 are shown in SEQ ID NO:1 to SEQ ID NO:27.

[0036] The present invention has the following beneficial effects:

[0037] Based on the reduced-representation genome sequencing technology, the present invention uses the KASP system to genotype 77 garlic varieties, constructs the SNP fingerprint maps of each garlic variety, and finally determines that 77 garlic varieties can be efficiently and accurately distinguished and identified through 15 specific SNP markers. The 15 SNP markers of the present invention not only enrich the molecular markers of garlic varieties, but also can be applied to the genotyping, identification, assisted identification and similarity detection of garlic varieties. Brief Description of the Drawings

[0038] Figure 1 It is the analysis result of the identification efficiency of SNP markers;

[0039] Figure 2 It is the SNP fingerprint map of each test material. Detailed Embodiments

[0040] To more fully illustrate the present invention, the following detailed description is given in conjunction with specific embodiments. However, these embodiments are only examples and do not constitute any limitation to the present invention. Unless otherwise specifically stated, the technical methods adopted in the embodiments are all conventional means well-known to those skilled in the art, and operations can be referred to the original third edition of "Bioinformatics and Functional Genomics" or related books. The bioinformatics software and related products used are all commercially available. For various experimental processes and methods not elaborated in detail, they all belong to the conventional technologies known in the art. The source, trade name and necessary composition information of the materials used will be marked when they first appear, and when the same reagents are used later, if there is no special explanation, they will be the same as the content marked for the first time. In addition, it should be noted that the locus combinations and applications provided by the present invention are all completed by the inventors through arduous creative labor and optimization work.

[0041] In the following embodiments, unless otherwise specifically stated, all raw materials can be obtained through commercial channels or prepared by conventional methods.

[0042] 77 garlic germplasms selected for the experiment are mainly commercial varieties and local varieties sold on the market, and are all preserved by the Horticulture Research Office of Xuzhou Institute of Agricultural Sciences in Xuhuai Region, Jiangsu Province (see Table 1); the garlic bulbs of 77 test materials are sown in a mixed substrate composed of vermiculite and organic matter, and the young leaves of the garlic plants when they grow to 4 leaves are used as materials and stored at -80 °C for standby.

[0043] Table 1 is the garlic germplasm materials and sources used in the experiment

[0044]

[0045]

[0046]

[0047] Example 1, DNA and Genome Library Construction

[0048] (1) After grinding the leaf samples, genomic DNA was extracted using a plant genomic DNA kit (TIANGEN, China), and the quality and concentration of the DNA were measured using a NanoDrop2000 ultraviolet spectrophotometer (Thermo Fisher, Waltham, MA, USA). Then, a paired-end library with a length range of 300–500 bp was constructed by performing double digestion (ddRAD) library construction on the qualified sample DNA.

[0049] (2) 500 ng of genomic DNA was reacted with 0.6 U of EcoRI (NEB), T4 DNA ligase (NEB), ATP (NEB), and an EcoRI adapter (including the index sequence for differentiating samples) at 37 °C for 3 hours and annealed at 65 °C for 1 hour.

[0050] (3) Then, the restriction endonuclease NlaIII (NEB) and an NlaIII adapter were added and reacted at 37 °C for 3 hours.

[0051] (4) After the reaction, the endonuclease was inactivated at 65 °C for 30 minutes in a polymerase chain reaction (PCR) amplifier. The digestion products of 400–600 bp were recovered by agarose gel electrophoresis and quantified using Qubit3.0 (Life Technology). After mixing 77 samples equally, a DNA library of the mixed product was constructed using the Illumina TruSeq kit.

[0052] Example 2, Identification of SNPs

[0053] (1) After library construction, the samples were sequenced using Illumina NovaSeq 6000PE150, and the raw sequencing reads were obtained. Then, the sequencing reads were aligned with the reference genome using the Burrows-Wheeler Aligner to obtain high-quality clean reads.

[0054] (2) According to the positioning results of the clean reads in the reference genome, single nucleotide polymorphisms (SNPs) were detected using GATK (version: 4.1.4.1) to obtain the original SNP sites.

[0055] Example 3, Screening of SNPs

[0056] (1) The original SNP loci were screened and 26,701,817 high-quality SNPs were obtained. The screening conditions were (1) the number of untested materials at the locus was less than 20; (2) the polymorphism was between 40% and 60%; (3) the locus was evenly distributed in the chromosome; and (4) there was no other variation within 50 bp before and after the locus.

[0057] (2) 26,701,817 high-quality SNPs were further screened and converted into KASP markers, and 4,297 markers were successfully designed. The screening conditions were as follows: ① the sequence was conserved for more than 50 bp before and after the DNA chain on the chromosome; ② the average depth was 5X or above, the quality value was greater than 30, the minimum integrity was greater than 0.9, the minimum allele frequency was greater than 0.05, and the SNP was a double allele; ③ 100 bp of sequence was cut off upstream and downstream of the SNP marker, and then the sequence was aligned to the reference genome using blast software (version: 2.10.1+), and markers at multiple positions in the alignment were removed; ④ markers with a polymorphic information content (PIC) greater than 0.35 were retained.

[0058] The calculation formula of PIC is: Where Pi and Pj are the occurrence frequencies of the two alleles of SNP in all tested varieties, and l is the sample size 77.

[0059] Example 4. KASP primer design and SNP marker selection

[0060] Primer design software Primer 3 designs primers for the filtered SNP markers, converts them into KASP markers, and 4297 markers are successfully designed. Other variable sites need to be avoided when designing KASP primers. These SNP markers are typed and verified, and after using the KASP system to perform genotyping on 48 test materials, the identification efficiency of these SNP markers is analyzed using a Perl language program. Among them, the reaction system of KASP is as follows:

[0061] Each well contains 2.5ul DNA template, 5ul 2×KASP Master Mix, and 2.5ul primer mix. The KASP reaction procedure is as follows: the first step is pre-denaturation, 95°C, 10min; the second step is denaturation, 95°C, 20s, annealing extension 61-55°C 60s, a total of 10 cycles; the second round is 95°C 20s, 55°C 60s, 35 cycles; if the first typing result is not ideal, add 95°C 20s, 57°C 60s, 3 cycles; after the PCR reaction is completed, the fluorescence data is read and analyzed.

[0062] The results of SNP marker identification efficiency analysis are shown in Figure 1As shown, it can be seen that all samples can be completely distinguished by using only 15 SNP markers, and the identification efficiency is 100%, indicating that these 15 SNP markers can be used for genotyping, identification, assisted identification, and similarity detection of garlic varieties, etc.

[0063] The position information of these 15 SNP markers on the garlic genome, the different bases, and the nucleotide sequence numbers of their corresponding primers are shown in Table 2.

[0064] Table 2 is the different bases and the nucleotide sequence numbers of their corresponding primers

[0065]

[0066] Among them, the nucleotide sequences of each primer are as follows:

[0067] SEQ ID NO:1: ccacagcagcatttattctggcat[T|C]

[0068] SEQ ID NO:2: attggagttggactttctcccaat

[0069] SEQ ID NO:3: cttgtacattaccgttctgtttccat

[0070] SEQ ID NO:4: gatgcggagactgagaaggaatgatt[C|T]

[0071] SEQ ID NO:5: caagccctagtccttgtgaccaa[C|T] SEQ ID NO:6: gtcggaagtggagtaacttggat

[0072] SEQ ID NO:7: cacgccctatgagcatactaagaaatttg[C|T] SEQ ID NO:8: ccttttctttccttatttcaactgagacc

[0073] SEQ ID NO:9: gcctgcgaaaatcaaagaaagc

[0074] SEQ ID NO:10: gacgaagaacgcaaggcagttg[T|C] SEQ ID NO:11: atattctaaacaagctgtgagggcat

[0075] SEQ ID NO:12: ctgtctcagtataacacacctcccac[T|C]

[0076] SEQ ID NO:13: ctccctttcctacttatgttgtccata

[0077] SEQ ID NO:14 gaactaccctacccatgattcagagtt[A|G] SEQ ID NO:15: tctgctatctagtatttgagttaccact[A|G] SEQ ID NO:16: cagccttggataacaccataagaattta

[0078] SEQ ID NO:17: acgatctttatgggagttaccagag

[0079] SEQ ID NO:18: acaagctcttcccttattgcaaggt[T|G] SEQ ID NO:19: tgaatccatcgttaaccgtatgact

[0080] SEQ ID NO:20: ctcgagaaggtgcttgagcttatga[A|T] SEQ ID NO:21: catctctaagacttagtggttttctagc

[0081] SEQ ID NO:22: gaaacaaaccaatgttcgatagtccgatt[C|T] SEQ ID NO:23: caatgcctcgaagggagcca[A|C] SEQ ID NO:24: caggaggcattgaggacaca

[0082] SEQ ID NO:25: tgatcttttgatggttttgggtgg

[0083] SEQ ID NO:26: agaaaataagggggaaggcctcac[T|C] SEQ ID NO:27: ctatcagattaaggtcttgaagatcggat[A|C] SEQ ID NO:28: ctgttctcccatagaaaattagtcagttc

[0084] SEQ ID NO:29: ggataaaggtagttaggtagatgaacttc[T|C] SEQ ID NO:30: gttcccagttgtagatttatgagtcattc。

[0085] Example 5. Garlic variety identification method, including the following steps:

[0086] A1 Obtain the DNA of the garlic to be tested;

[0087] A2 Determine the genes of 15 SNP loci in the obtained DNA and compare them with the genes of all garlic varieties in the fingerprint database;

[0088] A3 If the fingerprint of the garlic to be tested is inconsistent with the fingerprint of any garlic in the garlic fingerprint, the garlic to be tested is a new variety, and add this new variety into the fingerprint database. If the fingerprint of the garlic to be tested is exactly the same as that of a certain garlic, other information comparison is needed to determine whether they are of the same variety. Other information comparison includes plant type, whether it bolts, etc.

[0089] Example 6. Construction of SNP fingerprint

[0090] Use the aforementioned 15 SNP markers to construct the SNP fingerprints of each test material, and the results are as Figure 2 shown.

[0091] The above examples are the preferred embodiments of the present invention, but do not limit the scope of application of the present invention. Without departing from the basic spirit and principle of the present invention, any modification, change, substitution, combination or simplification method shall be regarded as equivalent substitution and shall be covered by the protection scope of the present invention.

Claims

1. A KASP primer combination for constructing a garlic DNA fingerprint library, characterized in that: Comprising 15 SNP markers, wherein the 15 SNP markers are SNP markers 1 to 15; wherein: The SNP marker 1 is the 1189998355th base on chromosome 1 of the garlic genome, which is N or G; The SNP marker 2 is the 372057825th base on chromosome 2 of the garlic genome, which is A or G; The SNP marker 3 is the 439366133rd base on chromosome 1 of the garlic genome, which is T or C; The SNP marker 4 is the 885164743rd base on chromosome 1 of the garlic genome, which is C or A; The SNP marker 5 is the 983174590th base on the garlic genome contig 1, which is A or G; The SNP marker 6 is the 1134535486th base on chromosome 2 of the garlic genome, which is A or G; The SNP marker 7 is the 1205498582nd base on chromosome 2 of the garlic genome, which is C or A; The SNP marker 8 is the 252730951st base on chromosome 3 of the garlic genome, which is T or C; The SNP marker 9 is the 73234679th base on chromosome 5 of the garlic genome, which is A or G; The SNP marker 10 is the 969401364th base on chromosome 5 of the garlic genome, which is A or G; The SNP marker 11 is the 1328456370th base on chromosome 5 of the garlic genome, which is A or C; The SNP marker 12 is the 1165001766th base on chromosome 6 of the garlic genome, which is A or G; The SNP marker 13 is the base 480253207 on chromosome 8 of the garlic genome, which is C or T; The SNP marker 14 is the 1154271274th base on chromosome 8 of the garlic genome, which is C or T; The SNP marker 15 is the 831291085th base on chromosome 5 of the garlic genome, which is C or T; The garlic varieties are: numbered G1, G2, G3, G4, G5, G7, G10, G11, G14, G15, G16, G18, G22, G23, G24, G25, G27, G29, G30, G32, G35, G37, G39, G40, G41, G42, G44, G45, G46, G47, G48, G55, G56, G58, G60, G65, G66, G67, G68, G69, G72, G73 , G79, G83, G84, G86, G87, G91, G93, G94, G99, G101, G103, G104, G106, G107, G108, G109, G110, G111, G112, G113, G117, G120, G122, G123, G124, G126, G127, G128, G130, G131, G133, G134, G135, G136, and G138 garlic varieties.

2. Application of the KASP primer combination for garlic DNA fingerprint library construction according to claim 1 in constructing SNP fingerprint.

3. A KASP primer combination for constructing a garlic DNA fingerprint library according to claim 2, characterized in that: It comprises one or more of primers 1 to 30, and the nucleotide sequences of the primers 1 to 30 are shown as SEQ ID NO: 1 to SEQ ID NO:

30.

4. A KASP primer combination for constructing a garlic DNA fingerprint library according to claim 3, characterized in that: Containing one or more of primer combinations 1 to 15; The primer combination 1 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 1 to SEQ ID NO: 2; The primer combination 2 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:3 to SEQ ID NO:4; The primer combination 3 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:5 to SEQ ID NO:6; The primer combination 4 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:7 to SEQ ID NO:8; The primer combination 5 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:9 to SEQ ID NO:10; The primer combination 6 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 11 to SEQ ID NO: 12; The primer combination 7 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 13 to SEQ ID NO: 14; The primer combination 8 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 15 to SEQ ID NO: 16; The primer combination 9 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 17 to SEQ ID NO: 18; The primer combination 10 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 19 to SEQ ID NO: 20; The primer combination 11 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:21 to SEQ ID NO:22; The primer combination 12 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:23 to SEQ ID NO:24; The primer combination 13 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO:25 to SEQ ID NO:26; The primer combination 14 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 27 to SEQ ID NO: 28; The primer combination 15 comprises a primer combination having nucleotide sequences as shown in SEQ ID NO: 29 to SEQ ID NO:

30.

5. Use of the KASP primer combination for constructing a garlic DNA fingerprint library according to any one of claims 3 to 5 in genotyping, identification, auxiliary identification and / or similarity detection of garlic varieties.

6. A set of PCR reagents for genotyping, identification, auxiliary identification and / or similarity detection of garlic varieties, characterized in that: The complete set of PCR reagents comprises one or more of primers 1 to 30, and the nucleotide sequences of the primers 1 to 27 are shown as SEQ ID NO: 1 to SEQ ID NO:

30.

7. Use of the complete set of PCR reagents according to claim 6 in genotyping, identification, auxiliary identification and / or similarity detection of garlic varieties.

8. A kit comprising the complete set of PCR reagents according to claim 7.

Images