Blue wheat SNP marker caps-6168 and use thereof

Abstract

The application relates to a blue wheat SNP marker CAPS-6168, and belongs to the technical field of wheat breeding. The CAPS-6168 is located in a TaMYC4-4D gene in haploid wheat. The application identifies a TaMYC4-4D blue specific haplotype by detecting nucleotide polymorphism of the TaMYC4-4D gene in different grain color wheat varieties, and develops the blue wheat SNP marker CAPS-6168. The marker can be used for screening and identification of blue wheat when the grain color does not appear, which will help early identification and generation expansion in the process of breeding blue wheat.

Description

TECHNICAL FIELD

[0001] The application belongs to the technical field of wheat breeding, and relates to a blue wheat SNP marker CAPS-6168 and use thereof. BACKGROUND

[0002] Color wheat is considered a new type of functional wheat variety, which is characterized in that the seed coat and aleurone layer contain rich natural anthocyanin compounds, which give the grains different color performances (Ye Lin, 2018). Anthocyanins are a class of secondary metabolites belonging to flavonoids (Karakaya et al., 2016), which have the characteristics of antioxidant, anti-inflammatory, antibacterial, etc., can maintain normal vascular permeability pressure to prevent vascular rupture, can eliminate free radicals in the body, improve immunity, inhibit the growth of cancer cells, etc. (Yang Xiujuan et al., 2005; Zong Xuefeng et al., 2006; Li et al., 2005; Kris et al., 2002), and also have the functions of preventing diabetes, preventing obesity, protecting vision, etc. (Mellen et al., 2008; Lutsey et al., 2007; Sharma et al., 2020). As an ideal raw material for functional health food, color wheat has a wide application market and development prospect. At the same time, as a valuable characteristic germplasm resource, it can provide material support for wheat high-quality breeding (Ma Lanxiang et al., 2021). Therefore, studying the anthocyanin biosynthesis mechanism of color wheat and cultivating excellent new varieties of color grain wheat have important significance for developing new health food, improving people's dietary structure and promoting people's health.

[0003] According to the color, colored wheat is divided into two categories: blue wheat and purple wheat. They are different from common wheat in that the aleurone layer and pericarp contain different types of anthocyanins (Liu et al., 2021). Blue wheat is due to the presence of blue anthocyanin compounds in the wheat aleurone layer, which makes the grain appear blue (Gao et al., 2000). The biosynthesis of anthocyanins is mainly regulated by three types of transcription factors: MYB, bHLH, and WD40, which alone or form an MBW complex, bind to the corresponding cis-acting elements in the promoter of the structural gene to regulate the expression of genes related to anthocyanin synthesis (Li et al., 2022). The synthesis of anthocyanins in the blue aleurone layer involves at least two key genes, Ba 1 and Ba 2, and the gene ThMYC4E has been identified as a candidate gene for Ba 1 (Zhao et al., 2019). In the study of the blue and white aleurone layer of triticale, the transcription factor BcMYC1 was identified as a candidate gene for regulating the synthesis and metabolism of anthocyanins in the blue aleurone layer (Li et al., 2020). In the study of blue barley, a "three-gene cluster" composed of two transcription factors HvMYB4H and HvMYC4H and a structural gene HvF3'5'H associated with the blue grain trait was found to be highly expressed in blue barley and specifically expressed in the aleurone layer (Jia et al., 2020).

[0004] The expression of the wheat TaMYC4-4D gene was significantly reduced in the grains of blue wheat plants with virus-induced TaMYC4-4D gene silencing, and the blue color of the mature grains disappeared, with a significant reduction in anthocyanin content, indicating that the transcription factor is involved in regulating the biosynthesis of anthocyanins in blue wheat grains. The rich genetic variation among wheat varieties allows breeders to create better genetic combinations and cultivate excellent varieties suitable for different cultivation environments (Xu et al., 2014; Rasheed & Xia 2019). Molecular marker-assisted selection is an effective means of crop genetic improvement, and more than 100 functional markers related to important agronomic traits have been used in wheat variety breeding and germplasm improvement (Meng et al., 2018; Zhao et al., 2019; Vishwakarma et al., 2016; Ma et al., 2018). Since the grain color of blue wheat appears gradually after 20 days after flowering, and in the process of breeding new wheat varieties, in order to speed up the breeding progress, it is often necessary to harvest and propagate early, and at this time it may not be possible to screen the grain color. Therefore, the development of a molecular marker that can mark the grain blue and identify it early in grain development will effectively solve this problem and help in the breeding of new blue wheat varieties. SUMMARY

[0005] The application provides a blue wheat SNP marker CAPS-6168 and use thereof, and solves the problem that existing blue wheat breeding needs to be harvested in advance and expanded, and the grain color cannot be screened at this time.

[0006] To solve the above technical problems, the technical scheme adopted by the application is as follows:

[0007] A blue wheat SNP marker CAPS-6168 is located in a TaMYC4-4D gene in haploid wheat, and the nucleotide sequence is CTTAAT.

[0008] Further, preferably, the nucleotide sequence of the TaMYC4-4D gene is shown as SEQ ID NO. 1.

[0009] The application also provides a primer for detecting blue wheat, and the primer is

[0010] TaMYC4-4D-SNP-F: TGCATGATGTCTTCCTACAC, as shown in SEQ ID NO. 2.

[0011] TaMYC4-4D-SNP-R: TCGGAAGAACATGCTGAGAG, as shown in SEQ ID NO. 3.

[0012] The blue wheat SNP marker CAPS-6168 of the application is used in detection or selection of a variety or strain with wheat grain blue pigment content.

[0013] Further, preferably, the primer is used for detecting blue wheat, and the method comprises the following steps:

[0014] (1) designing SNP upstream and downstream primers, and the primers are specifically shown as SEQ ID NO. 2 and SEQ ID NO. 3;

[0015] (2) taking haploid wheat variety DNA as a template, amplifying a TaMYC4-4D coding region fragment in different haploid wheat, and obtaining a single amplification band;

[0016] (3) using Mse I to perform enzyme cutting on the purified PCR product, and performing electrophoresis detection, and if the amplification product is still a single band after enzyme cutting, the wheat is blue.

[0017] The application has the following beneficial effects:

[0018] The application identifies a blue color-specific haplotype of TaMYC4-4D by detecting nucleotide polymorphisms of the TaMYC4-4D gene in different grain color wheat varieties, and develops a blue wheat SNP marker CAPS-6168, which can be used for screening and identifying blue wheat before the appearance of grain color, which will help early identification and generation expansion during the breeding of blue wheat. BRIEF DESCRIPTION OF DRAWINGS

[0019] In order to more clearly illustrate the technical solutions in the embodiments of the present application or the prior art, the drawings needed to be used in the embodiments or prior art description will be briefly introduced below. Obviously, the drawings in the following description are only some embodiments of the present application, and other drawings can be obtained by those skilled in the art without creative labor.

[0020] Figure 1 . Phenotypic diagram of part of the used hexaploid wheat varieties;

[0021] Figure 2 . PCR amplification results of the coding region of TaMYC4-4D;

[0022] Figure 3 . Variation sites of the coding region sequence of TaMYC4-4D in common hexaploid wheat and two formed haplotypes;

[0023] Figure 4 . Determination results of the haplotype CAPS molecular marker of the coding region of TaMYC4-4D. DETAILED DESCRIPTION

[0024] The technical solutions in the embodiments of the present application will be described clearly and completely below with reference to the drawings in the embodiments of the present application. Obviously, the described embodiments are only some embodiments of the present application, not all embodiments. Based on the embodiments in the present application, all other embodiments obtained by those skilled in the art without creative labor are within the scope of protection of the present application.

[0025] 1. Materials

[0026] In this study, 50 common wheat varieties (10 blue wheat, 16 purple wheat, and 24 common wheat) were selected, and the detailed information is shown in Table 1. The phenotypes will be described in detail in the following. Figure 1 .

[0027] The high-fidelity PCR enzyme KOD OneTM PCR Master Mix used for PCR amplification was purchased from Toyo Roshi Bio Inc., and the zero-background ZT4-Blunt rapid cloning kit was purchased from Beijing Zhuangmeng International Biological Gene Technology Co., Ltd.

[0028] Mse I restriction enzyme was purchased from Beijing Baor Medical Biotechnology Co., Ltd. (TAKARA);

[0029] ;

[0030]

[0031] 2. Primer design

[0032] First, according to the sequence difference of the three copies of 4A, 4B and 4D of TaMYC4-4D (TraesCS4D03G0543900) gene in the wheat genome database, the 4D specific coding region amplification primer was designed. Since the full length of the gene is 8556 bp, it contains 7 introns, so five segments are amplified and spliced.

[0033] The first segment is composed of 393 bp fragments from 145 bp upstream of the first exon to 135 bp downstream of the first exon;

[0034] The second segment is composed of 506 bp fragments from 145 bp upstream of the second exon to 254 bp downstream of the second exon;

[0035] The third segment is composed of 587 bp fragments from 62 bp upstream of the third exon to 335 bp downstream of the third exon;

[0036] The fourth segment is composed of 761 bp fragments from 184 bp upstream of the fourth exon to 163 bp downstream of the fifth exon;

[0037] The fifth segment is composed of 1519 bp fragments from 108 bp upstream of the sixth exon to 108 bp downstream of the eighth exon. The primer details are shown in Table 2. Primer synthesis and sequencing were completed by Henan Shangya Biotechnology Co., Ltd.

[0038]

[0039] 3. Extraction of total DNA of wheat

[0040] CTAB method was used to extract total DNA from wheat. First, the wheat leaves or other tissues were quickly frozen in liquid nitrogen and ground, 1 mL of preheated CTAB extraction solution was added, and it was incubated at 65°C for 1 h. Then, after centrifugation at 12000 g, an equal volume of chloroform:isopropyl alcohol (24:1) mixture was added and shaken. After centrifugation at 12000 g for 10 min, the supernatant was transferred to a new tube, 2 times the volume of anhydrous ethanol was added, mixed well, and placed at -20°C for 30 min. The supernatant was removed after centrifugation, and the DNA was washed with 75% ethanol twice. After drying, 100 μL of sterile water was added to dissolve the DNA.

[0041] 4. Amplification and sequencing of the coding region of TaMYC4-4D gene

[0042] The KOD OneTM PCR Master Mix high-fidelity PCR enzyme was used to amplify the target fragment. Five pairs of amplification primers were designed to amplify the TaMYC4-4D coding region sequence using 50 hexaploid wheat DNA as template. The PCR system contains: 25 μL KOD OneTM PCR Master Mix (2×), 0.3 μL of each upstream and downstream primers (10 μM), 200 ng DNA template, and ddH2O to a total volume of 50 μL. The PCR reaction program is as follows: first step, 98°C for 5 min; second step, 98°C for 10 s, 56°C for 10 s, 68°C for 10 min, 35 cycles; third step, 68°C for 5 min. The amplification results are shown in Figure 2. Figure 2 A: First segment PCR amplification results; B: Second segment PCR amplification results; C Third segment PCR amplification results; D: Fourth segment PCR amplification results; E: Fifth segment PCR amplification results.

[0043] The PCR amplified target fragments of each variety were recovered and ligated with ZT4-Blunt cloning vector, transformed into E. coli, and three or more positive clones were selected for sequencing with universal primers T7-F / R.

[0044] The sequencing results: the sequence of TaMYC4-4D-CD in blue wheat is shown in SEQ ID NO. 1; the sequence of TaMYC4-4D-CD in purple wheat and white wheat is shown in SEQ ID NO. 4.

[0045] 5. Sequence alignment and haplotype analysis of the coding region of TaMYC4-4D gene

[0046] The sequencing results were spliced and sequence alignment was performed using DNAMAN software (http: / / www.lynnon.com). Sequence alignment results found that there were 3 SNP sites of sense mutation sites (5845 G / A, 5859 G / A, 6168 C / A) in the TaMYC4-4D coding region in 50 wheat varieties. Haplotype identification of the promoter was performed by DnaSP 5.10 software (http: / / www.ub.edu / DnaSP), and the results showed that the 3 SNPs were tightly linked to form two haplotypes, named TaMYC4-4D-Hap 1 and TaMYC4-4D-Hap 2, as shown in Figure 3.

[0047] 6. Observation and analysis of grain color of different haplotype wheat varieties

[0048] After classification of different haplotypes of wheat, it was found that among the 50 wheat varieties detected, there were 10 Hap 1 haplotype varieties, all of which were blue wheat varieties; there were 40 Hap 2 haplotype varieties, all of which were purple and common wheat. Therefore, Hap 1 is a blue-specific haplotype.

[0049] 7. Development of CAPS molecular markers

[0050] Since the difference between the two haplotype promoters of TaMYC4-4D is a single base difference (SNP), enzyme digestion amplification polymorphism (CAPS) molecular markers can be developed according to these differences. The sequence differences between the coding region of Hap 1 blue-specific haplotype and the coding region of Hap 2 haplotype were analyzed using dCAPS Finder 2.0 (http: / / helix.wustl.edu / dcaps / dcaps.html). The SNP of TaMYC4-4D-Hap 1 at 6168 bp (C / A) is located in the sequence CTTCAT, and the SNP of TaMYC4-4D-Hap 2 at 6168 bp (C / A) is located in the sequence CTTAAT. CTTAAT can be recognized and cut by restriction enzyme Mse I, while CTTCAT cannot be cut (Figure 4). Figure 3). According to the sequence difference, a CAPS molecular marker can be developed to distinguish Hap 1 from other haplotypes, and the marker is named as CAPS-6168. The primers are designed upstream and downstream of the SNP identified by the CAPS marker (the sequence of TaMYC4-4D-SNP-F is shown as SEQ ID NO. 2: TGCATGATGTCTTCCTACAC; the sequence of TaMYC4-4D-SNP-R is shown as SEQ ID NO. 3: TCGGAAGAACATGCTGAGAG), and the TaMYC4-4D coding region fragment (6008 bp~6261 bp) in different haplotype wheat is amplified by using the DNA of different haplotype wheat varieties (6 varieties are selected for each haplotype) as templates, and a single amplification band (254 bp) can be obtained in different haplotype wheat. Then the purified PCR product is digested by Mse I, and the electrophoresis detection result shows that the amplification product of Hap 1 haplotype wheat variety is still a single 254 bp band after enzyme digestion, while the amplification product of Hap 2 haplotype material is changed into two fragments, 159 bp and 95 bp respectively Figure 4 Therefore, the CAPS-6168 molecular marker can distinguish Hap 1 from other haplotypes, and the marker can be used for screening and identification of blue wheat before the appearance of grain color, which will help early identification and generation expansion during the breeding of blue wheat.

[0051] The preferred embodiments of the present application have been described above with the preferred embodiments; however, all modifications and equivalent replacements, improvements, etc. made within the spirit and principles of the present application shall be included in the protection scope of the present application.

Claims

1. Use of the blue wheat SNP marker CAPS-6168 in the detection or selection of varieties or lines having a content of blue grain pigment in wheat, characterized in that: The blue wheat SNP marker CAPS-6168 is located at the 528th nucleotide of SEQ ID NO. 1, and the polymorphism is A / C; The method comprises the following steps: (1) designing SNP upstream and downstream primers, which are specifically shown in SEQ ID NO. 2 and SEQ ID NO. 3; (2) using haplotype wheat variety DNA as a template to amplify the TaMYC4-4D coding region fragment in different haplotype wheat, and obtaining a single amplification band; (3) using Mse I to perform enzyme cutting on the purified PCR product, and performing electrophoresis detection, if the amplification product is still a single band after enzyme cutting, then it is blue wheat.

Images