Tricyclic diterpenoid compound as well as preparation method and application thereof

Abstract

The present invention provides a tricyclic diterpenoid compound having anti-influenza virus activity. The tricyclic diterpenoid compound not only has better anti-H1N1 virus activity, but also is low in toxicity. The invention also discloses a preparation method of the tricyclic diterpenoid compound with antiviral activity. The preparation method comprises the following steps: (1) obtaining a fermentation product rich in the tricyclic diterpenoid compound through microbial fermentation culture; a recombinant vector adopted in the microbial fermentation culture carries nucleotide sequences: PQ793156 (dioxygenase gene), PQ793157 (FAD dependent monooxygenase gene), PQ793158 (terpenoid synthase gene), PQ793159 (UbiA family isopentenyl transferase gene), PQ793160 (GGPP synthase gene) and PQ793161 (amino transferase gene). And (2) separating and purifying the fermentation product obtained in the step (1) to obtain the tricyclic diterpenoid compound.

Description

Technical Field

[0001] The present invention belongs to the technical fields of genetic engineering and biopharmaceuticals, and particularly relates to a method for producing tricyclic diterpenoid compounds using recombinant strains; the present invention also relates to the use of such compounds in anti-influenza viruses. Background Art

[0002] Influenza (abbreviated as "flu") is an acute respiratory infection caused by influenza viruses, with strong infectivity and rapid transmission characteristics. Influenza is mainly transmitted through droplets in the air, contact between people, and contact with contaminated items. Its typical symptoms include acute high fever, general pain, significant fatigue, and mild respiratory symptoms. The high-incidence season of influenza is usually autumn and winter, and the accompanying complications and deaths are quite serious. Influenza viruses can be divided into three types: influenza A (A), influenza B (B), and influenza C (C). Among them, influenza A viruses have strong antigen variation ability, large infectivity, rapid transmission, and are prone to cause large-scale epidemics. A typical example is the influenza A H1N1 virus. Although influenza is usually self-limiting, it is particularly important for high-risk groups such as infants and the elderly. Due to complications such as pneumonia, the proportion of influenza-related deaths in the elderly population is relatively high.

[0003] Currently known anti-influenza drugs include ribavirin, oseltamivir, amantadine, zanamivir, and arbidol, etc. However, these drugs all have certain side effects. For example, ribavirin may cause hemolytic anemia, rash, diarrhea, and teratogenesis, while oseltamivir may cause nausea and vomiting. In addition, in recent years, the drug resistance of influenza viruses to existing antiviral drugs has been increasing, and the large-scale epidemic of novel influenza viruses has prompted people to eagerly hope to develop anti-influenza drugs with new mechanisms. Against this background, the inventor disclosed the invention patent ZL201810115669.3 "Pyrone compounds and preparation methods, uses". The α-pyrone compounds disclosed in this patent not only have good anti-H1N1 and H3N2 virus activities, but are also basically non-toxic to normal cells, have antiviral activity, can be used to prepare drugs against influenza viruses H1N1 and H3N2, and have broad application prospects and huge market spaces.

[0004] Terpenoids are a common class of compounds in nature. Triterpenoids are a special class of molecules among them, showing diverse structures and rich activities. Researchers have also conducted a series of studies on triterpenoids. The invention patent ZL201810320150.9 discloses "A diterpenoid compound from Lonicera macranthoides Hand.-Mazz., its preparation method and use against agricultural fungi". Through the method of extraction and separation by natural product chemistry, a new compound, lonimacranthoidin A, was obtained. Its skeleton belongs to the syn-pimarane type of tricyclic diterpenoids. Triterpenoids of the pimarane type often have various biological activities such as antioxidant, anti-tumor, anti-inflammatory, and antibacterial activities. The tricyclic diterpenoid compound prepared in this invention has a strong inhibitory effect on agricultural pathogenic fungi and can be used to prepare drugs against agricultural pathogenic fungi. HISAYUKI KOMAKI et al. (The Journal of antibiotics, 1999, 52(1): 13-19) isolated a new tricyclic diterpenoid derivative, brasilicardin A, from the pathogenic actinomycete Nocardia brasiliensis IFM 0406, and for the first time reported that the brasilicardin A compound has immunosuppressive activity. Meyer and Zeeck et al. (2003, PhD thesis, Institute of Organic and Biomolecular Chemistry, University of Germany.) isolated four new tricyclic diterpenoid derivatives, Phenalinolactones A–D, from Streptomyces sp. 6071, and for the first time reported that Phenalinolactones compounds have antibacterial activity. Liao-Bin Dong et al. (ChemBioChem, 2018, 19(16): 1727-1733.) isolated some tricyclic diterpenoid derivatives, Tiancilactones, from Streptomyces sp. CB03234 and Streptomyces sp. CB03238, and reported that these compounds have broad-spectrum antibacterial activity.

[0005] Currently, there is no report on the antiviral activity of tricyclic diterpenoids. Summary of the Invention

[0006] In view of the current situation of anti-influenza drugs, the present invention provides tricyclic diterpenoid compounds with anti-influenza virus activity. Compared with existing commonly used drugs, the tricyclic diterpenoid compounds not only have excellent anti-H1N1 virus activity, but also have low toxicity and are basically non-toxic to normal cells. Therefore, they have broad application prospects and great economic value.

[0007] The technical solution of the present invention:

[0008] Tricyclic diterpenoid compounds with antiviral activity, wherein the tricyclic diterpenoid compounds are tricyclic diterpenoid compound 1 (Ostamycin A) and 2 (Ostamycin B); their structural formulas are as follows:

[0009]

[0010] The application of the tricyclic diterpenoid compounds as described above in the preparation of anti-influenza virus drugs, wherein the influenza virus is H1N1. The inventors have found through research that the antiviral tricyclic diterpenoid compounds of the present invention act on the nucleoprotein of the influenza virus. It can be seen therefrom that the compounds inhibit the replication of the influenza virus by acting on the nucleoprotein, thereby inhibiting the H1N1 virus.

[0011] A pharmaceutical composition comprising the tricyclic diterpenoid compounds with antiviral activity as described above and a pharmaceutically acceptable carrier.

[0012] The preparation method of the tricyclic diterpenoid compounds with antiviral activity as described above, comprising the following steps:

[0013] (1) Obtain a fermented product rich in tricyclic diterpenoid compounds through microbial fermentation culture. Among them, the recombinant vector used in the microbial fermentation culture carries nucleotide sequences: PQ793156 (dioxygenase gene), PQ793157 (FAD-dependent monooxygenase gene), PQ793158 (terpene synthase gene), PQ793159 (UbiA family prenyltransferase gene), PQ793160 (GGPP synthase gene), PQ793161 (aminotransferase gene).

[0014] (2) Separate and purify the fermented product obtained in step (1) by liquid-liquid extraction, reverse-phase silica gel column chromatography and semi-preparative HPLC to obtain the tricyclic diterpenoid compounds. Specifically: extract the corresponding fermented product with ethyl acetate, perform liquid-liquid extraction with equal volumes of n-hexane - 95% methanol, perform reverse-phase silica gel column chromatography, elute with methanol and water as solvents, collect the elution fraction of methanol - water 90:10, and then separate and purify by semi-preparative HPLC to obtain compounds 1 and 2. Among them, each liter of the culture medium contains: soluble starch 10 g, KH 2 PO4 0.5 g, MgSO 4 7H 2 O 0.5g, glucose 20g, yeast extract 10g, corn syrup 4g, beef extract 3g, CaCO 3 2g, sea salt 30g, the rest is water, pH 7.2.

[0015] A recombinant vector, the recombinant vector carrying the nucleotide sequences of PQ793156 (dioxygenase gene), PQ793157 (FAD-dependent monooxygenase gene), PQ793158 (terpene synthase gene), PQ793159 (UbiA family isopentenyl transferase gene), PQ793160 (GGPP synthase gene), and PQ793161 (aminotransferase gene).

[0016] The microorganism comprises the recombinant vector as described above. After fermentation and cultivation of the microorganism, a fermentation product rich in tricyclic diterpenoid compounds can be obtained. The tricyclic diterpenoid compounds are tricyclic diterpenoid compounds with antiviral activity.

[0017] Beneficial effects of the present invention:

[0018] (1) The present invention provides a novel tricyclic diterpenoid compound with antiviral activity, which has the prospect of being developed into a new anti-influenza drug and produces unexpected technical effects.

[0019] (2) The present invention also provides a method for preparing tricyclic diterpenoid compounds with antiviral activity. Compared with existing anti-influenza drugs, the compounds can be optimized in yield and prepared by large-scale fermentation through molecular genetic manipulation, and have prospects for market application.

[0020] (3) The tricyclic diterpenoid compounds with antiviral activity described in the present invention have very low toxicity and are basically non-toxic to normal cells. Compared with existing drugs, they have natural advantages, not only have good activity, but also significantly reduce toxic side effects, and have broad application prospects and huge market space. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Attached Figure 1 The electrophoresis diagram for the construction verification of the expression vector constructed in Example 1 of the present invention;

[0022] Attached Figure 2 The ultraviolet absorption spectra of tricyclic diterpenoid compounds 1 and 2 prepared in Example 2 of the present invention;

[0023] Attached Figure 3 The mass spectrum (MS) of the tricyclic diterpenoid compound 1 prepared in Example 2 of the present invention;

[0024] Appendix Figure 4 It is the mass spectrometry (MS) spectrum of tricyclic diterpenoid compound 2 prepared in Example 2 of the present invention;

[0025] Appendix Figure 5 It is the result of hemagglutination inhibition experiment on compound 1 in Example 5 of the present invention;

[0026] Appendix Figure 6 It is the result of neuraminidase inhibition experiment on compound 1 in Example 5 of the present invention;

[0027] Appendix Figure 7 It is the result of NP protein expression in MDCK cells infected with H1N1 virus by compound 1 in Example 5 of the present invention;

[0028] Appendix Figure 8 It is the immunofluorescence result of NP protein of MDCK virus after compound 1 acts on H1N1 infection in Example 5 of the present invention. Detailed implementation manners

[0029] The present invention will be further described below in conjunction with examples. Unless otherwise specified, the raw materials used in the following examples are obtained through commercial channels.

[0030] Example 1: Construction of recombinant strain

[0031] (1) Extraction of genomic DNA

[0032] Inoculate Streptomyces amphotericinicus DS22-01 in TSBY liquid medium and culture overnight at 30°C. Centrifuge to collect the thalli and wash them with an appropriate amount of STE buffer; add a lysozyme solution of 3 - 5 mg / mL prepared with STE buffer, carefully and fully suspend the thalli, and incubate in a water bath at 37°C for 30 min until the cells become semi-transparent; add 6% SDS, gently mix up and down, and continue to incubate in a water bath at 37°C until it becomes clear; after adding an appropriate amount of 3M NaAc (pH = 4.8), then add an appropriate amount of phenol:chloroform:isoamyl alcohol (25:24:1; v / v / v), mix, and centrifuge at 12,000 rpm; transfer the upper clear liquid, repeatedly extract with phenol:chloroform:isoamyl alcohol until there are no protein impurities in the middle layer, transfer the supernatant, add an equal volume of isopropanol, and mix until white flocculent DNA precipitates; pick out the flocculent precipitate, wash it 1 - 2 times with 70% ethanol; after drying at room temperature, dissolve the genomic DNA with an appropriate amount of TE for standby.

[0033] (2) Construction of recombinant vector

[0034] Design primer pairs:

[0035] P1: 5’-CGCCGATGGTTTCTACAAAGATCG ACTAGT TGTTCACATTCGAACGGTCT-3’

[0036] P2: 5’–cgtctttgtcagacatAACTCCCCCAGTCCTGCAC-3’;

[0037] P1’: 5’-CAGGACTGGGGGAGTTatgtctgacaaagacggctggaa-3’

[0038] P2’: 5’–TTTTCTAAATACAGGTACCTCAAGT CTCGAG TCAGTAGCCCGCCTTGGCGTTGAC-3’。

[0039] Among them, the primer pair P1 / P2 uses the synthesized promoter P SF14 nucleotide sequence as a template to amplify the constitutive promoter P SF14 , and the primer pair P1’ / P2’ uses the genomic DNA of S. amphotericinicus DS22-01 as a template to amplify the functional genes PQ793156-PQ793161. The underlines are the restriction sites of SpeI and XhoI respectively.

[0040] PCR reaction system:

[0041] 2 μL (10 μmol) of each of the primer pairs P1 and P2 (P1’ and P2’), 1 μL of template, 25 μL of 2×Phanta Flash MasterMix (Dye Plus), add ddH 2 O to 50 μL.

[0042] PCR conditions:

[0043] Promoter amplification conditions, denaturation at 98°C for 1 min; 98°C for 30 s, 60°C for 30 s, 72°C for 20 s, 30 cycles; 72°C for 1.5 min; Functional gene amplification conditions, denaturation at 98°C for 1 min; 98°C for 30 s, 62°C for 30 s, 72°C for 1 min 30 s, 30 cycles; 72°C for 1.5 min. The promoter, functional gene and integrative vector pCAP01 were ligated using seamless ligase AB clone, transformed into Escherichia coli DH5α competent cells, positive clones were selected, and sequence determination was performed. The results are shown in Sequences 1-6; and PCR amplification verification was performed using primers P1 / P2’, as shown in Figure 1 the electrophoresis diagram, proving the correctness of the sequence.

[0044] (3) Construction of recombinant strains

[0045] The recombinant vector constructed in step (2) was introduced into the heterologous expression host S.coelicolor M1146 to obtain recombinant strain I.

[0046] Example 2: Preparation of tricyclic diterpenoid compound 1 and compound 2

[0047] 1. Fermentation production

[0048] (1) Cultivation of spores: According to the conventional method for culturing microorganisms, an appropriate amount of the recombinant strain I constructed in Example 1 was inoculated onto an MS solid slant medium and placed in a constant temperature incubator at 30 °C for 3 - 4 days.

[0049] MS medium: 20 g of soybean powder, 20 g of mannitol, 20 g of agar powder, dissolved in water, made up to 1 L, sterilized at 121 °C for 30 minutes. After sterilization, the medium was poured into a petri dish with a diameter of 90 mm and dispensed at 30 ml / plate.

[0050] (2) Fermentation culture

[0051] An appropriate amount of the spores of the recombinant strain cultured on the slant for 3 - 4 days was inoculated into a 250 ml conical flask containing 50 ml of the culture solution, placed in a constant temperature shaker at 30 °C, and cultured at a rotation speed of 220 rpm for 7 days to obtain mycelium and fermentation broth. Among them, the medium composition was: 10 g of soluble starch, KH 2 PO 4 0.5 g, MgSO 4 ·7H 2 O 0.5 g, 20 g of glucose, 10 g of yeast extract, 4 g of corn steep liquor, 3 g of beef extract, 2 g of CaCO 3 2 g, 30 g of sea salt, prepared with tap water, pH adjusted to 7.2.

[0052] 2. Obtaining the extract

[0053] The fermentation broth and mycelium were centrifuged at a rotation speed of 7500 rpm. The mycelium was discarded, and the fermentation broth was directly extracted three times with an equal volume of ethyl acetate. The ethyl acetate phases were combined and concentrated under reduced pressure to obtain a crude extract, a total of 2.5 g.

[0054] 3. Separation and purification of the compound

[0055] 2.5 g of the extract was first extracted twice with equal volumes of n-hexane-95% methanol, and the solvent was removed under reduced pressure. Then, the 95% methanol phase was subjected to reverse phase silica gel column chromatography, and gradient elution was performed with methanol-water as the solvent, and it was divided into 12 fractions. Fr-10 (methanol-water 90:10 eluate, 269 mg) was subjected to semi-preparative reverse phase high performance liquid chromatography (acetonitrile: water = 46:54 to acetonitrile: water = 60:40, 60 min) to obtain compound 1 (6 mg) and compound 2 (2 mg), both of which were white solid powders.

[0056] Example 3: Characterization of Compound 1 and Compound 2

[0057] Compound 1 and Compound 2 prepared in Example 2 were subjected to UV, MS, 1 H NMR and 13 C-NMR was used for characterization, and its structure was analyzed based on the characterization results.

[0058] Among them, for compound 1, UV (MeOH) λmax (logε) 220.0 (3.5), 239.0 (3.7) nm, molecular formula C 23 H 36 O 5 , HR-ESIMS m / z 391.2494[MH] - For compound 2, UV(MeOH)λmax(logε)257.0(3.0),323.0(3.6)nm, molecular formula C 23 H 34 O 4 , HR-ESIMS m / z 373.2383[MH] - In addition, the 1 HNMR and 13 The C-NMR data are detailed in Table 1. The signal attribution is based on the analysis results of HH COSY, HMQC and HMBC spectra. The multiplicity of carbon signals is represented by s (singlet), d (doublet), t (triplet), q (quartet) and m (multiplet), respectively.

[0059] Table 1 Compound 1 and Compound 2 1 H and 13 C NMR data (400 and 125 MHz, in d 6 -DMSO)

[0060]

[0061] Combining UV, MS, 1 H NMR and 13 C-NMR, it can be inferred that the structures of compound 1 and compound 2 are as follows:

[0062]

[0063] Example 4: Test on the anti-influenza virus activities of Compound 1 and Compound 2

[0064] (1) Experimental samples and methods

[0065] Preparation of the test sample solution: The test samples were the pure products of Compound 1 and Compound 2 separated and purified in Example 2. An appropriate amount of the samples was weighed and dissolved in DMSO to prepare a solution with the required concentration for activity testing.

[0066] Cell line and subculture of cells: Madin-Darby canine kidney (MDCK) cells were used. The cells were cultured in RPMI-1640 medium containing 10% fetal bovine serum (FBS) and subcultured in an incubator at 37°C with 5% CO 2 . The virus used was H1N1 (A / Puerto Rico / 8 / 1934) virus strain.

[0067] Cytopathic effect (CPE) inhibition experiment to determine the inhibition rate of the samples against influenza A virus: The MDCK cell suspension digested into a monolayer was seeded in a 96-well plate at a cell density of 25,000 cells / well, and the volume of the cell culture medium was 200 μL. After the cells grew to a monolayer after 24 h of culture, the influenza virus solution (MOI = 0.1) was inoculated. After incubation at 37°C for 1 h, the supernatant virus solution was discarded, and 200 μL of the drug-containing maintenance solution (ribavirin as the positive drug) was added. Subsequently, the cells were incubated at 37°C and 5% CO 2 for 30 h. The cells were fixed with 4% paraformaldehyde for 15 min and finally stained with crystal violet stain for 25 min. The OD value at a wavelength of 570 nm was measured for each well, and the inhibition rate of the drug against the IAV virus was calculated according to the formula:

[0068] Virus inhibition rate % = (OD value of the drug treatment group - OD value of the virus control group) / (OD value of the normal cell control group - OD value of the virus control group) × 100%

[0069] (2) Experimental results

[0070] Table 2. Inhibitory activities of Compound 1 and 2 against influenza virus H1N1

[0071]

[0072] (3) Conclusion

[0073] As can be seen from Table 2, the minimum inhibitory concentration IC 50 of Compound 1 against influenza virus H1N1 was 4.72 ± 0.65 μM, and the 50% cytotoxic concentration CC 50was 2595.41 ± 3.62 μM. The minimum inhibitory concentration IC of compound 2 against influenza virus H1N1 50 was 195.59 ± 1.74 μM, and the half-maximal cytotoxic concentration CC 50 was 514.55 ± 2.29 μM. For ribavirin, a common antiviral drug on the current market, the minimum inhibitory concentration IC 50 against influenza virus H1N1 was 20.80 ± 0.77 μM, and the half-maximal cytotoxic concentration CC 50 was 3702.46 ± 2.16 μM.

[0074] It can be seen from this that the IC 50 of compound 1 against H1N1 (A / Puerto Rico / 8 / 1934) virus was 77.3% lower than that of ribavirin, indicating that the inhibitory effect was significantly better than that of ribavirin and it could be used as an influenza virus inhibitor for anti-influenza virus research. The IC 50 of compound 2 against H1N1 (A / Puerto Rico / 8 / 1934) virus was 9.4 times lower than that of ribavirin. Although the inhibitory effect was not as good as that of ribavirin, it still had a good inhibitory effect and had the application prospect as an influenza virus inhibitor.

[0075] In summary, the tricyclic diterpenoid compounds described in this application have an obvious inhibitory effect on H1N1 virus. Therefore, the tricyclic diterpenoid compounds have the prospect of being developed into new anti-influenza drugs. This will undoubtedly have great social significance and economic prospects for solving the current demand for anti-influenza drugs by people.

[0076] Example 5: Exploration of the anti-influenza virus target of compound 1

[0077] I. Experimental samples and experimental methods

[0078] Preparation of the test sample solution The test sample was the pure product of compound 1 separated and purified in Example 2. An appropriate amount of the sample was accurately weighed and dissolved in DMSO to prepare a solution with the required concentration for measuring the activity.

[0079] (1) Hemagglutination inhibition (HI) experiment

[0080] To determine whether the sample binds to the hemagglutinin on the surface of the influenza virus, specifically: 25 μL of compound 1 with different concentrations and the positive control influenza hemagglutinin antibody were added into a V-shaped 96-well plate. Then, 25 μL of H1N1 virus with four hemagglutination units was added to each well. After incubation at 37 °C for 60 min, 50 μL of 1% chicken red blood cells was added to each well. After shaking and mixing evenly for 1 min, incubation was carried out at room temperature for 45 min. The 96-well plate was placed vertically to observe the hemagglutination result.

[0081] (2) Neuraminidase inhibition (NI) experiment

[0082] To determine the effect of the sample on the neuraminidase on the surface of influenza virus, specifically: Using a neuraminidase inhibitor screening kit, add 70 μL of neuraminidase detection buffer to each well in a 96-well fluorescence microplate. Then add 0, 1, 2, 5, 7.5, 10 μL of neuraminidase to each well respectively, and add an appropriate amount of distilled water to make the total volume 90 μL for standard curve drawing. For sample detection, add 70 μL of neuraminidase detection buffer to each well, then add 10 μL of neuraminidase to each well, and add 10 μL of compound 1 at different concentrations and the positive drug zanamivir, making the total volume 90 μL. After vibrating and mixing for 1 min, incubate at 37 °C for 2 min to fully mix the solution. Add 10 μL of neuraminidase fluorescent substrate to each well, vibrate and mix for 1 min, then incubate at 37 °C for 30 min, and detect using a fluorescence microplate reader with an excitation wavelength of 322 nm and an emission wavelength of 450 nm. Calculate the inhibition percentage of the sample on neuraminidase according to the standard curve.

[0083] (3) Western blot experiment

[0084] To determine the change in the expression of the viral nucleoprotein (NP) in host cells after the sample acts on H1N1 virus-infected cells. Specifically: Seed MDCK cells in a 6-well plate and incubate in a 37 °C, 5% CO 2 cell incubator for 24 h, then inoculate with influenza virus solution (MOI = 1.0). After incubating at 37 °C for 1 h, discard the supernatant virus solution, and add compound 1 at different concentrations and 20 μM ribavirin; after 4 h, aspirate the liquid in the culture dish, add cell lysis buffer RIPA to lyse cell proteins. After heating in a 100 °C metal bath for 15 min, measure the protein content using the BCA method. After calibrating the protein concentration, add an appropriate amount of loading buffer. The proteins in the cell lysis buffer are separated by SDS-PAGE gel electrophoresis, then transferred to a nitrocellulose membrane by wet transfer. After blocking with skim milk for 2 h, add the primary antibodies against NP and the internal reference protein GAPDH and incubate overnight. After washing, add a 1:5000 diluted secondary antibody labeled with alkaline phosphatase and incubate at room temperature for 1.5 h, then wash. Finally, use the BCIP / NBT alkaline phosphatase color development kit for band color development, take pictures, and analyze the change in protein expression using Image J.

[0085] (4) Indirect immunofluorescence experiment

[0086] To determine the change in the expression of the viral NP protein after the sample acts on host cells. Specifically: Seed MDCK cells in a 24-well plate with coverslips and incubate in a 37 °C, 5% CO 2After incubating in a cell incubator for 24 h, influenza virus solution (MOI = 1.0) was inoculated. After incubating at 37 °C for 1 h, the supernatant virus solution was discarded, and compounds 1 at different concentrations and 20 μM ribavirin were added. After 4 h, the liquid in the culture dish was aspirated, and after washing 2 - 3 times with PBS, 4% paraformaldehyde was added for fixation at room temperature for 15 min. After washing, 0.25% Triton X - 100 was added for permeabilization at room temperature for 10 min. Subsequently, the cells were washed, and 3% BSA was added and incubated at 37 °C for 1 h. After incubating overnight at 4 °C with influenza virus NP antibody, the cells were washed, and the secondary antibody conjugated with AF647 was incubated in the dark at room temperature for 2 h. Subsequently, the cells were washed, and the coverslips were mounted with an anti - fluorescence quenching mounting medium containing DAPI, and photographed using an Olympus FV3000 laser confocal microscope.

[0087] II. Experimental Results

[0088] The results of the HI experiment are as Figure 5 shown. It can be seen from Figure 5 that as the concentration increased, the agglutination of chicken red blood cells in the positive control group was significantly inhibited, and the effect was comparable to that without adding virus. However, compound 1 could not inhibit the agglutination of chicken red blood cells, suggesting that compound 1 has no obvious binding effect on the hemagglutinin of influenza virus.

[0089] The results of the NI experiment are as Figure 6 shown. It can be seen from Figure 6 that compared with the positive drug zanamivir, the inhibitory activities of compound 1 at different concentrations on neuraminidase were almost the same, approximately 4.04%. This indicates that compound 1 has almost no inhibitory effect on the neuraminidase of influenza virus.

[0090] The results of the Western blot experiment are as Figure 7 shown. It can be observed from Figure 7 that the concentration of viral NP protein in the virus group was the highest. When the concentration of compound 1 was 10 μM, it could significantly inhibit the expression of viral NP protein, and the inhibitory activity was higher than that of the positive drug ribavirin, indicating that compound 1 can inhibit the expression of viral NP protein in host cells in a concentration - dependent manner.

[0091] The results of the indirect immunofluorescence experiment are as Figure 8 shown. It can be observed from Figure 8 that: (1) Compared with the virus group, the fluorescence signal shown by 20 μM ribavirin in the viral NP protein channel was significantly weakened. (2) Compound 1 had only a weak fluorescence signal at a concentration of 10 μM, and no fluorescence signal was detected at concentrations of 20 μM and 40 μM. This is consistent with Figure 7 the results, indicating that compound 1 can target and inhibit the expression of viral NP protein, thereby exerting anti - influenza virus activity.

[0092] In summary, compared with the positive drug ribavirin, compound 1 can significantly inhibit the expression of influenza virus NP protein in Madin-Darby canine kidney (MDCK) cells, and compound 1 at different concentrations all shows strong inhibitory activity against the expression of viral nucleoprotein. Meanwhile, with the increase of the sample concentration, the expression level of viral NP protein in host cells infected with H1N1 significantly decreases. Thus, it can be clearly seen that the inhibitory effect of compound 1 on H1N1 (A / Puerto Rico / 8 / 1934) virus is mainly achieved by inhibiting the expression of H1N1 virus protein NP, thereby inhibiting virus replication and exerting antiviral activity.

[0093] In conclusion, both the tricyclic diterpenoid compound 1 and compound 2 described in this application have obvious inhibitory effects on H1N1 virus and have the prospect of being developed into new anti-influenza drugs. This will undoubtedly have great social significance and economic prospects for meeting the current demand for anti-influenza drugs.

Claims

1. A tricyclic diterpenoid compound having antiviral activity, characterized in that: The tricyclic diterpenoid compounds are tricyclic diterpenoid compounds 1 (Ostamycin A) and 2 (Ostamycin B); their structural formulas are as follows:

2. Use of the tricyclic diterpenoid compound according to claim 1 in the preparation of anti-influenza virus drugs; characterized in that: The influenza virus is H1N1.

3. A pharmaceutical composition, characterized in that: It comprises the tricyclic diterpenoid compound with antiviral activity as claimed in claim 1 and a pharmaceutically acceptable carrier.

4. The method for preparing a tricyclic diterpenoid compound according to claim 1, wherein: The following steps are involved: (1) obtaining a fermentation product rich in tricyclic diterpenoid compounds by microbial fermentation and cultivation; (2) separating and purifying the fermentation product obtained in step (1) to obtain the tricyclic diterpenoid compounds.

5. The method for preparing tricyclic diterpenoid compounds according to claim 4, characterized in that: The nucleotide sequences carried by the recombinant vector used in the microbial fermentation culture in the step (1) are: PQ793156 (dioxygenase gene), PQ793157 (FAD-dependent monooxygenase gene), PQ793158 (terpene synthase gene), PQ793159 (UbiA family isopentenyl transferase gene), PQ793160 (GGPP synthase gene) and PQ793161 (aminotransferase gene).

6. The method for preparing tricyclic diterpenoid compounds according to claim 5, characterized in that: The step (2) specifically comprises: the fermentation product obtained in the step (1) is separated and purified by liquid-liquid extraction, reverse phase silica gel column chromatography and semi-preparative HPLC to obtain the tricyclic diterpenoid compound.

7. The method for preparing tricyclic diterpenoid compounds according to claim 5, characterized in that: The method for preparing tricyclic diterpenoid compounds according to claim 5, characterized in that: the culture medium used in the microbial fermentation culture in step (1) is composed of: soluble starch 10g, KH2PO4 0.5g, MgSO4·7H2O 0.5g, glucose 20g, yeast extract 10g, corn steep liquor 4g, beef extract 3g, CaCO3 2g, sea salt 30g, tap water, and the pH is adjusted to 7.

2.

8. A recombinant vector, characterized in that: The nucleotide sequences carried by the recombinant vector are PQ793156 (dioxygenase gene), PQ793157 (FAD-dependent monooxygenase gene), PQ793158 (terpene synthase gene), PQ793159 (UbiA family isopentenyl transferase gene), PQ793160 (GGPP synthase gene), and PQ793161 (aminotransferase gene).

9. A microorganism comprising the recombinant vector according to claim 8, characterized in that: After fermentation and cultivation of the microorganism, a fermentation product rich in tricyclic diterpenoid compounds can be obtained, and the tricyclic diterpenoid compounds have antiviral activity.

Images