LN-R-6 strain of variovorax sp. And application thereof

Abstract

The invention provides a variovorax LN-R-6 strain and application thereof, and belongs to the technical field of agricultural microorganisms. The invention provides a strain of variovorax LN-R-6, and the preservation number of the variovorax LN-R-6 is CGMCC (China General Microbiological Culture Collection Center) NO. 33128. The variovorax LN-R-6 has the capabilities of fixing nitrogen, dissolving phosphorus, dissolving potassium, producing siderophores and producing IAA (indoleacetic acid), and can play a role in promoting the growth of plants. The variovorax LN-R-6 has the capacity of resisting salt and alkali and degrading environmental alkalinity, and can improve soil conditions while surviving in an alkaline environment, so that not only is the growth of plants facilitated, but also help is provided for the treatment of alkaline land. According to the application disclosed by the invention, pot experiments show that the variovorax LN-R-6 has an obvious growth promoting effect on the growth of host plants and non-host plants. Field experiments show that the variovorax LN-R-6 can significantly promote the growth of corn and increase the yield of the corn.

Description

Technical Field

[0001] The present invention belongs to the technical field of agricultural microorganisms, and particularly relates to a bacterium of Variovorax LN-R-6 and its application. Background Art

[0002] As one of the major nutrient elements affecting crop growth and yield formation, the amount of available nitrogen absorbed by crops from the soil is a key indicator reflecting their growth status. At present, agricultural production worldwide is highly dependent on fertilizers. Excessive application of nitrogen fertilizers can lead to a series of problems such as soil acidification, water eutrophication, and a decline in grain yield. In addition, due to the lack of sufficient environmental awareness and fertilization techniques, nitrogen fertilizers are often not used rationally, which further exacerbates the severity of environmental problems. Therefore, exploring feasible ways to utilize nitrogen is crucial for agricultural production.

[0003] Biological nitrogen fixation (Bio-N-N), that is, a method by which some microorganisms convert nitrogen in the air into nitrogen that can be absorbed by crops, plays a crucial role in the nitrogen cycle of the ecosystem. Although chemical fertilizers can improve soil fertility and crop yield, long-term irrational application will cause deterioration of the soil environment. Compared with traditional chemical fertilizers, biological nitrogen fixation technology has the advantages of providing a large amount of nitrogen for crops and being pollution-free.

[0004] Nitrogen-fixing microorganisms play a key role in nitrogen fixation in terrestrial ecosystems, and their strong nitrogen-fixing ability provides a crucial nitrogen source for plant growth. Many nitrogen-fixing microorganisms can not only greatly improve the rhizosphere environment of plants, optimize the physical and chemical properties of the soil, but also strongly promote the healthy growth of plants. The research and application of nitrogen-fixing related microorganisms are mainly reflected in the following three aspects: First, manufacturing nitrogen-fixing microbial fertilizers. The beneficial microbial living cells or dormant cells contained in biological fertilizers can continuously inject power into plant growth and development. The growth-promoting effect of nitrogen-fixing bacteria agents on corn is extremely significant. Moreover, it can effectively save the use of nitrogen fertilizers. In addition, the application of nitrogen-fixing microorganisms can significantly improve the soil environment. Therefore, microbial preparations have broad application prospects in improving saline-alkali land. Second, used as biological control agents. Nitrogen-fixing related microorganisms can inhibit the growth of pathogenic bacteria to achieve the purpose of preventing diseases and promoting growth. Third, nitrogen-fixing microorganisms can also form a symbiotic relationship with plants, such as the symbiosis between leguminous plants and rhizobia. In this symbiotic relationship, nitrogen-fixing microorganisms provide nitrogen for plants, while plants provide the nutrients and a suitable living environment required for the survival of nitrogen-fixing microorganisms.

[0005] In the current research on nitrogen-fixing microorganisms, there is no research on the nitrogen fixation of Variovorax and further promotion of plant growth. Summary of the Invention

[0006] In view of the problems in the prior art, the purpose of the present invention is to provide a Variovorax sp. which can fix nitrogen, promote the growth of crops and increase crop yields at the same time.

[0007] The purpose of the present invention is achieved by the following technical solutions:

[0008] The present invention provides a strain of Variovorax sp. LN-R-6, and the preservation number of the Variovorax sp. LN-R-6 is CGMCC NO. 33128.

[0009] The present invention provides a microbial preparation, which includes any one or more of the Variovorax sp. LN-R-6, the bacterial suspension of the Variovorax sp. LN-R-6 and the fermentation broth of the Variovorax sp. LN-R-6 described in the above technical solution.

[0010] Preferably, the viable bacteria of Variovorax sp. LN-R-6 in the microbial preparation are ≥ 10 8 cfu / g or ≥ 10 8 cfu / mL.

[0011] The present invention provides a preparation method of the microbial preparation described in the above technical solution, including:

[0012] Culturing the Variovorax sp. LN-R-6 in a culture medium to obtain a microbial preparation.

[0013] Preferably, the temperature of the culturing is 28-30 °C; oscillation is accompanied during the culturing process; the rotation speed of the oscillation is 180-220 rpm; the culturing time is 1-4 d.

[0014] The present invention provides a microbial bacterial fertilizer, the raw materials of which include: the Variovorax sp. LN-R-6 described in the above technical solution and straw.

[0015] The present invention provides a preparation method of the microbial bacterial fertilizer described in the above technical solution, including the following steps:

[0016] Inoculating the bacterial suspension of Variovorax sp. LN-R-6 into a fermentation substrate containing straw for fermentation culture to obtain a microbial bacterial fertilizer.

[0017] The present invention provides the application of the Variovorax sp. LN-R-6, the microbial preparation or the microbial bacterial fertilizer described in the above technical solution in any one or more of the following (1)-(4):

[0018] (1) Nitrogen fixation;

[0019] (2) Promoting plant growth;

[0020] (3) Degrading alkalinity in the environment;

[0021] (4) Improve the soil aggregate structure.

[0022] Preferably, the plant includes crops; the crops include corn and / or wheat.

[0023] The present invention provides a method for promoting plant growth, including:

[0024] Applying the microbial agent described in the above technical solution and / or applying the microbial fertilizer described in the above technical solution during plant planting;

[0025] Or, applying the microbial agent described in the above technical solution and / or applying the microbial fertilizer described in the above technical solution near the roots during the plant growth stage.

[0026] Advantages of the present invention:

[0027] The present invention provides a strain of Variovorax sp. LN-R-6, and the preservation number of the Variovorax sp. LN-R-6 is CGMCC NO. 33128. A strain of Variovorax sp. LN-R-6 is isolated in the present invention. Through the double-antibody one-step sandwich enzyme-linked immunosorbent assay (ELISA), it is detected that the nitrogenase activity of the Variovorax sp. LN-R-6 reaches 275.70 U / L, and the nitrogen fixation ability is strong. The Variovorax sp. LN-R-6 also has the abilities of dissolving phosphorus, decomposing potassium, producing siderophores and producing IAA, and can play a growth-promoting role for plant growth. The Variovorax sp. LN-R-6 also has the abilities of salt and alkali tolerance and degrading environmental alkalinity, which enables it to survive in an alkaline environment while improving soil conditions. This is not only beneficial to the growth of plants, but also provides help for the treatment of alkaline land. The Variovorax sp. LN-R-6 can also improve the soil aggregate structure, further achieving the effect of improving the soil. In the examples of the present invention, through pot experiments, it is shown that the Variovorax sp. LN-R-6 has an obvious growth-promoting effect on both host plants and non-host plants. Through field experiments, the present invention shows that: the Variovorax sp. LN-R-6 can significantly promote the growth of corn and increase its yield. In summary, the Variovorax sp. LN-R-6 provided by the present invention can, while fixing nitrogen, also improve the soil environment and promote plant growth, and has broad application prospects.

[0028] Biological preservation description

[0029] The Variovorax sp. LN-R-6, classified and named as Variovorax sp., was preserved in the China General Microbiological Culture Collection Center on December 19, 2024. The address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing, Institute of Microbiology, Chinese Academy of Sciences, and the preservation number is CGMCC NO. 33128. Description of the drawings

[0030] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the accompanying drawings required in the embodiments. Obviously, the accompanying drawings in the following description are only some embodiments of the present invention. For those of ordinary skill in the art, without creative efforts, other accompanying drawings can be obtained based on these drawings.

[0031] Figure 1 It is the overall research idea and technical roadmap of the present invention;

[0032] Figure 2 It is the phylogenetic evolution analysis result diagram of strain LN-R-6;

[0033] Figure 3 It is the qualitative identification result diagram of the nitrogen fixation ability of Nitrophage LN-R-6;

[0034] Figure 4 It is the qualitative identification result diagram of the phosphorus solubilizing ability of Nitrophage LN-R-6;

[0035] Figure 5 It is the identification result diagram of the potassium solubilizing and siderophore production abilities of Nitrophage LN-R-6;

[0036] Figure 6 It is the salt tolerance detection result diagram of Nitrophage LN-R-6;

[0037] Figure 7 It is the result diagram of the change of soil aggregate structure by Nitrophage LN-R-6;

[0038] Figure 8 It is the growth influence diagram of Nitrophage LN-R-6 on corn plants in the pot experiment;

[0039] Figure 9 It is the influence result diagram of Nitrophage LN-R-6 on the plant height, fresh weight and dry weight of the above-ground part of corn in the pot experiment;

[0040] Figure 10 It is the influence result diagram of Nitrophage LN-R-6 on the nitrogen concentration, potassium concentration and phosphorus concentration of the above-ground part of corn in the pot experiment;

[0041] Figure 11 It is the influence result diagram of Nitrophage LN-R-6 on the nitrogen accumulation amount, potassium accumulation amount and phosphorus accumulation amount of the above-ground part of corn in the pot experiment;

[0042] Figure 12 It is the root growth influence diagram of Nitrophage LN-R-6 on corn plants in the pot experiment;

[0043] Figure 13 It is the radar diagram of the results of the root scanning of corn plants by Nitrophage LN-R-6 in the pot experiment;

[0044] Figure 14 It is a graph showing the growth effect of Variovorax sp. LN-R-6 on wheat plants in a pot experiment;

[0045] Figure 15 It is a graph showing the effect of Variovorax sp. LN-R-6 on the plant height, fresh weight and dry weight of the above-ground part of wheat in a pot experiment;

[0046] Figure 16 It is a graph showing the effect of Variovorax sp. LN-R-6 on the nitrogen concentration, potassium concentration and phosphorus concentration of the above-ground part of wheat in a pot experiment;

[0047] Figure 17 It is a graph showing the effect of Variovorax sp. LN-R-6 on the nitrogen accumulation, potassium accumulation and phosphorus accumulation of the above-ground part of wheat in a pot experiment;

[0048] Figure 18 It is a graph showing the root growth effect of Variovorax sp. LN-R-6 on wheat plants in a pot experiment;

[0049] Figure 19 It is a radar chart showing the results of the root scanning of wheat plants by Variovorax sp. LN-R-6 in a pot experiment;

[0050] Figure 20 It is a graph showing the effect of Variovorax sp. LN-R-6 on the plant height, stem diameter and SPAD value of maize in a field experiment;

[0051] Figure 21 It is a graph showing the effect of Variovorax sp. LN-R-6 on the nitrogen accumulation and potassium accumulation in the stem of maize in a field experiment;

[0052] Figure 22 It is a graph showing the effect of Variovorax sp. LN-R-6 on the nitrogen accumulation and potassium accumulation in the leaves of maize in a field experiment;

[0053] Figure 23 It is a graph showing the effect of Variovorax sp. LN-R-6 on the number of grains per ear of maize in a field experiment;

[0054] Figure 24 It is a graph showing the effect of Variovorax sp. LN-R-6 on the 100-grain weight of maize in a field experiment. Detailed implementation mode

[0055] The present invention provides a strain of Variovorax sp. LN-R-6, and the preservation number of the Variovorax sp. LN-R-6 is CGMCC NO. 33128.

[0056] In this invention, the inbred maize line Xu 178 at the silking stage was used as the experimental material, and its roots were collected and used as the isolation material for root endophytic bacteria after surface disinfection. The isolated bacteria were screened and identified to obtain the strain LN-R-6 with strong abilities such as nitrogen fixation, phosphorus solubilization, potassium solubilization, salt and alkali tolerance, and IAA production; the strain LN-R-6 could still maintain stable excellent genetic traits after 3 generations of purification. The strain LN-R-6 was taxonomically identified to be Variovorax sp.

[0057] The cells of the Variovorax sp. strain LN-R-6 provided by this invention are light yellow, and the colonies are round, smooth and moist on the surface.

[0058] The Variovorax sp. LN-R-6 provided by this invention is capable of nitrogen fixation. Through the double antibody one-step sandwich enzyme-linked immunosorbent assay (ELISA), it was detected that the nitrogenase activity of the Variovorax sp. LN-R-6 reached 275.70 U / L, indicating strong nitrogen fixation ability.

[0059] The Variovorax sp. LN-R-6 provided by this invention has the abilities of phosphorus solubilization, potassium solubilization, siderophore production and IAA production, and can promote the growth of plants.

[0060] The Variovorax sp. LN-R-6 provided by this invention is salt and alkali tolerant. The results of the examples of this invention show that the Variovorax sp. LN-R-6 can grow normally in a medium with a NaCl concentration ≤ 70 g / L and can grow normally in a medium with a pH of 12.

[0061] The Variovorax sp. LN-R-6 provided by this invention can highly degrade the alkalinity in the environment. The results of the examples of this invention show that the Variovorax sp. LN-R-6 can degrade the alkalinity in the culture environment, reduce the pH value of the culture environment, and as the pH of the liquid medium environment changes, the stronger the alkalinity of the environment where the Variovorax sp. LN-R-6 is located, the stronger its ability to degrade alkali.

[0062] The Variovorax sp. LN-R-6 provided by this invention can improve the soil aggregate structure, which is beneficial to improving the soil structure and promoting plant growth.

[0063] This invention provides a microbial preparation, including any one or more of the Variovorax sp. LN-R-6, the bacterial suspension of the Variovorax sp. LN-R-6 and the fermentation broth of the Variovorax sp. LN-R-6 described in the above technical solution. In this invention, the viable bacteria of the Variovorax sp. LN-R-6 in the microbial preparation ≥ 10 8 cfu / g or ≥ 10 8 cfu / mL.

[0064] The present invention provides a method for preparing the microbial agent described in the above technical solution, including:

[0065] Culturing the bacterium Lysobacter sp. LN-R-6 in a culture medium to obtain a microbial agent.

[0066] The present invention has no special limitation on the method for culturing the bacterium Lysobacter sp. LN-R-6, and any conventional culturing method in the art can be used to enable the normal growth of Lysobacter sp. LN-R-6. As an optional embodiment of the present invention, the culture medium is LB medium. As an optional embodiment of the present invention, the culturing temperature can be 28-30 °C, or 29 °C; oscillation can be accompanied during the culturing process; the rotation speed of the oscillation can be 180-220 rpm, or 180, 190, 200, 210, or 220 rpm; the culturing time can be 1-4 d, or 1, 2, 3, or 4 d. The present invention obtains a fermentation broth of Lysobacter sp. LN-R-6 through the culturing.

[0067] After obtaining the fermentation broth of Lysobacter sp. LN-R-6, the present invention preferably further includes obtaining bacterial cells by centrifuging the fermentation broth of Lysobacter sp. LN-R-6. The present invention has no special limitation on the centrifugation method, and any conventional centrifugation method in the art can be used. After obtaining the bacterial cells, the present invention preferably resuspends the bacterial cells with sterile water to obtain a bacterial suspension of Lysobacter sp. LN-R-6. The present invention preferably adjusts the viable count in the bacterial suspension of Lysobacter sp. LN-R-6 to ≥ 10 8 CFU / mL, which can be 1×10 8 ~9×10 8 CFU / g, or 1×10 8 CFU / mL. The bacterial suspension of Lysobacter sp. LN-R-6 obtained by the present invention can be directly used as a microbial agent; the fermentation broth of Lysobacter sp. LN-R-6 can also be directly used as a microbial agent.

[0068] The microbial agent provided by the present invention can be used as a microbial fertilizer to promote plant growth. As an optional embodiment of the present invention, the plants include crops; the crops include corn and / or wheat. The results of the examples of the present invention show that the microbial agent can promote the growth of the above-ground part of corn, increase the plant height, above-ground fresh weight, above-ground dry weight, above-ground nitrogen accumulation, above-ground phosphorus accumulation, and above-ground potassium accumulation of corn; the microbial agent can promote the growth of corn roots, increase the root length, root surface area, root diameter, root volume, root tip number, and root bifurcation number of corn, and increase the yield of corn. The results of the examples of the present invention show that the microbial agent can promote the growth of the above-ground part of wheat, increase the plant height, above-ground fresh weight, above-ground dry weight, above-ground nitrogen concentration, above-ground nitrogen accumulation, above-ground phosphorus accumulation, and above-ground potassium accumulation of wheat; the microbial agent can promote the growth of wheat roots, increase the root length, root surface area, root diameter, root volume, root tip number, and root bifurcation number of wheat, thereby being beneficial to increasing the yield of wheat.

[0069] The present invention provides a microbial bacterial fertilizer, the raw materials of which include: the phagocytic bacterium LN-R-6 and straw described in the above technical solution. As an optional embodiment of the present invention, the straw includes wheat straw. In the examples of the present invention, in order to better verify that the phagocytic bacterium LN-R-6 can be used to degrade straw and improve fertilizer efficiency, sterile straw was used for corresponding effect verification.

[0070] The present invention provides a preparation method of the microbial bacterial fertilizer described in the above technical solution, including the following steps:

[0071] Inoculate the phagocytic bacterium LN-R-6 bacterial suspension into a fermentation substrate containing straw and perform fermentation culture to obtain a microbial bacterial fertilizer.

[0072] In the present invention, the preparation method of the phagocytic bacterium LN-R-6 bacterial suspension is the same as the preparation method of the above microbial agent. As an optional embodiment of the present invention, the viable count of the phagocytic bacterium LN-R-6 bacterial suspension ≥ 1×10 8 CFU / mL, and it can also be 1×10 8 CFU / mL.

[0073] As an optional embodiment of the present invention, the fermentation substrate includes straw. By mass, the mass portion of straw in the fermentation substrate can be 250 parts. In the present invention, the fermentation substrate also includes water; the water is preferably sterile water. In the present invention, based on the mass portion of straw, the mass portion of water in the fermentation substrate can be 100 parts.

[0074] As an alternative embodiment of the present invention, when inoculating the suspension of Lysobacter LN-R-6, the mass-volume ratio of the suspension of Lysobacter LN-R-6 to the straw can be 10 mL: 250 g. After inoculation, the present invention conducts fermentation culture. In the present invention, the temperature of the fermentation culture can be 28 - 30 °C, or can be 28 °C, 29 °C or 30 °C. In the present invention, the time of the fermentation culture can be 14 d. After the fermentation culture is completed, the present invention obtains the microbial fertilizer.

[0075] The microbial fertilizer provided by the present invention can promote plant growth. When applying the microbial fertilizer of the present invention, it is preferably applied near the roots of plants. As an alternative embodiment of the present invention, the microbial fertilizer can be applied during the jointing stage of corn; the application rate of the microbial fertilizer can be 100 g / m 2 . As an alternative embodiment of the present invention, the plant can include corn. The results of the examples of the present invention show that the microbial fertilizer can significantly increase the plant height of corn in a high-nitrogen environment, increase the nitrogen accumulation and potassium accumulation in both high-nitrogen and low-nitrogen environments, increase the number of grains per ear and 100-grain weight of corn, and thus increase the yield of corn.

[0076] The present invention provides the application of the Lysobacter LN-R-6 described in the above technical solution, the microbial preparation described in the above technical solution, or the microbial fertilizer described in the above technical solution in any one or more of the following (1) - (4):

[0077] (1) Nitrogen fixation;

[0078] (2) Promoting plant growth;

[0079] (3) Degrading alkalinity in the environment;

[0080] (4) Improving soil aggregate structure.

[0081] The Lysobacter LN-R-6 provided by the present invention can fix nitrogen. Through detection, the nitrogenase activity of the Lysobacter LN-R-6 of the present invention reaches 275.70 U / L, and the nitrogen fixation ability is strong.

[0082] The provided Phagocytotic Bacterium LN-R-6 of the present invention can promote plant growth. As an alternative embodiment of the present invention, the plants include crops; the crops include corn and / or wheat. In the present invention, the promotion of plant growth includes promoting the growth of the above-ground part of the plant and / or promoting the growth of the plant roots. As an alternative embodiment of the present invention, the promotion of the growth of the above-ground part of the plant includes increasing any one or more of plant height, above-ground fresh weight, above-ground dry weight, above-ground nitrogen concentration, above-ground potassium concentration, above-ground phosphorus concentration, above-ground nitrogen accumulation, above-ground phosphorus accumulation, and above-ground potassium accumulation. As an alternative embodiment of the present invention, the promotion of the growth of the plant roots includes increasing any one or more of root length, root surface area, root diameter, root volume, number of root tips, and number of root forks.

[0083] The provided Phagocytotic Bacterium LN-R-6 of the present invention can degrade alkalinity in the environment. The results of the examples of the present invention show that the Phagocytotic Bacterium LN-R-6 can degrade the alkalinity in the culture environment, reduce the pH value of the culture environment, and as the pH of the liquid culture medium environment changes, the stronger the alkalinity of the environment where the Phagocytotic Bacterium LN-R-6 is located, the stronger its ability to degrade alkali.

[0084] The provided Phagocytotic Bacterium LN-R-6 of the present invention can improve the soil aggregate structure. The results of the examples of the present invention show that the Phagocytotic Bacterium LN-R-6 can change the distribution of the soil aggregate structure, increase the content of the soil with a particle size of 0.053 - 0.25 mm, and improve the soil structure.

[0085] The present invention provides a method for promoting plant growth, including:

[0086] Applying the microbial preparation described in the above technical solution and / or applying the microbial fertilizer described in the above technical solution during plant planting;

[0087] Applying the microbial preparation described in the above technical solution and / or applying the microbial fertilizer described in the above technical solution near the roots during the plant growth stage.

[0088] The present invention has no special limitations on the application method and application timing of the microbial preparation and the microbial fertilizer, and any conventional application method and application timing in the art can be adopted.

[0089] As an alternative embodiment of the present invention, the microbial preparation can be applied when planting plant seeds; the application amount is 20 mL per seed. As an alternative embodiment of the present invention, the microbial fertilizer can be applied at the jointing stage, and the application amount of the microbial fertilizer can be 100 g / m 2. In the present invention, the plant includes crops; the crops include corn and / or wheat; the corn includes Zhengdan 958 and / or MY73 corn; the wheat includes Bainong 307.

[0090] To further illustrate the present invention, the technical solutions provided by the present invention will be described in detail below in conjunction with the drawings and embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0091] The composition of the culture medium used in the examples is as follows:

[0092] The following 1)-4) are the corresponding liquid culture medium formulations, and 15 g / L agar needs to be added to the solid culture medium on this basis.

[0093] 1) Ashby nitrogen-free medium: 5 g of mannitol, 5 g of glucose, 0.2 g of potassium dihydrogen phosphate, 0.2 g of magnesium sulfate, 0.2 g of sodium chloride, 0.3 g of potassium sulfate, 5 g of calcium carbonate, add distilled water to 1000 mL. After adjusting the pH value to 7.0, perform sterilization treatment at 115 °C for 30 min.

[0094] 2) LB medium: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride, and add distilled water to 1000 mL. After adjusting the pH value to 7.0, perform sterilization at 121 °C for 30 min.

[0095] 3) Inorganic phosphorus medium: 10 g of glucose, 0.5 g of ammonium sulfate, 0.3 g of sodium chloride, 0.3 g of magnesium sulfate heptahydrate, 0.03 g of manganese sulfate monohydrate, 0.3 g of potassium sulfate, 0.03 g of ferrous sulfate heptahydrate, 5 g of calcium phosphate dihydrate. Make up to 1000 mL with distilled water. After adjusting the pH value to 7.0, sterilize at 115 °C for 30 min.

[0096] 4) Organic phosphorus medium: 10 g of glucose, 0.5 g of ammonium sulfate, 0.5 g of yeast extract powder, 0.3 g of sodium chloride, 0.3 g of potassium chloride, 0.3 g of magnesium sulfate, 0.03 g of ferrous sulfate, 0.03 g of manganese sulfate, 0.2 g of lecithin, 1 g of calcium carbonate. Make up the volume to 1000 mL with distilled water and adjust the pH value to 7.0. Perform sterilization treatment twice at 115 °C for 30 min.

[0097] 5) Modified Aleksandrov medium: 5 g of glucose, 0.5 g of magnesium sulfate heptahydrate, 0.005 g of ferric chloride, 0.1 g of calcium carbonate, 2 g of calcium phosphate, 3 g of potassium-containing mineral, 20 g of agar, 0.1 g of bromothymol blue. Add distilled water to 1000 mL and adjust the pH value to 7.0. Sterilize at 115 °C for 30 min.

[0098] 6) CAS medium: The formula consists of 60.5 mg of chrome azurol S (CAS), 72.9 mg of cetyltrimethylammonium bromide (DTA), 2.64 mg of ferric chloride hexahydrate, 295.25 mg of sodium dihydrogen phosphate dihydrate, 1213.5 mg of disodium hydrogen phosphate dodecahydrate, 125 mg of ammonium chloride, 37.5 mg of potassium dihydrogen phosphate, and 62.5 mg of sodium chloride. At the same time, 9 g of agar is added and distilled water is added to 1000 mL, and the pH value is adjusted to 7.0. Sterilization treatment is carried out at 115 °C for 30 min.

[0099] The overall research idea and technical route of the present invention are as Figure 1 shown.

[0100] Example 1 Isolation and purification of Variovorax LN-R-6.

[0101] 1 Test materials Sample source and treatment

[0102] Weigh 5 g of the roots of inbred maize Xu178 at the silking stage under high and low nitrogen treatments respectively, rinse them thoroughly with sterile water, and perform surface sterilization. The surface sterilization steps are as follows: 1) soak in sterile water for 1 min; 2) soak in 70% ethanol for 3 min; 3) soak in 2.5% sodium hypochlorite for 10 min; 4) rinse with 70% ethanol for 30 s; 5) rinse with sterile water 5 times. After taking out, dry it with sterile absorbent paper, suck 120 μL of sterile water and wash it on the surface of the plant, let it flow into the LB medium, coat and culture it, and detect the sterilization effect. After ensuring its surface is sterile, carry out screening.

[0103] 2. Screening of nitrogen-fixing microorganisms

[0104] Cut the surface-sterilized root samples carefully into small pieces about 0.5 cm long with sterile scissors, add a little sterile water and grind them with a sterile mortar, suck 1 mL of the grinding liquid and transfer it to a centrifuge tube containing 9 mL of sterile water, and mix it to obtain a suspension with an initial concentration of 10 -1 . To obtain suspensions with different concentrations, further dilute it to 10 -5 times.

[0105] Precisely suck 100 μL of the diluted liquid of each concentration after dilution with a pipette gun, and then inject it into different culture plates respectively. To ensure that the bacterial liquid is evenly distributed on the plate, use a spreader to carry out careful spreading operations. Repeat this step three times for the diluted liquid of each concentration to ensure the reliability and accuracy of the experiment.

[0106] Finally, place these culture plates in an incubator set at 30°C for cultivation to observe the growth of microorganisms. Based on the colony diameter and colony quantity, select the dominant colonies, including strain LN-R-6. After purifying it by streak plate method for 3 generations, inoculate it into liquid LB medium for preservation.

[0107] 1) Inoculation and cultivation of strain LN-R-6: Continuously streak and inoculate the strain to be tested on an LB plate, and incubate it at a constant temperature of 28°C for 2 days. Pick well-grown single colonies and transfer them to liquid LB medium for further cultivation for 10 h to enrich the target strain. Observe the colony and cell morphology of strain LN-R-6, and it is found that the cells of the strain LN-R-6 are light yellow, and the colonies are round, smooth, and moist on the surface.

[0108] 2) DNA extraction: Pipette 1 mL of the bacterial liquid on a laminar flow bench and transfer it to a 1.5 mL centrifuge tube. At room temperature, centrifuge at a speed of 12,000 rpm for 1 min to precipitate the bacterial cells. Carefully pour off the supernatant, then add 200 μL of ddH 2 O, gently mix to resuspend the bacterial cells. Place the resuspended bacterial liquid in a boiling water bath or metal bath at 100°C and heat for 10 min. Centrifuge again at 12,000 rpm for 1 min at room temperature to collect the DNA in the supernatant. Transfer the supernatant to a new sterile centrifuge tube and store it at -20°C for subsequent experiments.

[0109] 3) PCR amplification of DNA: Use the universal bacterial primers 27F as shown in SEQ ID NO.1, specifically: AGAGTTTGATCCTGGCTCAG, and 1492R as shown in SEQ ID NO.2, specifically: TACGGCTACCTTGTTACGACTT, to perform PCR amplification on the extracted DNA. The expected amplified fragment size is approximately 1500 bp. The PCR amplification program is set as follows: pre-denaturation at 94°C for 5 min, then 30 cycles in the order of denaturation at 94°C for 1 min, annealing at 56°C for 30 s, and extension at 72°C for 90 s. Finally, perform a final extension at 72°C for 10 min and store the amplification product at 4°C.

[0110] 4) Detection and sequencing of the amplification product: Detect the quality and size of the PCR amplification product by agarose gel electrophoresis technology. The specific operation is as follows: Take 5 μL of the PCR product and mix it with 1% agarose gel, and perform electrophoresis at a voltage of 120 V for 25 min. After electrophoresis, use a gel imaging system to observe the electrophoresis results.

[0111] If the target band is observed to be single and clear, it indicates that the PCR amplification is successful and meets the sequencing requirements. The PCR product is sent to Wuhan Aoke Dingsheng Biotechnology Co., Ltd. for sequencing analysis. Its base sequence is shown in SEQ ID NO.3, specifically:

[0112]

[0113] Compare the sequencing results in databases such as NCBI, and use software such as MAGA11 to draw a phylogenetic tree to analyze the taxonomic status and genetic relationship of the strains to be tested. The phylogenetic tree of the strain LN-R-6 is shown as Figure 2 follows. Analysis shows that the strain LN-R-6 belongs to the genus Variovorax of the family Comamonadaceae in the phylum Bacteroidetes. The strain LN-R-6 is a Variovorax bacterium, classified and named as Variovorax sp., and was deposited in the China General Microbiological Culture Collection Center on December 19, 2024, with the deposit number: CGMCC NO.33128.

[0114] Example 2 Study on the characteristics of nitrogen-fixing bacteria

[0115] 1. Nitrogen-fixing ability of the strain

[0116] (1) Qualitative determination of nitrogen-fixing ability

[0117] Streak the strain to be tested on Ashby nitrogen-free medium and culture it at 28 °C for 24 h. If the bacteria can grow normally, it is considered to have nitrogen-fixing activity.

[0118] Under the conditions of Ashby nitrogen-free medium and cultured at 28 °C for 24 h, the strain showed normal growth. Therefore, it can be determined that it has nitrogen-fixing activity. The qualitative identification shows that the Variovorax LN-R-6 has nitrogen-fixing ability as Figure 3 follows.

[0119] Next, place the coated petri dish in an incubator with a constant temperature set at 30 °C and culture it in an inverted manner for 24 h. During this culture process, the Variovorax LN-R-6 will form typical single colonies on the medium. Then, through multiple plate purification processes, ensure the purity of the colonies for subsequent experiments.

[0120] (2) Quantitative determination of nitrogen-fixing ability

[0121] First, inoculate the target strain into LB liquid medium. After culturing at 28 °C for 24 h, adjust the OD 600 to

[0122] 1.0. Use a kit to detect the nitrogenase activity of the isolated nitrogen-fixing bacteria through a double-antibody one-step sandwich enzyme-linked immunosorbent assay (ELISA) (the kit is purchased from Shanghai Yuanju Company, model number YJ729304).

[0123] Quantitatively determine the nitrogen-fixing ability of Variovorax LN-R-6. Inoculate the nitrogen-fixing bacteria into LB liquid medium and measure the OD 600Adjust it to 1.0. The double-antibody one-step sandwich ELISA kit was used for detection. The nitrogenase activity of nitrogen-fixing bacteria was detected, and the results showed that the nitrogenase activity of Variovorax LN-R-6 reached 273.70 U / L, indicating a strong nitrogen-fixing ability.

[0124] 2. Phosphate-solubilizing ability of the strain

[0125] (1) Qualitative determination of phosphate-solubilizing ability

[0126] The tested strains were inoculated onto solid media containing organic phosphorus and inorganic phosphorus respectively. Then, they were cultured at a constant temperature of 28 °C for 4 days. After the culture, carefully observe the growth of the strains on the media, especially pay attention to the formation of a transparent phosphate-solubilizing circle, which is used as an index to evaluate the phosphate-solubilizing ability of the strains.

[0127] The monoclonal of Variovorax LN-R-6 was inoculated onto solid media containing organic phosphorus and inorganic phosphorus and cultured at 28 °C for 4 days. It was found that transparent phosphate-solubilizing circles appeared for both strains, proving that strain LN-R-6 has the ability to dissolve organic phosphorus and inorganic phosphorus. Qualitative identification showed that Variovorax LN-R-6 has the ability to dissolve organic phosphorus as shown in Figure 4 A in Figure 4 ; Qualitative identification showed that Variovorax LN-R-6 has the ability to dissolve inorganic phosphorus as shown in

[0128] (2) Quantitative determination of phosphate-solubilizing ability

[0129] The monoclonal of the tested strain was inoculated into liquid media containing organic phosphorus and inorganic phosphorus and cultured at 28 °C for 2 days. The phosphate-solubilizing ability was determined by the molybdenum antimony anti-colorimetric method.

[0130] Preparation of molybdenum antimony anti-solution:

[0131] a. Dissolve 0.5 g of potassium antimony tartrate (K(SbO)C 4 H 4 O 6 ) in 100 mL of deionized water to obtain solution a.

[0132] b. Dissolve 10 g of ammonium molybdate ((NH 4 ) 6 Mo 7 O 24 ·4H 2 O) in 400 mL of deionized water, then gradually add 153 mL of concentrated sulfuric acid while stirring constantly. Subsequently, add the previously prepared solution a to this solution and continue stirring until evenly mixed, and finally make up the volume to 1 L.

[0133] Adjustment before use: Before use, weigh 1.5 g of ascorbic acid, dissolve it in 100 mL of molybdenum antimony anti-solution, and mix well.

[0134] Preparation of phosphorus standard solution:

[0135] Weigh potassium dihydrogen phosphate and prepare a phosphorus standard solution with a concentration of 50 mg / L. Next, dilute it to a diluted solution with a concentration of 5 mg / L.

[0136] Respectively pipette 0, 1, 2, 3, 4, 5 mL of 5 mg / L phosphorus solution, add 5 mL of molybdenum antimony anti-solution, and make up the volume to 50 mL for preparing the standard solution. The phosphorus concentration in the solution is 0.1, 0.2, 0.3, 0.4, 0.5 mg / L.

[0137] Quantitatively determine the phosphorus solubilizing ability of the bacterium LN-R-6. Monoclonalize the strain to be tested in organic phosphorus and inorganic phosphorus liquid media, and use the molybdenum antimony anti-colorimetric method to determine its phosphorus solubilizing ability. The results show that after the strain is cultured, the phosphorus concentration in the organic phosphorus medium can reach 14.44 mg / L, and the phosphorus concentration in the inorganic phosphorus medium can reach 1.80 mg / L.

[0138] 3. Potassium solubilizing ability of the strain

[0139] (1) Qualitative determination of potassium solubilizing ability

[0140] Monoclonalize the strain to be tested in the modified Aleksandrov medium and culture it at 28 °C for 4 days. If the strain can grow normally and has a yellow halo, it has the potassium solubilizing ability.

[0141] Monoclonalize the bacterium LN-R-6 to the Aleksandrov medium and culture it at 28 °C for 4 days. It is found that the strain can grow normally and has a yellow halo. Therefore, it is proved that the bacterium LN-R-6 has the potassium solubilizing ability. The qualitative identification of the strain with potassium solubilizing ability is as shown in Figure 5 A in

[0142] (2) Quantitative determination of potassium solubilizing ability

[0143] Adopt atomic absorption flame spectrophotometry to quantitatively determine the potassium solubilizing ability of the strain. First, inoculate the strain to be tested into the modified Aleksandrov liquid medium at an inoculation amount of 1%, and culture it in an environment with a constant temperature of 28 °C for 2 days to observe the growth situation. At the same time, set up a control group without inoculation as a blank reference. After the culture is completed, centrifuge at a speed of 10000 r / min for 10 min by a centrifuge to separate the supernatant, and use flame photometry to accurately determine the K + concentration in the supernatant.

[0144] To ensure the accuracy of the measurement, a potassium standard curve was prepared. The specific steps were as follows: 0.1907 g of KCl was accurately weighed and dissolved in 1 L of deionized water to obtain a potassium standard stock solution with a concentration of 100 mg / L. This standard curve will serve as an important reference basis for subsequent measurement processes.

[0145] 0, 5, 10, 15, 20, 25, and 30 mL of the potassium standard stock solution were pipetted and made up to 100 mL. The potassium concentrations were 0, 5, 10, 15, 20, 25, and 30 mg / L respectively. The calibration curve was measured using a flame photometer, starting from the lowest concentration.

[0146] The potassium-solubilizing ability of the bacterium Lysobacter gummosus LN-R-6 was quantitatively determined. The strain was inoculated in the modified Aleksandrov liquid medium for 2 days, and the non-inoculated sample served as the blank. After the cultivation, the potassium concentration was measured by flame photometry. The potassium concentration in this liquid medium could reach 0.90 mg / L, while the potassium concentration of the corresponding blank control was only 0.20 mg / L, indicating that the strain had a certain potassium-solubilizing ability. + concentration, and the potassium concentration in this liquid medium + could reach 0.90 mg / L. In contrast, the potassium concentration of the blank control + was only 0.20 mg / L, indicating that the strain had a certain potassium-solubilizing ability.

[0147] 4. Ability of the strain to produce siderophores

[0148] Qualitative determination: The universal CAS agar plate method proposed by Schwyn and Neilands is a widely accepted siderophore detection technique. The basic principle of this method is that siderophores can bind to the blue complex formed by chrome azurol S (CAS), hexadecyltrimethylammonium bromide (HDTMA), and iron ions. Through this binding, the iron ions originally bound to the complex are "hijacked". This reaction causes a significant change in the color of the medium around the colony, gradually changing from the initial blue to orange-yellow, thus forming an obvious siderophore secretion ring. The appearance of this phenomenon can help determine whether the strain has the ability to produce siderophores.

[0149] The strain to be tested was monocloned into the CAS medium and cultured at 28 °C for 24 h. If the strain could grow normally and had an orange halo, it had the ability to produce siderophores.

[0150] Lysobacter gummosus LN-R-6 was monocloned into the CAS medium and cultured at 28 °C for 24 h. The results showed that the medium outside the bacterium changed from blue to orange, and there was a siderophore secretion ring. Lysobacter gummosus LN-R-6 had the ability to produce siderophores as shown in Figure 5 B in the figure.

[0151] 5. Determination of the IAA-producing ability of the strain

[0152] Using spectrophotometry, the indole-3-acetic acid (IAA) secreted by the strain was quantitatively analyzed. The operation process was as follows: 1% of the test strain was added to the LB culture medium containing 0.1 g / L tryptophan, and cultured at 28 °C for 2 days. The culture without bacteria was used as the blank. After the culture was completed, an equal volume of Salkowski colorimetric solution was added. The pink color of the solution proved that the strain had the ability to produce IAA.

[0153] After the culture was completed, the absorbance (OD 600 ) of the bacterial solution was measured, and then centrifuged at a speed of 10,000 r / min for 10 min to obtain the supernatant. Then, for subsequent analysis, the supernatant and Salkowski colorimetric agent were uniformly mixed in an exact ratio of 1:1 by volume. After standing for 30 min in the dark, finally, the OD 530 value of the mixed solution was measured, and the content of indole-3-acetic acid in the fermentation broth per unit volume after 48 h of bacterial culture was calculated to evaluate the yield of IAA. Standard curve: Prepare gradient dilution solutions composed of analytically pure indole-3-acetic acid, namely indole-3-acetic acid solutions with contents of 0, 5, 10, 15, 20, 30, 40, 50 mg / L, mix them with an equal volume of Salkowski colorimetric solution, mix well, react in the dark for 30 min, and measure the absorbance at 530 nm. Draw the standard curve. Measure the absorbance at 530 nm of the strain that turned pink, and substitute it into the standard curve to calculate the amount of IAA produced.

[0154] After 48 h of bacterial culture, the content of indole-3-acetic acid in the fermentation broth per unit volume of the bacterium Lysobacter sp. LN-R-6 can reach 24.04 mg / L.

[0155] 6. Determination of the salt and alkali tolerance ability of the strain

[0156] Determination of salt tolerance ability: The test strain was inoculated at an inoculation amount of 1% into LB liquid medium with different NaCl concentrations of 10, 30, 50, 70, 90 g / L at pH 7, and cultured at 28 °C and 200 r / min for 24 h, and the OD 600 after culture was measured, and the results are shown in Table 1.

[0157] Table 1 Salt tolerance ability of Lysobacter sp. LN-R-6

[0158]

[0159] The strain has strong salt tolerance within a certain range of NaCl concentration. For example, Figure 6 and Table 1 both show that the activity is stronger when the NaCl concentration in the solution is lower than 70 g / L, and when it exceeds 70 g / L, the bacterium is difficult to grow.

[0160] 7. Determination of the alkali degradation ability of the strain

[0161] The test strain was inoculated into LB liquid medium with pH values of 8, 9, 10, 11, and 12 at an inoculation amount of 1%, and the pH after culturing at 28°C for 24 h was measured. μ = (pH before - pH after) / pH before * 100%. The pH of the bacterial liquid measured after 24 h and the ability of the test strain to degrade alkali are shown in Table 2.

[0162] Table 2 Ability of bacterium LN-R-6 to degrade alkali

[0163]

[0164]

[0165] As can be seen from Table 2, bacterium LN-R-6 has a certain ability to degrade alkali. After culturing for a period of time, the pH of the liquid medium environment changes. The stronger the alkalinity of the environment where bacterium LN-R-6 is located, the stronger its ability to degrade alkali.

[0166] 8. Evaluation of the effect of the strain on the reshaping of soil aggregate structure

[0167] Bacterium LN-R-6 was cultured in LB medium at 28°C for 24 h to obtain the bacterial liquid of bacterium LN-R-6. After the cultured bacterium liquid was centrifuged at high speed, the supernatant was discarded, and sterile water was added to resuspend it to prepare a bacterial suspension for subsequent experiments, with a concentration of 10 8 cfu / g. After the soil passed through a 100-mesh sieve, it was sterilized at high temperature. A culture dish with a diameter of 9 cm was used as the culture container. 15 g of soil was accurately added to each culture dish and 5 mL of the bacterial liquid was inoculated. Sterile water of the same amount was used as the control. Five replicates were set for each batch to ensure that the water content in each culture dish was equal, and they were placed in a constant temperature incubator. After 30 days of growth, the wet sieving method was used for measurement.

[0168] In this experiment, the soil sample was placed on a set of sieves with different pore sizes (2 mm, 0.25 mm, 0.053 mm) and oscillated and sieved on a specific sieve shaker at a certain rotation speed and time, and the soil aggregates were divided into different levels according to the particle size. The changes in the soil aggregate structure caused by bacterium LN-R-6 are shown in Table 3 and Figure 7 as shown. Different letters in the figure indicate significant differences, that is, P < 0.01.

[0169] Table 3 Changes in the soil aggregate structure caused by bacterium LN-R-6

[0170] Particle size CK LN-R-6 0.25 - 2mm 0.047±0.0116 0.040±0.01 0.053 - 0.25mm 10.70±0.5481 11.37±0.1901 <0.053mm 3.68±0.4800 3.03±0.2250

[0171] The sample used in this experiment was the soil that had passed through a 100-mesh sieve and was sterilized at high temperature. It was found during the measurement that there was no soil with a particle size greater than 2 mm. As Figure 7And Table 3 shows that among the three particle size grades of screening, it is found that the soil in the 0.053 - 0.25 mm particle size grade in the inoculated treatment increases, showing a significant difference compared with the control. This proves that the inoculated strain changes the distribution of soil aggregate structure. This bacterium improves the soil structure by increasing the content of soil in the 0.053 - 0.25 mm particle size grade, thereby promoting the growth of plants.

[0172] Example 3 Evaluation of the growth promotion effect of nitrogen-fixing bacterium LN-R-6 on seedlings

[0173] 1. Test method

[0174] (1) Preparation of microbial agent

[0175] The bacterium Variovorax paradoxus LN-R-6 was cultured in LB medium at 28 °C for 24 h to obtain the Variovorax paradoxus LN-R-6 bacterial liquid. After the cultured Variovorax paradoxus bacterial liquid was centrifuged at high speed, the supernatant was discarded, and sterile water was added to resuspend it to prepare a bacterial suspension for subsequent tests. The concentration was 10 8 cfu / g, as the microbial agent.

[0176] (2) Take 660 g of the tested soil after sieving and sterilization and put it into pots. The variety used in this study is maize Zhengdan 958. First, disinfect the surface of the maize, and then ensure its cleanliness by rinsing it with sterile water multiple times. Then, through two days of germination treatment, seeds with strong germination consistency were selected. One maize seed was planted in each pot, and 20 mL of the microbial agent prepared in step (1) was added to each pot. Equal amounts of sterile water were used as the control. Each batch was treated with six replicates to ensure that the water content in each pot was equal, and they were placed in a light incubator. Sampling was carried out after 30 days of growth. The plant height, fresh weight, dry weight, nitrogen, phosphorus and potassium accumulation in the plants, and root growth were measured. Nitrogen and phosphorus were determined by a flow analyzer, potassium was determined by flame photometry, and the root growth data was measured using a root scanner to investigate the growth promotion effect.

[0177] (3) Take about 660 g of the tested soil after sieving and sterilization and put it into pots. The variety used in this study is wheat Bainong 307. First, disinfect the surface of the wheat, and then ensure its cleanliness by rinsing it with sterile water multiple times. Then, through two days of germination treatment, three wheat seeds were planted in each pot. 20 mL of the microbial agent prepared in step (1) was added to each pot. Equal amounts of sterile water were used as the control. Each batch was treated with six replicates to ensure that the water content in each pot was equal, and they were placed in a light incubator. Sampling was carried out after 30 days of growth. The plant height, fresh weight, dry weight, nitrogen, phosphorus and potassium accumulation in the plants, and root growth were measured. The measurement methods were the same as above to investigate the growth promotion effect.

[0178] 2. Test results

[0179] (1) Evaluation of the growth promotion effect of corn potted plants

[0180] Table 4 Growth promotion effect of Phagocytophaga LN-R-6 on the aboveground part of corn

[0181] Index CK LN-R-6 Plant height (cm) 41.00±1.0000 46.77±4.8232 Fresh weight of corn (g) 3.21±0.0945 4.20±0.1000 Dry weight of corn (g) 0.51±0.0135 0.60±0.0143 N concentration in aboveground part (mg / g) 15.50±0.6887 15.32±1.5184 P concentration in aboveground part (mg / g) 2.95±0.2145 3.35±0.0105 K concentration in aboveground part (mg / g) 15.82±0.6056 16.04±0.6401 N accumulation in aboveground part (mg) 44.56±11.2950 68.81±5.1812 P accumulation in aboveground part (mg) 9.11±2.7836 16.42±2.2993 K accumulation in aboveground part (mg) 37.49±10.6012 75.69±4.5713

[0182] In the experimental group added with Phagocytophaga LN-R-6, such as Figure 8 their plant heights are significantly higher than those of the control group in the two pots on the right.

[0183] It can be analyzed from Table 4 that after inoculating the potted plants with bacteria and sampling and measuring their plant heights, fresh weights, and dry weights 30 days after growth, as Figure 9 shown, compared with the blank control, the experimental groups added with microbial agents are higher than the control group in these aspects, and the differences are significant, proving that Phagocytophaga LN-R-6 can promote the growth of the aboveground part of corn. After drying the sampled plants of the potted plants, the nutrients of the aboveground part of the plants are measured, and the results are as Figure 10 shown. It is found that the experimental groups added with microbial agents are slightly higher than the control group in nitrogen and potassium concentrations, while the difference in phosphorus concentration is relatively large, but no significant difference is found after comparison. Further, the accumulation amounts of nutrients are calculated from the concentrations, as Figure 11 shown. It is found that in terms of the accumulation amounts of nitrogen, phosphorus, and potassium, the experimental groups added with microbial agents are significantly higher than the control group, and the differences are extremely significant. The specific data are shown in Table 4. It shows that Phagocytophaga LN-R-6 indeed promotes the growth of the aboveground part of corn.

[0184] Table 5 Influence of Phagocytophaga LN-R-6 on the root growth of corn plants

[0185]

[0186] For the underground part of corn plants, root scanning is carried out on them, as Figure 12 shown. It is found that the roots of the control group without adding microbial agents are not as developed as those of the experimental group added with microbial agents. The specific data are shown in Table 5, and the radar chart made from the results of root scanning is as Figure 13 shown. It can be seen more clearly that the experimental group added with microbial agents is higher than the control group in terms of root length, surface area, average diameter, root volume, number of root tips, number of bifurcations, etc. Among them, the differences in root surface area, average diameter, root volume, and number of root tips are significant. The results show that Phagocytophaga LN-R-6 has a growth promotion effect on the underground part of corn plants.

[0187] (2) Evaluation of the growth promotion effect of wheat potted plants

[0188] Table 6 Growth promotion effect of Phagocytophaga LN-R-6 on the aboveground part of wheat

[0189]

[0190]

[0191] The experimental group added with Bdellovibrio LN-R-6, such as Figure 14 Their plant heights were significantly higher than those of the control groups in the two pots on the right.

[0192] After inoculating the potted plants with bacteria and sampling and measuring their plant heights, fresh weights, and dry weights 30 days after growth, as shown in Table 6 and Figure 15 As shown, compared with the blank control, the experimental groups added with microbial agents were higher than the control groups in these aspects. Among them, the difference in plant height was significant, proving that Bdellovibrio LN-R-6 indeed had a growth-promoting effect on the above-ground part of wheat. After the sampled plants of the potted plants were dried, the nutrients in the above-ground parts of the plants were measured, and the results were as Figure 16 It was found that the experimental groups added with microbial agents were higher than the control groups in the concentrations of nitrogen, phosphorus, and potassium. Among them, the difference in the nitrogen concentration in the above-ground part was significant. Further, the accumulation amounts of nutrients were calculated from the concentrations, as Figure 17 As shown, it was found that in terms of the accumulation amounts of nitrogen, phosphorus, and potassium, the experimental groups added with microbial agents were significantly higher than the control groups, and the differences were extremely significant. The specific data are shown in Table 6. It shows that Bdellovibrio LN-R-6 indeed promoted the growth of the above-ground part of maize.

[0193] Table 7 Root growth of wheat plants

[0194]

[0195] For the underground parts of wheat plants, root scanning was performed on them, as Figure 18 It was found that the roots of the control groups without adding microbial agents were less developed than those of the experimental groups. The specific data are shown in Table 7. Radar charts were made from the results of root scanning, as Figure 19 As shown, it can be seen more clearly that the experimental groups added with microbial agents were higher than the control groups in terms of root length, surface area, average diameter, root volume, number of root tips, number of forks, etc. Among them, the differences in root length, surface area, root volume, number of root tips, and number of forks were significant. The results show that Bdellovibrio LN-R-6 also promoted the growth of the underground parts of wheat plants.

[0196] Example 4 Evaluation of the promotion effect of Bdellovibrio LN-R-6 on maize in field soil

[0197] 1. Test method

[0198] (1) Preparation of microbial bacterial fertilizer:

[0199] Inoculate Bdellovibrio LN-R-6 into LB liquid medium for liquid fermentation. The temperature of liquid fermentation is 28 - 30 °C, the rotation speed is 180 - 220 r / min, and the time is 24 h. After the liquid fermentation is completed, the bacterial liquid of Bdellovibrio LN-R-6 is obtained.

[0200] Centrifuge the bacterial suspension of Lysobacter sp. LN-R-6 to obtain bacterial cells, resuspend the bacterial cells with sterile water to obtain a bacterial suspension, and the bacterial content in the bacterial suspension is 1×10 8 CFU / mL, obtaining a bacterial suspension that can be used as a microbial agent.

[0201] Inoculate 10 mL of the bacterial suspension with a bacterial content of 1×10 8 CFU / mL into a sterile bag containing 250 g of sterile wheat straw and 100 g of sterile water for fermentation. The fermentation conditions are: temperature 30°C, fermentation time 14 d, obtaining a microbial fertilizer.

[0202] The field is divided into 4 plots, each plot is 5 m long and 3 m wide. The spacing between maize plants is 25 cm, and the row spacing is 60 cm. Respectively, for the high-nitrogen (HN) plots only adding sterile straw and water-retaining agent, the high-nitrogen (HN) plots applying microbial fertilizer, the low-nitrogen (LN) plots only adding sterile straw and water-retaining agent, and the low-nitrogen (LN) plots applying microbial fertilizer (hereinafter referred to as HNCK, HN+NFb, LNCK, LN+NFb respectively). The nitrogen application rate for the high-nitrogen treatment is: N 210 kg·ha -1 , and the application rates of phosphorus and potassium fertilizers are: P 2 O 5 and K 2 O are both 45 kg·ha -1 ; the nitrogen application rate for the low-nitrogen treatment is: N 0, and the application rates of phosphorus and potassium fertilizers are: P 2 O 5 and K 2 O are both 45 kg·ha -1 . In the field experiment, the method of simultaneous sowing of seed and fertilizer is adopted for planting. Before planting, collect the basic soil samples and measure their basic physical and chemical properties. Table 8 shows the basic physical and chemical properties of the field soil before planting (before fertilization). The field management is kept consistent. The maize variety used is MY73, and microbial fertilizer is added at the jointing stage of maize, and it is applied close to the maize roots, with an application amount of 100 g / m 2 . At the silking stage of maize, measure the plant height, stem diameter, biomass, nutrient accumulation amount and SPAD value, and measure the maize yield at the maturity stage (theoretical yield (kg / mu) = number of plants per mu * average number of ears per plant * number of grains per ear * 100-grain weight * 0.85 * 10 -5 ).

[0203] Table 8 Basic physical and chemical properties of field soil

[0204]

[0205] 2. Test results

[0206] Table 9 Effects of Different Treatments on Maize Growth

[0207] Treatment LNCK LN+NFb HNCK HN+NFb SPAD 38.05±4.99 42.4±3.57 38.95±4.33 38.92±2.89 Plant height (cm) 198.17±13.95 193.08±13.87 192.67±2.66 203.33±2.36 Stem diameter (cm) 14.91±2.13 17.46±1.072 18.95±1.18 19.29±1.76

[0208] As shown in Table 9 and Figure 20 as indicated, compared with CK, the SPAD value increased by 11.43% and the stem diameter increased by 17.13% under low nitrogen environment with the application of microbial fertilizer. Under high nitrogen environment with the application of microbial fertilizer, it can significantly promote the plant height of maize.

[0209] Table 10 Effects of Different Treatments on Nutrient Accumulation of Maize

[0210] Treatment LNCK LN+NFb HNCK HN+NFb N accumulation in stem part (mg) 262.16±22.61 443.55±73.70 648.33±110.32 751.32±103.77 K accumulation in stem part (mg) 942.03±84.22 1620.73±154.44 2383.50±441.46 2515.17±283.21 N accumulation in leaf part (mg) 134.90±2.49 291.53±35.32 340.39±20.52 407.81±22.03 K accumulation in leaf part (mg) 783.75±52.06 1010.26±230.27 1617.27±134.35 2286.92±186.85

[0211] The nitrogen and potassium nutrients of the samples taken were measured, and the stems and leaves of the above-ground parts of the plants were dried separately to measure their nutrients. As shown in Table 10 and Figures 21 - 22 as indicated, in the stems, the treatments with microbial fertilizer under high nitrogen and low nitrogen environments had increased nitrogen accumulation and potassium accumulation compared with their corresponding controls. Among them, there was no significant difference under high nitrogen environment, the difference in nitrogen accumulation was significant under low nitrogen environment, and the difference in potassium accumulation reached an extremely significant level. In the leaf part, the treatments with microbial fertilizer under high nitrogen and low nitrogen environments had increased nitrogen accumulation and potassium accumulation compared with their corresponding controls. Among them, the difference in nitrogen accumulation was significant, the difference in potassium accumulation was not significant under low nitrogen environment, and the difference was extremely significant under high nitrogen environment.

[0212] Table 11 Effects of Different Treatments on Maize Yield

[0213] Treatment Number of grains per ear 100-grain weight (g) Theoretical yield (kg / mu) LNCK 367.6±72.12 22.002±0.11 305.70 LN+NFb 455.6±97.20 24.148±0.27 415.83 HNCK 437.3±86.35 23.972±0.26 396.22 HN+NFb 507.6±91.67 25.402±0.22 487.35

[0214] At the maturity stage of maize, the yields of each treatment were measured. As shown in Table 11 and Figures 23 - 24 as indicated, the number of grains per ear increased in the treatments with high nitrogen And the treatment of adding microbial fertilizer in the low-nitrogen environment has a significant difference in 100-grain weight compared with its corresponding control. Applying microbial fertilizer compared with their corresponding controls, and the difference reached a significant level under low nitrogen environment. Under low nitrogen environment, the theoretical yield increased by 36.03% in the treatment with microbial fertilizer compared with its corresponding control. Under high nitrogen environment, the theoretical yield increased by 23.00% in the treatment with microbial fertilizer compared with its corresponding control. Field experiments showed that this microbial fertilizer can improve the nutrient accumulation and yield of maize to varying degrees in different nitrogen concentration environments and promote the growth of maize.

[0215] In summary, the phagocytic bacteria LN-R-6 provided by the present invention has the ability to fix nitrogen, dissolve phosphorus, dissolve potassium, produce IAA, produce siderophores and degrade the alkalinity of alkaline environments, and the difference is more obvious compared with the blank control, wherein the ability of the strain to fix nitrogen, dissolve phosphorus, dissolve potassium, produce siderophores and produce IAA promotes the growth of plants. The phagocytic bacteria LN-R-6 also has a certain ability to tolerate salt and alkali and degrade the alkalinity of the environment, which enables it to improve soil conditions while surviving in an alkaline environment, which is not only conducive to the growth of plants, but also provides help for the management of alkaline land. Potted experiments show that the strain has a significant growth-promoting effect on the growth of both host plants (corn) and non-host plants (wheat). In field experiments, it can also promote corn growth and increase its yield.

[0216] Although the above embodiment describes the present invention in detail, it is only a part of the embodiments of the present invention, not all of the embodiments. People can also obtain other embodiments based on this embodiment without creativity, and these embodiments all fall within the protection scope of the present invention.

Claims

1. A strain of Variovorax sp. LN-R-6, characterized in that: The deposit number of the phage LN-R-6 is CGMCC NO.33128.

2. A microbial preparation, characterized in that: It includes any one or more of the phage LN-R-6 described in claim 1, the bacterial suspension of phage LN-R-6 and the fermentation broth of phage LN-R-6.

3. The microbial preparation according to claim 1, characterized in that: The bacterial activity of the phage LN-R-6 in the microbial preparation is ≥10 8 cfu / g or ≥10 8 cfu / mL.

4. The method for preparing the microbial preparation according to claim 2 or 3, characterized in that: include: The phage LN-R-6 is cultured in a culture medium to obtain a microbial preparation.

5. The preparation method according to claim 4, characterized in that: The culture temperature is 28-32° C. The culture process is accompanied by shaking. The shaking speed is 180-220 rpm. The culture time is 1-4 days.

6. A microbial fertilizer, characterized in that: Ingredients include: The phage LN-R-6 and straw described in claim 1.

7. The method for preparing the microbial fertilizer according to claim 6, characterized in that: The following steps are involved: The bacterial suspension of the phagocytic bacterium LN-R-6 was inoculated into a fermentation matrix containing straw for fermentation culture to obtain a microbial fertilizer.

8. Use of the phage LN-R-6 according to claim 1, the microbial preparation according to claim 2 or 3, or the microbial fertilizer according to claim 6 in any one or more of the following (1) to (4): (1) Nitrogen fixation; (2) Promote plant growth; (3) Alkalinity in the degradation environment; (4) Improve soil aggregate structure.

9. The use according to claim 8, characterized in that: The plants include crop plants; the crop plants include corn and / or wheat.

10. A method for promoting plant growth, characterized in that: include: Applying the microbial preparation according to claim 2 or 3 and / or the microbial fertilizer according to claim 6 when planting plants; Alternatively, the microbial preparation according to claim 2 or 3 and / or the microbial fertilizer according to claim 6 are applied near the roots during the plant growth stage.

Images