Enterobacter hormaechei ZS01 and application thereof

Abstract

The invention discloses an enterobacter hormaechei ZS01 and application thereof, the enterobacter hormaechei ZS01 is preserved in the China Center for Type Culture Collection, the preservation number is CCTCC NO: M 2025313, and the nucleotide sequence of 16S rDNA of the enterobacter hormaechei ZS01 is as shown in SEQ ID NO: 1. The enterobacter hormaechei ZS01 obtained by the invention has high-concentration nicotine tolerance and excellent nicotine degradation capability, and the nicotine degradation efficiency can reach 98%. Meanwhile, the enterobacter hormaechei ZS01 also has certain potential application in the aspect of improving the quality of the flue-cured tobacco. Detection results show that the aroma substance content of tobacco leaves treated by the enterobacter hormaechei ZS01 can be increased by 50%-120%, and the enterobacter hormaechei ZS01 has good application prospects in nicotine degradation and development of low-nicotine and high-aroma tobacco products.

Description

Technical Field

[0001] The invention relates to the technical field of bioengineering, and in particular to a strain of Enterobacter hallii ZS01 and an application thereof. Background Art

[0002] As the world's understanding of the harm of smoking continues to deepen, low-nicotine, high-aroma tobacco products have gradually become a new trend in market demand. Nicotine is the most important and most abundant alkaloid in tobacco, and is closely related to the sensory quality of tobacco. In the traditional tobacco processing process, the nicotine content in tobacco leaves is relatively high, which not only poses a threat to consumers' health, but also limits the diversity and flavor of tobacco products. Therefore, how to effectively reduce the nicotine content in tobacco leaves while increasing the richness of its aroma substances has become a technical problem that the tobacco industry needs to solve urgently. Patent (CN119120308A) uses a composite microbial agent composed of a culture solution of Bacillus thuringiensis HNCS-93, a culture solution of Bacillus mucilaginosus NK-102, and a culture solution of Bacillus firmus SAB-1 to treat freshly cured tobacco leaves, which can effectively increase the content of total Maillard reactants and total free amino acids in tobacco leaves, reduce the content of starch, pectin, and lignin to improve the quality of freshly cured tobacco leaves; Patent (CN119162058A) uses a bacterial agent of Bacillus death valley S7 to treat tobacco leaves, which can inhibit mold in the leaves, reduce nicotine content, degrade the content of macromolecular compounds such as protein, cellulose, lignin, pectin, etc. in tobacco leaves, and improve the sensory quality of tobacco leaves. However, these studies are currently mainly focused on reducing the nicotine content in tobacco leaves, but have not effectively increased the aroma substances in tobacco leaves.

[0003] In this context, the use of microorganisms with strong degradation ability provides new ideas and methods for the degradation of nicotine. Studies have shown that some microorganisms can degrade nicotine through specific metabolic pathways, thereby achieving its biological removal. Therefore, exploring and applying microorganisms that can efficiently degrade nicotine in tobacco leaves will significantly improve the safety and flavor characteristics of tobacco products. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a strain of Enterobacter holmesii ZS01 and its application, aiming to solve the problem of high nicotine content and insufficient aroma substances in tobacco leaves in traditional tobacco processing. Enterobacter holmesii ZS01 is obtained by screening, and its characteristics of efficiently degrading nicotine and increasing the content of aroma substances in tobacco leaves are utilized, providing a new idea for the development of low-nicotine, high-aroma tobacco products.

[0005] The technical problem to be solved by the present invention is achieved through the following technical solutions:

[0006] An Enterobacter hormaechei ZS01, which is deposited in the China Center for Type Culture Collection with the deposit number CCTCC NO: M 2025313, and the nucleotide sequence of its 16S rDNA is shown in SEQ ID NO: 1.

[0007] A bacterial agent, which contains Enterobacter hormaechei ZS01, and the bacterial agent is prepared by the following method: inoculating Enterobacter hormaechei ZS01 into an LB liquid medium for culture to obtain a seed liquid, further expanding the culture of the seed liquid to obtain a fermentation liquid, centrifuging the fermentation liquid and collecting the thalli, and resuspending the thalli with deionized water to obtain the bacterial agent.

[0008] The application of an Enterobacter hormaechei ZS01 or a bacterial agent in improving the quality of tobacco leaves.

[0009] Preferably, in the above technical solution, the bacterial agent is prepared by the following method: inoculating Enterobacter hormaechei ZS01 into an LB liquid medium for culture to obtain a seed liquid, further expanding the culture of the seed liquid to obtain a fermentation liquid, centrifuging the fermentation liquid and collecting the thalli, and resuspending the thalli with deionized water to obtain the bacterial agent.

[0010] Preferably, in the above technical solution, the Enterobacter hormaechei ZS01 is used to degrade nicotine in tobacco leaves and increase the content of aroma substances.

[0011] Preferably, in the above technical solution, the aroma substances are nornicotine, myosmine, cotinine and 2,3-cyclopentenopyridine, and the total content of the aroma substances is increased by 50%-120%.

[0012] Preferably, in the above technical solution, the concentration range of nicotine is 1.0-5.0 g / L.

[0013] Preferably, in the above technical solution, the method of the application includes the following steps:

[0014] (1) Strain culture and fermentation liquid preparation:

[0015] Taking out the strain from -80°C, streaking it on an LB solid medium for resuscitation, after overnight culture, picking a single colony into 5 mL of an LB liquid medium containing 500 mg / L nicotine, and culturing it at 37°C and 220 RPM for 12-16 h;

[0016] Inoculate the seed liquid into 100 mL of LB liquid medium containing 500 mg / L nicotine at a ratio of 2%, and culture it at 37 °C and 220 RPM for 16 h;

[0017] Centrifuge at 6000 RPM for 10 min under the condition of 4 °C to collect the bacterial cells.

[0018] (2) Tobacco leaf treatment:

[0019] Resuspend the bacterial cells with an equal volume of deionized water and spray them onto 100 g of tobacco leaves at a spraying amount of 1% - 10%. After spraying, ferment them in a constant temperature and humidity environment for 12 - 120 h.

[0020] Preferably, in the above technical solution, in step (2), the conditions of the constant temperature and humidity environment are: the temperature is 20 - 50 °C, the humidity is 40 - 70%; the volume / mass ratio of the bacterial agent to the tobacco leaf is 5%; the fermentation time is 96 h.

[0021] The above technical solution of the present invention has the following beneficial effects:

[0022] Enterobacter hormaechei ZS01 obtained by the present invention has the ability to tolerate high concentrations of nicotine and excellent nicotine degradation ability, and its nicotine degradation efficiency can reach 98%. At the same time, Enterobacter hormaechei ZS01 also has certain potential applications in improving the quality of flue-cured tobacco. The detection results show that the content of aroma substances in tobacco leaves treated with Enterobacter hormaechei ZS01 can be increased by 50% - 120%, and it has good application prospects for both nicotine degradation and the development of low-nicotine and high-aroma tobacco products. Brief Description of the Drawings

[0023] The drawings incorporated in and constituting a part of this specification illustrate embodiments of the present invention and, together with the description, are used to explain the principles of the present invention.

[0024] Figure 1 It is the colony morphology diagram of Enterobacter hormaechei ZS01

[0025] Figure 2 It is the 16S rDNA gel diagram of Enterobacter hormaechei ZS01.

[0026] Figure 3 It is the phylogenetic tree of Enterobacter hormaechei ZS01.

[0027] Figure 4 It is the nicotine degradation ability curve diagram of Enterobacter hormaechei ZS01.

[0028] Figure 5 It is the process curve of nicotine degradation of Enterobacter hormaechei ZS01 and the control strain.

[0029] Figure 6Effects of fermentation treatment with Enterobacter hormaechei ZS01 and control strains on the aroma components of tobacco leaves. Detailed implementation manners

[0030] Various exemplary embodiments of the present invention will now be described in detail with reference to the accompanying drawings. It should be noted that: unless otherwise specifically stated, the relative arrangements of components and steps, numerical expressions, and numerical values set forth in these embodiments do not limit the scope of the present invention.

[0031] Unless otherwise specified, the experimental methods used in the following examples are all conventional methods. The materials and reagents used, unless otherwise specified, can all be obtained from commercial channels. The equipment used in the experiments, unless otherwise specified, are all well-known to those skilled in the art.

[0032] This application provides a strain that can efficiently degrade nicotine and increase the content of aroma substances. This strain is Enterobacter hormaechei ZS01, and the nucleotide sequence of its 16S rDNA is shown as SEQ ID NO:1. The highly efficient aroma-enhancing strain Enterobacter hormaechei ZS01 was isolated from the surface of Zhusha No. 2 flue-cured tobacco in Shilin, Kunming.

[0033] Enterobacter hormaechei ZS01 was deposited at the China Center for Type Culture Collection on February 27, 2025. Address: Wuhan University, Wuhan, China. The deposit number is CCTCC NO:M 2025313.

[0034] Application of the highly efficient aroma-enhancing strain in improving the quality of tobacco leaves. The highly efficient aroma-enhancing strain is used in the tobacco leaf aging process to improve the quality of flue-cured tobacco.

[0035] Application of the highly efficient aroma-enhancing strain in improving the quality of tobacco leaves. The specific steps are as follows:

[0036] (1) Take out the strain from -80°C and streak it on an LB solid medium for resuscitation. After overnight culture, pick a single colony and culture it in 5 mL of LB liquid medium containing 500 mg / L nicotine for 12 - 16 h;

[0037] (2) Inoculate the seed liquid into 100 mL of LB liquid medium containing 500 mg / L nicotine at a ratio of 2%, and culture it at 37°C and 220 RPM for 16 h;

[0038] (3) Centrifuge at 6000 RPM for 10 min at 4°C to collect the bacterial cells;

[0039] (4) Resuspend the bacterial cells with deionized water and spray them onto 100 g of tobacco leaves at a spraying amount of 1% - 10%;

[0040] (5) Ferment the tobacco leaves under the conditions of a temperature of 25 - 50 °C and a humidity of 40 - 70%, and the fermentation time is 48 - 120 h.

[0041] The fermentation product of the high-efficiency aroma-enhancing strain can metabolize nicotine in tobacco leaves into aroma substances, thereby improving its tobacco quality.

[0042] The above-mentioned method for isolating and screening the high-efficiency aroma-enhancing strain Enterobacter hormaechei. The primary screening method is as follows: First, weigh about 2 g of Zhusha tobacco leaves and place them in 20 mL of sterilized nicotine medium and ultrapure water. After thoroughly mixing in an oscillator, culture them in a shaker at 30 °C and 37 °C for 48 h. Subsequently, gradually dilute the culture solution to an appropriate concentration, and take bacterial solutions at five concentrations of 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 as the objects for culturing bacteria on spread plates. Spread them on LB medium (plates), with 3 plates for each gradient. After spreading, culture them in a constant temperature incubator at 30 °C and 37 °C for 1 - 2 days, and pick plump single colonies for further streak isolation and purification.

[0043] Composition of Luria-Bertani (LB) medium: 10.0 g / L tryptone, 5.0 g / L yeast extract, 10.0 g / L sodium chloride, 18.0 g / L agar. Sterilize at 121 °C for 20 min in an autoclave.

[0044] Composition of nicotine medium: K 2 HPO 4 13.3 g / L, KH 2 PO 4 4.0 g / L, (NH 4 ) 2 SO 4 0.01 g / L, yeast powder 1.0 g / L, nicotine 0.5 g / L; trace element solution 10.00 mL (MgSO 4 ·7H 2 O 1 g, MnSO 4 ·H 2 O 0.40 g, CaCl 2 0.15 g, CuCl 2 ·2H 2 O 0.20 g, FeSO 4 ·7H 2 O 0.02 g, dissolve it in 0.10 mol / L HCl to 100 mL), dissolve it in distilled water, and sterilize at 121 °C for 20 min in an autoclave.

[0045] Strain identification method: After the strain was isolated and purified, the universal primers for bacterial species identification 27F: GAGAGTTTGATCCTGGCTCAG; 1492R: TACGGCTACCTTGTTACGAC were used to amplify the bacterial 16S rDNA for strain identification, and the strain was found to be Enterobacter hallii. The 16S rDNA nucleotide sequence of the strain is shown in SEQ ID NO: 1.

[0046] The cell morphological characteristics and physiological and biochemical properties of Enterobacter hallii are: Gram-negative bacteria, short rod-shaped, with flagella around, arranged singly, in pairs or in clusters, mostly reproduced by binary fission, with a size of 0.6-1.0μm×1.2-3.0μm, the optimal growth temperature is 37℃, and the optimal pH is 7.4.

[0047] The technical solution of the present application is described in detail below by way of example:

[0048] Example 1 Screening and Isolation of Microorganisms on the Surface of Cinnabar Smoke

[0049] Cinnabar No. 2 tobacco leaves from Yunnan Shilin that were normally stored were cut into pieces under sterile conditions, about 2.0 g were weighed, and placed in 20 mL of sterilized nicotine culture medium. After being fully mixed in an oscillator, they were cultured in a shaker at 37°C and 200 RPM for 48 h. The culture medium was then diluted in a gradient and 10 -1 , 10 -2 , 10 -3 , 10 -4 , 10 -5 Five concentrations of bacterial suspensions were used as the objects of coating culture and were coated on nicotine solid plates. Three plates were coated for each gradient. 0.1 mL of bacterial solution was added to each plate. The plates were cultured in a constant temperature incubator at 30°C and 37°C for 2 days. Single colonies with full colonies were picked for restreaking and separation.

[0050] After preliminary screening, 26 strains with good growth were obtained from the cinnabar tobacco. Subsequently, the nicotine degradation ability of the 26 strains was further screened. The strains were picked into LB medium containing 2g / L nicotine, and the nicotine remaining in the medium was measured after culturing for 12 hours under the same conditions to calculate the nicotine degradation rate.

[0051] The detection method of nicotine is high performance liquid chromatography. The specific conditions are as follows: the chromatographic column is Agilent ZORBAX Eclipse Plus C18 (4.6×250 mm, 5 μm), with an ultraviolet detector, and the detection wavelength is 259 nm. The mobile phase consists of A: methanol; B: 1 mM sulfuric acid; the elution program is A:B = 10:90 (v:v); the elution temperature is 30 °C; the flow rate is 0.6 mL / min; the injection volume is 10 μL.

[0052] Example 2 Analysis of the cell morphological characteristics and physiological and biochemical properties of Enterobacter hormaechei

[0053] Enterobacter hormaechei is a facultative anaerobe. The optimal growth temperature is 37 °C, and the optimal pH is 7.4. It does not grow under acidic conditions. This bacterium has low nutritional requirements. On a common agar plate medium at 37 °C for 24 - 36 h, colonies can grow. The colonies are grayish-white, 1 - 2 mm in size, round, smooth around the edges, slightly convex, and the surface is smooth and moist (as Figure 1 shown); on a MacConkey agar plate medium after culturing at 37 °C for 24 h - 36 h, transparent small colonies can be observed. The colonies are 1 - 2 mm in size, round, smooth around the edges, slightly convex, and the surface is smooth and moist. Then, after storing at 4 °C for 24 h, the colonies turn red and the medium does not change color; on a 5% sheep blood agar plate after culturing at 37 °C for 24 h - 36 h, the colonies are grayish-white, pinhead-sized, and there is no hemolysis phenomenon. In ordinary broth after culturing at 37 °C for 24 h - 36 h, the broth becomes turbid. Enterobacter hormaechei does not ferment lactose, can utilize glucose, is positive for the methyl red test, urease positive, catalase positive, and on the triple sugar iron medium, the slant is yellow and the bottom is red, and it does not produce H 2 S.

[0054] Example 3 Amplification and determination of the 16S rDNA nucleotide sequence of Enterobacter hormaechei

[0055] Use the TSINGKE plant DNA extraction kit (general type). The specific steps are as follows:

[0056] Place the Spin Column in a Collection Tube, add 250 μL of Buffer BL, and centrifuge at 12,000 RPM for 1 min to activate the silica gel membrane. Take the sample of dry tissue (not more than 20 mg), add liquid nitrogen and grind thoroughly. After grinding, place it in a 1.5 mL centrifuge tube, add 400 μL of Buffer P1, vortex for 1 min, incubate in a water bath at 65 °C for 10 - 30 min, and during this period, it can be taken out and inverted to mix well for sufficient lysis. Add 150 μL of Buffer P2, vortex for 1 min, and incubate on ice for 5 min. Centrifuge at 12,000 RPM for 5 min, and transfer the supernatant to a new centrifuge tube. Add an equal volume of absolute ethanol to the supernatant, immediately mix well by vigorous shaking, transfer all the liquid into the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid. Add 500 μL of Buffer PW (anhydrous ethanol has been added before use) to the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid. Add 500 μL of Wash Buffer (anhydrous ethanol has been added before use) to the Spin Column, centrifuge at 12,000 RPM for 30 s, and discard the waste liquid. Repeat operation step 7. Place the Spin Column back into the Collection Tube, centrifuge at 12,000 RPM for 2 min, open the lid and air dry for 1 min. Take out the Spin Column, put it into a clean centrifuge tube, add 50 - 100 μL of TE Buffer (TE Buffer preheated at 65 °C) in the center of the adsorption membrane, place it at 20 - 25 °C for 2 min, and centrifuge at 12,000 RPM for 2 min.

[0057] After appropriately diluting the extracted DNA sample, use it as a PCR template, and amplify the bacterial 16S rDNA through universal primers for bacterial identification (27F: 5’-GAGAGTTTGATCCTGGCTCAG-3’; 1492S: 5’-TACGGCTACCTTGTTACGAC-3’) for analysis and identification. Take 1 μL of the PCR product and verify it on a 1% agarose gel and send it to Tsingke Biotechnology Co., Ltd. for sequencing (as Figure 2 shown).

[0058] Perform a BLAST analysis of the sequencing results in the NCBI database. The results show that the similarity of this bacterium to Enterobacter hormaechei strain 14269 is 99% (as Figure 3 shown), and its nucleotide sequence is as shown in SEQ ID NO:1.

[0059] Example 4 Degradation efficiency of Enterobacter hormaechei under different nicotine concentrations

[0060] Pick the Enterobacter hormaechei ZS01 that has grown overnight on the solid medium, add it to 5 mL of LB liquid medium containing 500 mg / L nicotine, and culture it at 37 °C and 220 RPM for 12 - 16 hours to obtain the seed liquid. Subsequently, inoculate the seed liquid into 100 mL of LB liquid medium containing 1.0 g / L, 2.0 g / L, 3.0 g / L, 4.0 g / L, and 5.0 g / L nicotine at an inoculation ratio of 2% (v / v), and culture it at 37 °C and 220 RPM for 96 h to determine the nicotine degradation rate of the culture system (as Figure 4 shown).

[0061] The results show that Enterobacter hormaechei ZS01 can tolerate high concentrations of nicotine and has excellent nicotine degradation ability at nicotine concentrations of 1.0 - 5.0 g / L. When the nicotine concentration is 1.0 g / L, its nicotine degradation efficiency can reach 98%.

[0062] Example 5 Determination of the dynamic process of nicotine degradation by Enterobacter hormaechei

[0063] Respectively pick Enterobacter hormaechei ZS01 that has grown overnight on the solid medium and Enterobacter hormaechei ZJ - 21 with nicotine degradation ability screened in the patent (CN115305227A) and inoculate them into 5 mL of LB liquid medium containing 500 mg / L nicotine, and culture them at 37 °C and 220 RPM for 12 - 16 h to obtain the seed liquid. Then, inoculate the seed liquid into 100 mL of LB medium containing 1.0 g / L nicotine at an inoculation ratio of 2% (v / v) for culture. During this period, samples are taken every 6 h to determine the nicotine concentration respectively, and the process curve of nicotine degradation is plotted (as Figure 5 shown).

[0064] The results show that Enterobacter hormaechei ZS01 and ZJ - 21 rapidly degrade nicotine within 24 h. By 24 h, the nicotine degradation rate of the fermentation treatment with ZS01 reaches 85%, while that of ZJ - 21 is 55%; subsequently, the nicotine degradation rates of the two strains gradually level off. When the fermentation is completed at 48 h, the nicotine degradation efficiency of ZS01 reaches 98%, while the nicotine degradation rate of ZJ - 21 is 60%. This shows that the Enterobacter hormaechei ZS01 screened in the present invention has a higher nicotine degradation efficiency.

[0065] Example 6 Spraying and fermentation treatment of tobacco leaves with Enterobacter hormaechei

[0066] Escherichia hormaechei ZS01 and ZJ-21 that had grown overnight on solid medium were separately picked and cultured in 5 mL of LB medium containing 500 mg / L nicotine at 37 °C and 220 RPM for 12 - 16 h to obtain seed solutions. Subsequently, the seed solutions were inoculated into 100 mL of the above medium at an inoculation ratio of 2% (v / v) and cultured for another 24 h to obtain fermentation broths. The fermentation broths of the strains were centrifuged at 4 °C and 6000 RPM for 10 min, the cells were collected, resuspended with an equal volume of deionized water, and then sprayed. A control experiment was carried out with the same volume of deionized water. It was sprayed on the surface of 100 g of tobacco leaves according to a volume / mass ratio of 5%, and fermented in an incubator at 25 °C and 40% relative humidity for 12 h, 24 h, 48 h, 72 h, 96 h, and 120 h respectively. The nicotine degradation rate in the tobacco leaves and the changes in the total contents of nornicotine, myosmine, cotinine, and 2,3-cyclopentenopyridine were detected and calculated.

[0067] The results showed that after fermentation treatment with Escherichia hormaechei ZS01, the tobacco leaves showed a decrease in nicotine content (the optimal spraying ratio was 5% and the optimal fermentation time was 96 h), and at the same time, the total content of aroma substances such as nornicotine, myosmine, cotinine, and 2,3-cyclopentenopyridine increased by 50% - 120% (as Figure 6 shown), while the tobacco leaves fermented with Escherichia hormaechei ZJ-21 did not show an increase in aroma substances.

[0068] Comparative Example 1

[0069] The specific implementation method was similar to that of Example 5, except that Escherichia hormaechei was not added, and an equal volume of PBS buffer was used to spray and ferment the tobacco leaves, and the changes in the contents of nicotine and some aroma substances in the tobacco leaves were detected.

[0070] The results showed that replacing the bacterial solution with PBS buffer had a poor effect on fermenting tobacco leaves, and the nicotine and aroma substances inside did not change significantly. This indicated that the Escherichia hormaechei used in this invention could significantly reduce the nicotine content in tobacco leaves and increase some aroma substances, thereby improving the quality of tobacco leaves.

[0071] This application utilizes the unique biodegradation characteristics of Escherichia hormaechei ZS01 to provide an effective solution for the tobacco industry. This strain can not only exhibit excellent degradation efficiency within the nicotine concentration range of 1.0 - 5.0 g / L, but also enhance the aromatic components in tobacco leaves, change the sensory characteristics of tobacco products, and meet the dual needs of modern consumers for health and taste. Therefore, this invention provides important technical support and theoretical basis for the development of low-nicotine and high-aroma tobacco products, and has broad application prospects.

[0072] Although the present invention has been disclosed above by way of examples, it is not intended to limit the present invention. Any person skilled in the art can make various different selections and modifications without departing from the spirit and scope of the present invention. Therefore, the protection scope of the present invention is defined by the claims and their equivalent forms.

Claims

1. A strain of Enterobacter hormaechei ZS01, characterized in that: It is deposited in China Center for Type Culture Collection with a deposit number of CCTCC NO:M 2025313, and the nucleotide sequence of its 16SrDNA is shown in SEQ ID NO:

1.

2. A bacterial agent, characterized in that The bacterial agent comprises the Enterobacter hormaechei ZS01 according to claim 1.

3. The bacterial agent according to claim 2, characterized in that The bacterial agent is prepared by the following method: inoculating Enterobacter holmesii ZS01 into LB liquid culture medium to obtain seed liquid, further expanding the seed liquid to obtain fermentation liquid, centrifuging the fermentation liquid to collect bacterial cells, and resuspending the bacterial cells in deionized water to obtain the bacterial agent.

4. Use of Enterobacter hormaechei ZS01 according to claim 1 or the bacterial agent according to any one of claims 2-3 in improving the quality of tobacco leaves.

5. The use according to claim 4, characterized in that: Enterobacter hormaechei ZS01 is used to degrade nicotine in tobacco leaves and increase the content of aroma substances.

6. The use according to claim 5, characterized in that: The aroma substances are nornicotine, myosamine, cotinine and 2,3-cyclopentapyridine, and the total content of the aroma substances is increased by 50%-120%.

7. The use according to claim 5, characterized in that: The nicotine concentration ranges from 1.0 to 5.0 g / L.

8. The use according to claim 5, characterized in that: The method of application comprises the following steps: (1) Strain culture and fermentation broth preparation: The strain was taken out from -80℃ and streaked on LB solid medium for recovery. After overnight culture, a single colony was picked and placed in 5 mL of LB liquid medium containing 500 mg / L nicotine, and cultured at 37℃ and 220RPM for 12-16h. The seed solution was inoculated into 100 mL of LB liquid medium containing 500 mg / L nicotine at a ratio of 2%, and cultured at 37°C and 220 RPM for 16 h; The cells were collected by centrifugation at 6000 RPM for 10 min at 4°C. (2) Tobacco leaf processing: Resuspend the bacteria with an equal volume of deionized water and spray it on 100g of tobacco leaves at a spraying rate of 1%-10%. After spraying, ferment in a constant temperature and humidity environment for 12-120h.

9. The use according to claim 8, characterized in that: In step (2), the constant temperature and humidity environment conditions are: temperature of 20-50° C., humidity of 40-70%; volume / mass ratio of bacterial agent to tobacco leaves of 5%; and fermentation time of 96 hours.

Images