Genetically engineered bacteria and their application in xylitol production
By introducing xylose reductase and xylose transporter genes into Vibrio sodium, genetically engineered bacteria was solved, and the problem that Vibrio sodium could not efficiently use xylose to produce xylitol was achieved, and the effect of efficient production of xylitol was achieved.
Patent Information
- Application Number
- CN202510593468.4
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-09
- Publication Date
- 2025-08-22
- Estimated Expiration
- 2045-05-09
AI Technical Summary
In the prior art, Vibrio sodium cannot efficiently use xylose to produce xylitol, and genetic engineering needs to be carried out to achieve xylitol metabolism.
Introduce xylose reductase gene and xylose transporter gene in Vibrio sodium to construct genetically engineered bacteria, integrate the T7 RNA polymerase expression cassette, integrate or free plasmid form to express xylose reductase, knock out glucose phosphorylated transporter encoding gene ptsG, integrate xylose transporter genes, and optimize copy number of xylose reductase and xylose transporter.
Vibrio sodium needs to be able to efficiently transport extracellular xylose into the cell and convert it into xylitol, and a genetically engineered bacteria that can use xylitol to produce xylitol was constructed, which increased the yield and conversion rate of xylitol.
Smart Images

Figure SMS_1 
Figure SMS_2 
Figure SMS_3
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering, and in particular relates to genetically engineered bacteria and their application in the production of xylitol. Background Art
[0002] Xylitol is a pentitol naturally found in plant and animal cells. It appears as a white solid, crystalline, or granular substance that is soluble in water. As a sugar substitute with a taste closest to sucrose, xylitol has extensive applications in medicine, food, and other fields, and also holds great promise in the chemical industry and new materials. Currently, chemical production of xylitol is a mature process, but it suffers from drawbacks such as high energy consumption and high costs. Biological production of xylitol is expected to replace traditional chemical routes and become the primary method for large-scale production. Microorganisms reported for xylitol production include Escherichia coli, Bacillus subtilis, and yeast.
[0003] Vibrio natriuresis is a Gram-negative marine bacterium that is non-pathogenic to humans. Its doubling time is 7 to 10 minutes, and its generation rate is twice as fast as that of Escherichia coli. It is the free-living bacterium with the shortest generation time known, and may be developed into a special artificial cell factory. Studies have found that the number of ribosomes in a single cell of Vibrio natriuresis is as high as 115,000, while Escherichia coli has only about 70,000 to 90,000, which means that it has a faster biomass synthesis rate and stronger protein expression ability. By constructing a central metabolic model, detecting biomass components, and high-resolution 13 Comprehensive analysis of C metabolic flow and other factors revealed that Vibrio natriuresis had a central metabolic model similar to that of Escherichia coli, with a growth rate of 1.70 L / h and a conversion rate of 3.90 g / g / h in glucose minimal medium, which was twice the metabolic rate of Escherichia coli.
[0004] Therefore, Vibrio natriuresis is a promising platform organism for xylitol production. However, wild-type Vibrio natriuresis cannot utilize the abundant and inexpensive xylose, and requires genetic engineering to enable it to efficiently metabolize xylose to produce xylitol. Summary of the Invention
[0005] In response to the demand for xylose-utilizing Vibrio natriuresis in the prior art, the present invention provides genetically engineered bacteria and their use in the production of xylitol. The specific plan is as follows:
[0006] In a first aspect, the present invention provides a genetically engineered bacterium, comprising a host cell and a target gene inserted into the host cell, wherein the host cell is Vibrio natriuresis; the target gene is a xylose reductase gene and a xylose transporter gene.
[0007] In the present invention, xylose reductase and xylose transporter genes are introduced into Vibrio natriuresis. The resulting genetically engineered bacteria can normally express xylose reductase and xylose transporter. The xylose transporter can transport extracellular xylose into the cell, where it can produce xylitol under the catalysis of the intracellular xylose reductase. The resulting genetically engineered bacteria were used for fermentation in a medium containing xylose and glucose, and the product xylitol was detected in the fermentation medium, demonstrating that a biological pathway for metabolizing xylose to produce xylitol has been successfully established in Vibrio natriuresis.
[0008] Furthermore, the natriuretic vibrio is a wild type natriuretic vibrio or a gene encoding a glucose phosphorylation transporter is knocked out. ptsG of the wild-type Vibrio natriuresis.
[0009] Furthermore, an RNA polymerase expression cassette for prokaryotic expression is integrated into the Vibrio natriuresis.
[0010] Furthermore, a T7 RNA polymerase expression cassette is integrated into the Vibrio natriuresis.
[0011] Furthermore, the T7 RNA polymerase expression cassette is inserted into the genome of Vibrio natriuresis DNS On the site.
[0012] In the genome of Vibrio natriuresis, DNS Genes encode nucleases that degrade intracellular nucleic acids and insert them into DNS Sites can be destroyed DNS Gene, thereby avoiding the expression of nuclease, and avoiding the xylose reductase gene and xylose transporter gene introduced into Vibrio natriuresis in this application from being degraded and losing their function.
[0013] Furthermore, the wild type Vibrio natriureticus is Vibrio natriureticus ATCC14048.
[0014] Furthermore, the accession number of the xylose reductase in the NCBI library is one of AF074484.1, AB002106.1, ALO17776.1, EAA34695.1, AAA99507.1 or Q9P8R5.1.
[0015] Furthermore, the accession number of the xylose reductase in the NCBI library is ALO17776.1.
[0016] Furthermore, the xylose reductase is recombinantly expressed in the form of genome integration or free plasmid.
[0017] Furthermore, the copy number of the xylose reductase gene is 4 to 7.
[0018] The present invention finds that genetically engineered bacteria expressing the xylose reductase gene in the form of an episomal plasmid have good catalytic ability for xylose. When the xylose reductase gene is expressed in a genome-integrated form, when the copy number of the xylose reductase gene is 4 to 7, the ability of the genetically engineered bacteria to catalyze xylose is better than that of the episomal form. However, when the copy number is less than 4 or greater than 7, the ability of the genetically engineered bacteria to catalyze xylose is significantly worse than that of the episomal form.
[0019] Furthermore, the xylose transporter gene is a xylose transporter gene derived from bacteria.
[0020] Furthermore, the xylose transporter gene is a xylose transporter gene derived from Escherichia coli W3110 xylE or xylRFGH , xylose transporter gene araE from Bacillus subtilis, or xylose transporter gene from Halomonas HEO0208 .
[0021] In the present invention, the ability of xylose reductase and xylose transporter introduced into Vibrio natriuresis was tested, and it was found that xylose reductase derived from bacteria or fungi can be successfully expressed in Vibrio natriuresis and have certain catalytic activity, while xylose transporter needs to be selected from a source close to Vibrio natriuresis at the species level, such as Escherichia coli, Bacillus subtilis, and Halomonas among bacteria.
[0022] Furthermore, the natriuretic vibrio is natriuretic vibrio ATCC14048.
[0023] In a second aspect, the present invention provides a method for producing xylitol, using xylose and glucose as substrates and the genetically engineered bacteria according to claim 1 as a catalyst to form a catalytic reaction system to produce xylitol.
[0024] Furthermore, the mass ratio of xylose to glucose is 1-4:1.
[0025] Furthermore, the reaction temperature is 25-35°C.
[0026] Compared with the prior art, the present invention has the following beneficial effects:
[0027] The present invention introduces a xylose transporter gene and a xylose reductase gene into Vibrio natriuresis, and the obtained genetically engineered bacteria can functionally express and obtain a recombinant xylose transporter, thereby transporting extracellular xylose into the cell, and utilizing the xylose reductase to convert the xylose into xylitol. The present invention is the first to construct a genetically engineered Vibrio natriuresis bacterium that can utilize xylose and produce xylitol, which is of great significance for subsequent research on the production of xylitol using Vibrio natriuresis. DETAILED DESCRIPTION
[0028] In order to make those skilled in the art better understand the present invention, the technical solution of the present invention is clearly and completely described below in conjunction with specific embodiments. It should be noted that the following detailed description is exemplary and is only a part of the embodiments of the present invention, rather than all embodiments.
[0029] Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without making any creative work should fall within the scope of protection of the present invention.
[0030] Unless otherwise specified, all technical and scientific terms used herein have the same meanings as commonly understood by those skilled in the art to which this application belongs. The experimental materials used in the examples of the present invention are all conventional experimental materials in the art and can be purchased through commercial channels. Experimental methods without detailed conditions were performed according to conventional experimental methods or according to the operating instructions recommended by the supplier.
[0031] The materials and methods involved in the following examples are as follows:
[0032] The primer synthesis and sequencing in the examples were all completed by a biotechnology company. The molecular biology experiments in the examples, including plasmid construction, enzyme digestion, competent cell preparation, and transformation, were mainly carried out with reference to the Molecular Cloning Laboratory Manual (3rd edition), edited by J. Sambrook and D.W. Russell (USA), translated by Huang Peitang et al., Science Press, Beijing, 2002. The transformation method of natural competent cells of Vibrio natriuresis and the preparation method of competent cells were all referenced to the literature (Dalia, TN, et al. Multiplex Genome Editing by Natural Transformation (MuGENT) for Synthetic Biology in Vibrio natriegens ACS Synth Biol. 2017). Specific experimental conditions can be determined through simple experiments if necessary. PCR amplification experiments should be performed according to the reaction conditions provided by the plasmid or DNA template supplier or the kit instructions. Adjustments can be made through simple experiments if necessary. Vibrio natrium ATCC14048 should be purchased from ATCC.
[0033] BHIv2 culture medium composition: brain heart infusion broth 37 g / L, NaCl 11.92 g / L, MgCl2·6H2O 4.7 g / L, KCl 0.31 g / L, sterilized by high-pressure steam at 115°C for 20 min.
[0034] Liquid phase detection method for sugars and sugar alcohols: High performance liquid chromatography (HPLC) with ultrapure water as the mobile phase, an Agilent Hi-Plex Ca column (7.7 mm × 300 mm), a column temperature of 85°C, and a flow rate of 0.6 mL / min.
[0035] The gene names involved in the present invention are explained as follows:
[0036] ptsG : Glucose phosphotransferase system enzyme II component.
[0037] XR : Xylose reductase.
[0038] XylE : Xylose transporter from Escherichia coli.
[0039] XylRFGH :Right now XylR 、 XylF 、 XylG and XylH , a xylose transporter from Escherichia coli. These four genes are naturally linked together in Escherichia coli and are collectively called XylRFGH .
[0040] HEO 0208: Xylose transporter from Halomonas sp.
[0041] AraE : A xylose transporter from Bacillus subtilis.
[0042] Example 1 Construction of the genetically engineered Vibrio natriuresis strain VnDX integrating T7 RNA polymerase
[0043] Using Vibrio natriuresis ATCC14048 as the starting strain, Escherichia coli E.coli The T7 RNA polymerase expression cassette on the BL21(DE3) genome was integrated into the genome of Vibrio natriuresis ATCC14048 DNS The specific method is as follows:
[0044] (1) Construction of pMD19T-dnsaLR-T7RNAP-spec plasmid
[0045] Plasmid pMD19T-dnsaLR-spec was digested with restriction endonuclease HindIII at 37℃ for 3 h. Primer pair T7RNAP-F and T7RNAP-F were designed to be isolated from Escherichia coli. E.coli BL21 (DE3) genome amplification T7 RNA polymerase expression cassette lacI-P lacUV5-T7 RNAP, and the DNA fragment was recovered. The linearized pMD19T-dnsaLR-spec plasmid and the T7 RNAP expression cassette were assembled to obtain the plasmid pMD19T-dnsaLR-T7RNAP-spec. The primer sequences are as follows:
[0046] T7RNAP-F: ggataaagtcatactttttaaagactttaactgcatgcccgagaagatgttgagcaaac;
[0047] T7RNAP-R: cacatgaactcgagtagggataacagggtaatcccgggcacagtatcaaggtattttat.
[0048] (2) Obtaining the repair template
[0049] The pMD19T-dnsaLR-T7RNAP-spec plasmid was extracted and digested with restriction endonuclease XbaI to obtain the linearized fragment dnsaLR-T7RNAP-spec, which was used as the repair template.
[0050] (3) Natural transformation
[0051] Plasmid pMMB67EH-tfoX was electroporated into Vibrio natriuresis ATCC14048 to generate the ATCC14048 / pMMB67EH-tfoX strain. This strain was inoculated into a BHIv2 tube containing 100 µg / mL Carb and 0.3 mM IPTG and cultured overnight. 3.5 µL of the overnight culture was diluted in 350 µL of sea salt containing 100 µM IPTG, and 50 ng of the dnsaLR-T7RNAP-spec fragment was added. The culture was gently mixed and incubated at 30°C for 4-6 hours. The culture was then revived in 1 mL of LBv2 medium and incubated at 30°C at 200 rpm for 1 hour before being plated on a Spec-resistant plate. PCR was performed using the appropriate PCR amplification system and conditions. Amplified products were detected by electrophoresis on a 1.0% agarose gel. Strains showing positive bands were designated VnDX.
[0052] The composition of BHIv2 medium is: Brain Heart Infusion Broth 37 g / L, NaCl 11.92 g / L, MgCl 2• 6H2O 4.7 g / L, KCl 0.31 g / L.
[0053] Example 2 Knockout ptsG Construction of Genetically Engineered Vibrio natriuresis Bacteria VnDX△ptsG
[0054] Using VnDX, a strain of Vibrio natriuresis that has integrated T7 RNA polymerase, and wild-type Vibrio natriuresis ATCC14048 as the starting strains, the CRISPR-associated transposase (CAST) method (Chromosome recombination and modification by LoxP-mediated evolution in Vibrio natriegens Using CRISPR-associated transposases. Biotechnol Bioeng 2023) Knockout of the glucose phosphorylation transporter gene in the genome of Vibrio natriuresis ptsG , the steps are as follows:
[0055] (1) Construction of pTNSQcas-ptsG plasmid
[0056] First, the PAM site was located on the target gene. The sequence corresponding to the 32 bp before the PAM site is the N32 sequence. The corresponding crRNA primer pairs N32-ptsG-F and N32-ptsG-R were designed. The plasmid pTNSQcas was digested with the restriction endonuclease BsaI at 37°C for 2 h. The primer pairs N32-ptsG-F and N32-ptsG-R were annealed to each other. The linearized plasmid and the primer annealing product were ligated at 25°C for 15 min and then transformed into Escherichia coli. E.coli DH5α, coated with LB solid plates containing chloramphenicol. The correct clone sequenced was plasmid pTNSQcas-ptsG. The primer sequences are as follows:
[0057] N32-ptsG-F: tttttgctaacctgcaaaaagtcggtaaatca;
[0058] N32-ptsG-R: tgatttaccgactttttgcaggttagcaaaaa.
[0059] (2) Construction of pDonor-verA plasmid
[0060] Using the plasmid pDonor-verA disclosed in the literature as a template, primers verA-F and verA-R were used to amplify a DNA fragment of approximately 1.9 kb, which was then electrophoresed on agarose gel and recovered. Using the plasmid pMW118 as a template, primers SC101-F and SC101-R were used to amplify a DNA fragment of approximately 1.8 kb, which was then electrophoresed on agarose gel and recovered. The two fragments were assembled and transformed into Escherichia coli. E.coli DH5α, coated with LB solid plates containing kanamycin. The clone that was sequenced correctly was the pDonor-verA plasmid. The primer sequences are as follows:
[0061] verA-F: cccagtcacgacgttgaagcggggttttttgcgaaaaaaa;
[0062] verA-R: gctagcatgcctatttgtttatttttcta;
[0063] SC101-F: aaacaaataggcatgctagcgcaccacatagcagacccgccataaaac;
[0064] SC101-R: aacgtcgtgactgggctcattaggcaccgggatctg.
[0065] (3) Electroporation of the pTNSQcas-ptsG plasmid into the Vibrio natriuresis VnDX or ATCC14048 strain
[0066] a. Preparation of electrocompetent cells: Streak Vibrio natrii stored at -80°C onto antibiotic-free solid culture plates and incubate overnight at 30°C. Pick a single colony and inoculate a 5 mL BHIv2 tube. Incubate overnight at 30°C with a shaker at 220 rpm. The next day, transfer 1% of the culture to fresh BHIv2 medium and incubate at 30°C with a shaker at 220 rpm for approximately 1-1.5 hours. Measure the OD value. 600 : Pipette 1 mL of bacterial liquid and detect it with a spectrophotometer. It is ready when the cell count reaches about 0.5 (0.4-0.6); divide the bacterial liquid into 1.5 mL EP tubes and centrifuge at 6000 rpm at 4℃ for 10 min, and discard the supernatant; resuspend the bacteria in 1 mL of electroporation wash buffer, centrifuge at 6000 rpm at 4℃ for 10 min, and discard the supernatant; repeat the above steps twice, making sure to pour off the liquid after each centrifugation; resuspend with 100 μL of wash buffer and store in a -80℃ ultra-low temperature freezer or directly electroporate.
[0067] b. Electroporation: Place the prepared competent culture of Vibrio natriuresis on ice. Aseptically add 800 ng of the pTNSQcas-ptsG plasmid, mix gently, transfer to a 1 mm electroporation cuvette, and electroporate at 800 V, 25 μF, and 200 Ω.
[0068] c. Transfer the cells to a sterile 1.5 mL EP tube using 800 μL of BHIv2 medium. Resuscitate the tube in a shaker at 30°C, 220 rpm for 45 minutes. Spread the tube on a chloramphenicol-resistant plate and incubate for 10–12 hours.
[0069] d. Pick a single colony and inoculate it into a BHIv2 tube. Incubate the tube in a shaker at 30°C and 220 rpm for 10–12 hours. Store the culture in glycerol stock to obtain the genetically engineered strains VnDX / pTNSQcas-ptsG and ATCC / pTNSQcas-ptsG.
[0070] (4) Electroporation of the pDonor-VerA plasmid into strain VnDX / pTNSQcas-ptsG or ATCC / pTNSQcas-ptsG
[0071] The method of electroporation to transfer the pDonor-VerA plasmid was the same as in Example 1. Finally, the genetically engineered bacteria VnDX / pTNSQcas-ptsG / pDonor-VerA and ATCC / pTNSQcas-ptsG / pDonor-VerA into which two plasmids were transferred were obtained.
[0072] (5) Induction of transposase by anhydrotetracycline hydrochloride (aTC)
[0073] Scrape 5-10 transformants from the transformation plate in 2.4, resuspend in 100 μL of liquid LBv2 medium, spread onto solid BHIv2 plates containing chloramphenicol, kanamycin, and 100 ng / mL aTc, and incubate at 30°C for 10 h. Perform PCR using upstream and downstream primers corresponding to the different insertion sites. If the PCR band is approximately 1.3 kb, the terminator sequence (VerA) has been inserted into the ptsG gene, indicating that the engineered strain has been engineered to have ptsG insertionally inactivated.
[0074] (6) Plasmid loss
[0075] The engineered bacteria that were PCR-positive in 2.5 were propagated three times in antibiotic-free tubes, and then streaked on antibiotic-free plates to separate single bacteria. Single colony spot plate testing was used to identify whether the plasmid had been lost. Single colonies that had been successfully lost were inoculated into 5 mL BHIv2 tubes for activation and preservation, obtaining strains VnDX△ptsG and ATCC△ptsG.
[0076] Example 3 Knockout ptsG , Construction of genetically engineered strains of Vibrio natriuresis VnDX△ptsG::xylE and ATCC△ptsG::xylE integrating the xylose transporter gene
[0077] Using the engineered bacteria VnDX△ptsG and ATCC△ptsG as the starting strains, the NT-CRISPR method (NT-CRISPR, combining natural transformation and CRISPR-Cas9 counterselection for markerless and scarless genome editing in Vibrio natriegens Communications Biology 2022 Vol. 5 Issue 1 Pages 265) The xylose transporter gene from Escherichia coli was XylE Integrate into the genome of Vibrio natriuresis. The specific method is as follows:
[0078] (1) Construction of the NT-CRISPR tool plasmid pNT-Xylitol targeting the untranslated region of the genome
[0079] Plasmid pNT-116 was digested with the restriction endonuclease BsaI at 37°C for 2 hours. Primers N20-NT-F and N20-NT-R were designed and annealed. The linearized plasmid and primer annealing product were ligated at 25°C for 15 minutes, transformed into E. coli DH5α, and plated on LB plates containing chloramphenicol. The clone that was sequenced correctly was designated plasmid pNT-Xylitol. The primer sequences are as follows:
[0080] N20-NT-F: gtccaacaaaccaccgcaatgcgg;
[0081] N20-NT-R: aaacccgcattgcggtggtttgtt.
[0082] (2) Transferring pNT-xylitol into VnDX△ptsG
[0083] The method of electroporation to transfer the pNT-xylitol plasmid was the same as in Example 2. The genetically engineered bacteria VnDXΔptsG / pNT-xylitol were obtained.
[0084] (3) Obtaining the repair template
[0085] Using the E. coli W3110 genome as a template, PCR was performed using primers xylE-F and xylE-R to obtain a DNA fragment of approximately 1.7 kb in length. Using the E. coli W3110 genome as a template, PCR was performed using primers up-F and up-R to obtain a DNA fragment of approximately 0.5 kb in length. Using the E. coli W3110 genome as a template, PCR was performed using primers down-F and down-R to obtain a DNA fragment of approximately 0.5 kb in length. Three DNA fragments were recovered by agarose gel electrophoresis. Using the three recovered DNA fragments as templates and up-F and down-R as primers, overlap extension PCR was performed. A DNA fragment of approximately 2.7 kb was recovered by agarose gel electrophoresis, namely the repair template up-xylE-down. The primer sequences are as follows:
[0086] xylE-F: gaagcggcataaaaacccacttacgataattctctttcg;
[0087] xylE-R: tgcatgcattttcgtttacagcgtagcagtttgttg;
[0088] up-F: aatgctacgatgcaatcacgatatac;
[0089] up-R:tttttatgccgcttctaagtgagtt;
[0090] down-F: acgaaaatgcatgcacgacaaaa;
[0091] down-R:ttcgattgattgggcgaaaatct.
[0092] (4) Natural transformation
[0093] The natural transformation method is the same as in Example 1. The transformants were verified by PCR using specific primers to obtain the xylose transporter gene integrated into the genome. xylE The genetically engineered Vibrio natriureticus strains VnDX△ptsG::xylE and ATCC△ptsG::xylE.
[0094] The same method was used to construct genetically engineered bacteria VnDX△ptsG::xylRFGH, VnDX△ptsG::HEO, VnDX△ptsG::araE, ATCC△ptsG::xylRFGH, ATCC△ptsG::HEO, ATCC△ptsG::araE integrating xylose transporters from different sources. xylE and xylRFGH is a xylose transporter gene from Escherichia coli. HEO 0208 is a xylose transporter gene from Halomonas sp. araE It is a xylose transporter gene derived from Bacillus subtilis. The specific sequence information is shown in Table 1.
[0095] Table 1 Xylose transporter genes from different sources
[0096]
[0097] Example 4: T7 expression system recombinantly expressing xylose reductase from different sources
[0098] (1) Obtaining xylose reductase genes from different sources
[0099] Based on the XR gene sequences published on NCBI, 11 wild-type XR genes from different sources were screened (sequence information is shown in Table 2). The wild-type XR gene sequences from different sources were codon-optimized in Escherichia coli and fully synthesized to obtain plasmids containing XR genes from different sources.
[0100] (2) Electroporation of 11 pET-28a-XR plasmids into VnDX
[0101] The electroporation competent cell preparation method and electroporation method are shown in Example 2, and VnDX / pET-28a-XR1, VnDX / pET-28a-XR2, VnDX / pET-28a-XR3, VnDX / pET-28a-XR4, VnDX / pET-28a-XR5, VnDX / pET-28a-XR6, VnDX / pET-28a-XR7, VnDX / pET-28a-XR8, VnDX / pET-28a-XR9, VnDX / pET-28a-XR10 and VnDX / pET-28a-XR11 of Vibrio natriuresis were obtained.
[0102] (3) Shake flask fermentation to induce expression of XR
[0103] Activate 11 strains, including VnDX / pET-28a-XR1, by streaking on solid plates. Single colonies were selected and inoculated into 5 mL tubes of BHIv2 medium supplemented with 200 μg / mL kanamycin and cultured overnight at 30°C, 220 rpm. 0.3 mL of each overnight bacterial culture was inoculated into 30 mL of BHIv2 medium supplemented with 200 μg / mL kanamycin and cultured with a shaker at 30°C, 220 rpm, for 10 hours. IPTG was then added for induction to a final concentration of 0.3 mM and cultured with a shaker at 28°C, 220 rpm, for 10 hours.
[0104] (4) Xylose reductase activity detection
[0105] Take 4 mL of bacterial solution from each shake flask of the above fermentation, add 4 mL of Tris-HCl buffer (pH 7.5), and lyse the bacteria using an ultrasonic cell disruptor (operate 3 s, pause 7 s, 30 times) to obtain crude enzyme solution.
[0106] The enzyme activity of XR was determined using a UV spectrophotometer. The total reaction system, 1 mL, consisted of xylose (final concentration 0.5 M), 200 μM NADPH, 50 mM Tris-HCl (pH 7.5), and an appropriate amount of crude enzyme solution. The change in absorbance at 340 nm was measured. The enzyme activity of XR was calculated from the increase in absorbance using the formula: U / mL = [ΔA × V (mL) × 10 6 × dilution factor] / [△t×6220×1×V 酶液 (mL)]. The enzyme library and enzyme activity determination results of XR from different sources are shown in Table 2.
[0107] Analysis of XR enzyme activity revealed significant differences in the activity of different XRs when recombinantly expressed in engineered Vibrio natriuresis strains. XR9 and XR10 exhibited no detectable activity; XR1, XR2, and XR8 exhibited activity below 1 U / mL; XR3, XR4, XR6, and XR7 exhibited activity between 1 and 10 U / mL; and XR5 exhibited the highest activity, reaching 43 U / mL.
[0108] Table 2 Activity assay results of xylose reductase (XR) from different sources recombinantly expressed in the Vibrio natriuresis T7 system
[0109]
[0110] Example 5 Recombinant expression of xylose reductase from different sources using non-T7 systems
[0111] (1) Construction of XR recombinant expression plasmid pJ23119-XR
[0112] Eleven XR gene sequences were amplified using specific primers from 11 pET-28a-XR plasmids as templates. Using the existing pJ23119 plasmid as a template, a plasmid backbone containing chloramphenicol resistance, the p15a replicon, and the J23119 constitutive promoter was amplified. The plasmid backbone was then recombined with each of the 11 XR gene sequences to construct 11 XR expression plasmids.
[0113] (2) Electroporation of 11 XR plasmids into ATCC14048
[0114] The electroporation competent cell preparation method and electroporation method are shown in Example 2, and Vibrio natriuresis ATCC / pJ23119-XR1, ATCC / pJ23119-XR2, ATCC / pJ23119-XR3, ATCC / pJ23119-XR4, ATCC / pJ23119-XR5, ATCC / pJ23119-XR6, ATCC / pJ23119-XR7, ATCC / pJ23119-XR8, ATCC / pJ23119-XR9, ATCC / pJ23119-XR10 and ATCC / pJ23119-XR11 are obtained.
[0115] (3) Expression of XR by shake flask fermentation
[0116] Activate 11 strains, including ATCC / pJ23119-XR1, by streaking on solid plates. Pick a single colony and inoculate it into a 5 mL tube of BHIv2 medium supplemented with 25 μg / mL chloramphenicol. Incubate overnight at 30°C, 220 rpm. Take 0.3 mL of each overnight bacterial culture and inoculate it into 30 mL of BHIv2 medium supplemented with 25 μg / mL chloramphenicol. Incubate at 30°C, 220 rpm, and shake for 15 hours.
[0117] (4) Xylose reductase activity detection
[0118] The xylose reductase activity was detected according to the method in Example 4. The enzyme library and enzyme activity determination results of XR from different sources are shown in Table 3.
[0119] Analysis of XR enzyme activity revealed significant variability when expressing different XRs using the J23119 constitutive promoter. No activity was detected for XR2, XR8, and XR10; XR9 had an activity below 1 U / mL; XR1, XR3, XR6, XR7, XR9, and XR11 had an activity range of 1-10 U / mL. XR5 had the highest activity, reaching 19.97 U / mL, followed by XR4. Variation in enzyme activity when expressing XRs using different expression systems is attributed to differences in the strength of the expression systems.
[0120] Table 3 Activity assay results of xylose reductase recombinantly expressed in the non-T7 system (J23119 promoter) of Vibrio natriuresis
[0121]
[0122] Example 6 Shake flask fermentation of xylitol by an engineered bacterium expressing recombinant XR and integrating a xylose transporter
[0123] Based on the results of XR enzyme activity assay in Example 4, XR5 with the highest enzyme activity and XR4 with the second highest enzyme activity were selected to construct xylitol strains. The corresponding plasmids pET-28a-XR5 and pET-28a-XR4 were transformed into engineered bacteria integrated with different xylose transporters for testing.
[0124] (1) Electroporate plasmids pET-28a-XR5 and pET-28a-XR4 into VnDX△ptsG::xylE strain
[0125] Competent electroporation and electroporation were performed as in Example 2 to obtain the engineered strain VnDXΔptsG::xylE / pET-28a-XR5, designated as strain S1. The same method was used to obtain the engineered strains VnDXΔptsG::xylRFGH / pET-28a-XR5, VnDXΔptsG::HEO / pET-28a-XR5, VnDXΔptsG::araE / pET-28a-XR5, VnDXΔptsG::xylE / pET-28a-XR4, VnDXΔptsG::xylRFGH / pET-28a-XR4, VnDXΔptsG::HEO / pET-28a-XR4, and VnDXΔptsG::araE / pET-28a-XR4, designated as strains S2, S3, S4, S5, S6, S7, and S8, respectively.
[0126] (2) Shake flask fermentation
[0127] a) Select well-growing monoclonal bacteria and place them in 5 mL of BHIv2 medium supplemented with kanamycin. Incubate at 30°C for 5-10 hours to use as seed solution.
[0128] b) Inoculate the cultured seed solution into the fermentation medium at a 1% inoculum size and incubate at 30°C until the OD reaches 0.6-0.8. Add IPTG to a final concentration of 0.3 mM and appropriate amounts of xylose and glucose mother solutions to each shake flask fermentation medium, respectively, to achieve a xylose concentration of 30 g / L and a glucose concentration of 15 g / L. After substrate addition, incubate at 30°C for 12 hours. Samples were taken periodically and changes in relevant parameters were monitored. Each experiment consisted of three replicates. Detailed fermentation data are shown in Table 4.
[0129] The results of shake flask fermentation showed that xylose transporters from different sources could be functionally expressed in Vibrio natriuresis and play a role in xylose transport. However, the efficiency of xylose transporters from different sources was different. HEO After being expressed in Vibrio natriuresis, 0208 had the highest efficiency in transporting xylose, and thus the highest xylitol production.
[0130] Table 4 Effects of different xylose transporters on xylitol production
[0131]
[0132] Example 7 Construction of genetically engineered bacteria expressing XR in the genome
[0133] According to the results of XR enzyme activity determination in Example 4 and shake flask fermentation in Example 5, the selected HEO 0208 The genetically engineered strain VnDX△ptsG::HEO for the xylose transporter and XR5 for the xylose reductase were subsequently integrated into the genome. Using the CRISPR-associated transposase (CAST) method, which has been published in the literature, multiple copies of the xylose reductase were integrated into the genome of Vibrio natriuresis, resulting in an integrated xylitol-producing strain that does not require the addition of antibiotics. The specific steps are as follows:
[0134] (1) Construction of pTNSQcas-array8 and pDonor-XR5 plasmids
[0135] A crRNA array capable of simultaneously targeting eight sites in the Vibrio natriuresis genome was designed. The DNA sequence was synthesized by Nanjing GenScript Biotech Co., Ltd. The CAST plasmid pTNSQcas-array8, containing the crRNA array, was also constructed by Nanjing GenScript Biotech Co., Ltd.
[0136] Using the pDonor-verA plasmid as a template, PCR was performed using primers pDonor-F and pDonor-R to generate a DNA fragment approximately 3 kb in length. Using the pET-28a-XR5 plasmid as a template, PCR was performed using primers XR5-F and XR5-R to generate a DNA fragment 1.2 kb in length. The two DNA fragments were recovered by agarose gel electrophoresis and then chemically transformed into DH5α competent cells using Gibson assembly. The cells were then plated on kanamycin-resistant LB plates and cultured overnight at 37°C. The next day, colonies were picked and inoculated into test tubes to obtain the plasmid pDonor-XR5. The primer sequences are as follows:
[0137] pDonor-F:CTTACTGCAGTAGTTTTGCTGA;
[0138] pDonor-R:gctggcgcctatatcTGGGTGTGATAATTATCAATT;
[0139] XR5-F: gatataggcgccagcaaccgca;
[0140] XR5-R: AACTACTGCAGTAAGgcggccgcttactggatctt.
[0141] (2) Construction of XR integrated genetically engineered bacteria
[0142] Following the electroporation and electroporation methods described in Example 2, plasmids pTNSQcas-array8 and pDonor-XR5 were sequentially electroporated to obtain the genetically engineered strain VnDXΔptsG::HEO / pTNSQcas-array8 / pDonor-XR5. Transposase expression and transposition were induced using the inducer anhydrotetracycline hydrochloride as described in Example 2. Following the methods described in Example 2, eight integrative genetically engineered strains containing 1 to 8 copies of XR were obtained.
[0143] Example 8 Shake flask fermentation with genetically engineered bacteria
[0144] The shake flask fermentation experiment was the same as in Example 5. The results of the shake flask fermentation experiments of the integrated genetically engineered bacteria and the plasmid-type genetically engineered bacteria are shown in Table 5. As can be seen from Table 5, the efficiency of xylose conversion fermentation by the integrated genetically engineered bacteria with different copies of the XR gene varies. Comparing the results of shake flask fermentation with the plasmid-type expression genetically engineered bacteria, it was found that the shake flask fermentation efficiency of the 5-, 6-, and 7-copy integrated genetically engineered bacteria was significantly better than that of the plasmid-type genetically engineered bacteria. The integrated genetically engineered bacteria had a higher xylose conversion rate. Among them, the integrated genetically engineered bacteria with 5 copies of the XR gene had the best xylitol production effect. After 12 hours of fermentation, the xylitol concentration was 29.60 g / L and the xylose conversion rate reached 99.0%.
[0145] Table 5 Shake flask fermentation results of integrated genetically engineered bacteria
[0146]
[0147] Comparative Example 1
[0148] According to the method of Example 6, Escherichia coli was constructed E.coli The BL21(DE3) strain expressing XR recombinantly was also subjected to the genetically engineered bacteria enzyme activity assay according to Example 6. The results are shown in Table 6. The maximum XR enzyme activity was 0.38 U / mL, which was much lower than the enzyme activity of XR recombinantly expressed in Vibrio natriuresis.
[0149] Table 6 Activity determination results of xylose reductase (XR) from different sources expressed in E. coli
[0150]
[0151] Comparative Example 2
[0152] The genetically engineered strain VnDXΔptsG without the heterologous xylose transporter was constructed according to the method of Example 2. Similarly, the XR expression plasmid was transferred into VnDXΔptsG according to the method of Example 4. Shake flask fermentation was performed, and samples were taken and analyzed at 12 and 24 hours, respectively. No xylitol production was detected.
Claims
1. A genetically engineered bacterium comprising a host cell and a target gene inserted into the host cell, characterized in that: The host cell is Vibrio natriuresis; the target genes are xylose reductase gene and xylose transporter gene; The xylose reductase has an accession number of AB002106.1 or ALO17776.1 in the NCBI database; The xylose transporter gene is a xylose transporter gene derived from Escherichia coli W3110 xylE or xylRFGH , xylose transporter gene from Bacillus subtilis araE , or a xylose transporter gene from Halomonas HEO0208 ; described xylE The gene accession number in the NCBI database is 948529; xylRFGH The accession numbers of the genes in the NCBI database are 948086, 948090, 948127 and 948083; araE The gene accession number in the NCBI database is 938567; HEO0208 The gene accession number in the NCBI database is CBV41047.1; The natriuretic vibrio is a gene encoding a glucose phosphorylation transporter knocked out ptsG of the wild-type Vibrio natriuresis.
2. The genetically engineered bacterium according to claim 1, characterized in that An RNA polymerase expression cassette for prokaryotic expression is integrated into the Vibrio natriuresis.
3. The genetically engineered bacterium according to claim 2, characterized in that The RNA polymerase expression cassette is a T7 RNA polymerase expression cassette, which is inserted into the genome of Vibrio natriuresis dns On the site.
4. The genetically engineered bacterium according to claim 1, characterized in that The wild type Vibrio natriureticus is Vibrio natriureticus ATCC14048.
5. The genetically engineered bacterium according to claim 1, characterized in that The xylose reductase gene is expressed in the host cell in one of the following ways: (A) Expressed in host cells in the form of a recombinant plasmid; (B) Inserted into the untranslated region of the host cell genome in the form of an expression cassette for expression.
6. The genetically engineered bacterium according to claim 5, characterized in that (A) The original expression vector of the recombinant plasmid is pET-28a.
7. The genetically engineered bacterium according to claim 5, characterized in that In (B), the xylose reductase gene is expressed by the T7 promoter.
8. The genetically engineered bacterium according to claim 5, characterized in that In (B), the copy number of the xylose reductase gene integrated into the genome is 4 to 7.
9. A method for producing xylitol, characterized in that: Xylose and glucose are used as substrates, and the wet bacteria, crude enzyme solution, immobilized cells or lyophilized cells of the genetically engineered bacteria according to claim 1 are used as catalysts to form a catalytic reaction system to produce xylitol.
10. The method according to claim 9, characterized in that The mass ratio of xylose to glucose is 1-4:
1.
11. The method according to claim 9, characterized in that The reaction temperature is 25~35℃; the reaction pH is 5~9.
Citation Information
Patent Citations
Genetically engineered bacterium for preparing xylitol and application of genetically engineered bacterium
CN118581025A
Production of xylitol and ethanol by recombinant saccharomyces cerevisiae expressing arabinose transporter
KR1020170114785A