Preparation method of circular RNA (Ribonucleic Acid)

Abstract

The invention discloses a circular RNA (Ribonucleic Acid) preparation method, which belongs to the technical field of biology and comprises the following steps: 1, synthesizing a template; 2, synthesizing a template of the circular RNA; 3, in vitro transcription; 4, removing the DNA template; 5, carrying out a cyclization reaction: recovering the non-cyclized RNA after the IVT reaction is finished by using an NEB RNA recovery column, and cyclizing the purified RNA according to cyclization conditions; 6, treating and enriching the circular RNA by using RNase R (Ribonucleic Acid); 7, verifying the purity of the purified circular RNA by HPLC (high performance liquid chromatography); and 8, verifying the circular RNA through reverse transcription PCR (Polymerase Chain Reaction). According to the method disclosed by the invention, the reaction conditions of RNase R incubation are optimized, most of linear RNA in the circRNA sample treated by RNase R after the reaction conditions are optimized is removed, and the circRNA purity is higher.

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and particularly relates to a method for preparing circular RNA. Background Art

[0002] Circular RNA (circRNA) is a class of single-stranded closed RNA molecules that lack 5' and 3' free ends, so they are not easily degraded by exonucleases and are more stable than linear RNA. With the assistance of an internal ribosome entry site (IRES), circRNA can translate and express any target protein and can be developed as a candidate vaccine or drug.

[0003] Therefore, the present invention optimizes the template sequence and cyclization conditions for circRNA synthesis through gene synthesis, and obtains circRNA with higher purity by digesting linear RNA with RNaseR. Summary of the Invention

[0004] In order to obtain circular RNA with higher purity, the present invention provides a method for preparing circular RNA.

[0005] The object of the present invention can be achieved by the following technical solutions:

[0006] A method for preparing circular RNA, comprising the following steps:

[0007] I. Synthesize the template: Design PCR primers for amplifying the EGFP gene, a gene synthesis vector, and a vector for enzyme digestion;

[0008] II. Synthesize the template for circular RNA: Use a supercoiled plasmid, and the plasmid must be completely linearized to ensure that the double-strand is a blunt end or the 5' end has an overhanging structure. Use EcoRV endonuclease to linearize the plasmid, and use PCR A to recover the linearized template;

[0009] III. In vitro transcription (IVT): Use T7 RNA polymerase for in vitro transcription, and add an RNA enzyme inhibitor to the transcription system to protect the RNA from degradation;

[0010] IV. Remove the DNA template: After the IVT reaction is completed, use DNase I to remove the DNA template to reduce the influence on subsequent reactions;

[0011] V. Perform a cyclization reaction: First, recover the uncyclized RNA after the IVT reaction using a NEB RNA recovery column, and cyclize the purified RNA according to the following cyclization conditions:

[0012] React 2 - 10 μg of purified RNA at 65 °C for 3 min, then mix it with 100 mM GTP and 2 μL of Buffer I, supplement with NF water to make the solution 20 μL, and react at 55 °C for 30 min to obtain circular RNA. Purify and recover the circularized RNA using an NEB column and store it at - 20 °C for later use;

[0013] VI. Enrich circular RNA by RNase R treatment: Mix 2 μL of 10×RNase R Reaction Buffer, 1 μg of RNA sample, and 2 U of RNase R (20 U / μL), supplement with NF water to make the solution 20 μL, incubate at 37 °C for 20 min, and react at 70 °C for 10 min to inactivate the reaction;

[0014] VII. Verify the purity of the above - purified circular RNA by HPLC;

[0015] VIII. Verify circular RNA by reverse transcription PCR.

[0016] Furthermore, the primers are ZT1 - EGFP - F1, ZT2 - EGFP - F2, ZT3 - EGFP - R1, ZT3 - EGFP - R1;

[0017] The sequence of ZT1 - EGFP - F1 is:

[0018] atgataatatggccacaaccATGGTGAGCAAGGGCGAGGA;

[0019] The sequence of ZT2 - EGFP - F2 is:

[0020] gtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtagga;

[0021] The sequence of ZT3 - EGFP - R1 is:

[0022] agattacaagtataagtcaccttatactcaggcctcaattaacccaagaaaacatctctgTTACTTGTAC AGCTCGTCCA;

[0023] The sequence of ZT2 - EGFP - R2 is:

[0024] cagtcgacgggcccgggatcgatatcctagaaatctgataaatggaattagtcctacaatttagcacggga.

[0025] Furthermore, the PCR amplification step is as follows:

[0026] Add 1.5 μL of primer F, 1.5 μL of primer R, 1 μL of template, and 1 μL of enzyme to 45 μL of working solution, and obtain PCR primers through the PCR program.

[0027] Furthermore, the PCR program is as follows:

[0028] Pre-denature at 96 °C for 3 minutes, denature at 98 °C for 10 seconds, anneal at 68 °C for 25 seconds, extend at 72 °C for 30 seconds. Among them, the three steps of denaturation, annealing, and extension are cycled 25 times, and the final extension at 72 °C is 2 minutes, and finally stored permanently at 4 °C.

[0029] Furthermore, the step of digesting the vector with enzymes is as follows:

[0030] Mix 2 μL of BstxI / BamHI, 5 μL of 10X buffer, and 2 μg of plasmid, supplement NF water until the solution volume is 50 μL, and incubate at 37 °C for 2 h to obtain the vector digested with enzymes.

[0031] Furthermore, the EGFP vector step is as follows:

[0032] Recombine and transform the PCR product and the vector digested with enzymes into Escherichia coli, spread on a plate, perform bacterial inspection the next day, screen positive clones, and after detection, obtain a complete EGFP vector.

[0033] Furthermore, the buffer system for the cyclization reaction is as follows:

[0034] 10×Group I intron cyclization reaction buffer, 500 mM Tris-HCl (pH = 7.5), 100 mM MgCl 2 , 10 mM DTT.

[0035] Advantages of the present invention:

[0036] In the present invention, compared with the traditional cyclization reaction, after the IVT is completed, 2 mM GTP is added to the IVT system and reacted at 55 °C for 15 min. Gel electrophoresis can show the band after cyclization, but it is weak and the cyclization efficiency is not high. The optimized cyclization reaction conditions are to first recover the uncyclized RNA after IVT with an NEB RNA recovery column, and cyclize the purified RNA according to the following cyclization conditions to obtain more cyclized products.

[0037] In the present invention, the reaction conditions for incubating RNase R are optimized. After the optimization of the reaction conditions, most of the linear RNA in the circRNA sample treated with RNase R is removed, and the purity of circRNA is higher. Description of the drawings

[0038] The present invention will be further described below in conjunction with the accompanying drawings.

[0039] Figure 1 It is the electrophoresis diagram in the third step of Example 1 of the present invention;

[0040] Figure 2 It is the electrophoresis diagram in the fifth step of Example 1 of the present invention;

[0041] Figure 3 It is the electrophoresis comparison diagram before and after RNase R treatment in the sixth step of Example 1 of the present invention;

[0042] Figure 4 It is the electrophoresis comparison diagram before and after purification by NEB column in the sixth step of Example 1 of the present invention;

[0043] Figure 5 It is the HPLC detection diagram before RNase R treatment in the seventh step of Example 1 of the present invention;

[0044] Figure 6 It is the HPLC detection diagram after RNase R treatment in the seventh step of Example 1 of the present invention;

[0045] Figure 7 It is the electrophoresis diagram in the eighth step of Example 1 of the present invention;

[0046] Figure 8 It is the circRNA microcircular plasmid diagram of Example 1 of the present invention;

[0047] Figure 9 It is the sequence alignment diagram of the sequencing result of Example 1 of the present invention. Detailed implementation manners

[0048] The technical solutions in the embodiments of the present invention will be clearly and completely described below in conjunction with the embodiments of the present invention. Obviously, the described embodiments are only a part of the embodiments of the present invention, rather than all the embodiments. All other embodiments obtained by those of ordinary skill in the art based on the embodiments of the present invention without creative efforts shall fall within the protection scope of the present invention.

[0049] Example 1

[0050] This example provides a method for preparing circular RNA, including the following steps:

[0051] 1. Synthesize the template:

[0052] Design PCR primers for amplifying the EGFP gene

[0053] The sequence of the ZT1-EGFP-F1 is as follows:

[0054] atgataatatggccacaaccATGGTGAGCAAGGGCGAGGA

[0055] The sequence of ZT2-EGFP-F2 is as follows:

[0056] gtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtagga

[0057] The sequence of ZT3-EGFP-R1 is as follows:

[0058] agattacaagtataagtcaccttatactcaggcctcaattaacccaagaaaacatctctgTTACTTGTACAGCTCGTCCA

[0059] The sequence of ZT2-EGFP-R2 is as follows:

[0060] cagtcgacgggcccgggatcgatatcctagaaatctgataaatggaattagtcctacaatttagcacggga;

[0061] Amplification vector 2

[0062] The amplification system is as follows:

[0063] Table 1

[0064] Item Volume Primer F 1.5 μL Primer R 1.5 μL Template 1 μL Enzyme 1 μL Working solution 45 μL

[0065] The PCR procedure is as follows:

[0066] Pre-denaturation at 96 °C for 3 minutes, denaturation at 98 °C for 10 seconds, annealing at 68 °C for 25 seconds, extension at 72 °C for 30 seconds. Among them, the three steps of denaturation, annealing, and extension are cycled 25 times, the final extension at 72 °C is 2 minutes, and finally stored permanently at 4 °C.

[0067] The digestion system is as follows:

[0068] Table 2

[0069] Item Condition BstxI / BamHI 2 μL each 10X buffer 5 μL Add NF water to 50 μL Plasmid 2 μg 72℃ 2h

[0070] The PCR product and the digested vector are recombinantly transformed into Escherichia coli, spread on plates, the bacteria are detected the next day, and the positive clones are screened and sent for sequencing. Finally, a complete EGFP vector is constructed for subsequent circRNA synthesis.

[0071] II. Template for synthesizing circRNA: Supercoiled plasmids are used. The plasmids must be completely linearized to ensure that the double-stranded ends are blunt or have overhangs at the 5' end. The plasmid is linearized by digestion with EcoRV endonuclease, and the linearized template is recovered by PCRA;

[0072] III. In vitro transcription (IVT): In vitro transcription is carried out using T7 RNA polymerase (Yeasen). An RNase inhibitor is added to the transcription system to protect the RNA from degradation;

[0073] 3% gel electrophoresis is used to verify the in vitro transcription, and the verification results are as Figure 1 shown.

[0074] IV. Removal of DNA template: After the IVT reaction, DNase I is used to remove the DNA template to reduce the impact on subsequent reactions;

[0075] V. Optimization of the cyclization reaction:

[0076] Prepare the cyclization reaction Buffer system

[0077] Table 3

[0078] System 10× Group I intron circularization reaction Buffer 500 mM Tris-HCl (pH = 7.5) <![CDATA[100mMMgCl 2 > 10 mM DTT

[0079] Optimization of the cyclization reaction

[0080] First, the uncyclized RNA after the IVT reaction is recovered using an NEB RNA recovery column, and the purified RNA is cyclized under the following cyclization conditions:

[0081] The RNA is first treated at 65 °C for 3 min, and then the cyclization reaction is carried out according to the following system:

[0082] The cyclization system is as follows:

[0083] Table 4

[0084]

[0085]

[0086] The cyclized RNA is purified and recovered using an NEB column and stored at -20 °C for subsequent use.

[0087] 3% agarose gel electrophoresis is used to verify the cyclization efficiency, and the verification results are as Figure 2 shown, where 1 represents the cyclization efficiency before the optimized system, and 2 represents the cyclization efficiency after the optimized system.

[0088] It can be seen that Figure 2 after optimizing the cyclization system, the yield of circular RNA increases significantly.

[0089] VI. Enrichment of circular RNAs by RNase R treatment:

[0090] The RNase R reaction system is as follows:

[0091] Table 5

[0092] Item Condition 10X RNase R Reaction Buffer 2 μL RNA sample 1 μg RNase R (20 U / μL) 2U Add NF water to 20 μL Incubate at 37 °C 20 min Heat inactivate at 70 °C 10 min

[0093] The effect of RNase R treatment was verified by 3% gel electrophoresis. The verification results are as Figure 3 shown, where 1 represents the sample before RNase R treatment and 2 represents the sample after RNase R treatment.

[0094] From Figure 3 it can be seen that after optimizing the reaction conditions, most of the linear RNAs were removed from the circRNA samples after RNase R treatment.

[0095] The samples treated with RNase R above were purified by NEB columns and verified by 3% agarose gel electrophoresis. The verification results are as Figure 4 shown, where 1 represents the sample before NEB column purification and 2 represents the sample after NEB column purification.

[0096] VII. Verification of the purity of the purified circular RNAs by HPLC:

[0097] The test conditions and verification results are as Figure 5 , Figure 6 shown:

[0098] From Figure 5 , Figure 6 it can be seen that Figure 5 is the HPLC result diagram before RNase R treatment. It can be seen that there are two peaks, which are the peaks of linear RNA and circular RNA respectively; Figure 6 is after RNase R treatment. The linear RNA was removed, and the peak diagram represents the purity of circular RNA, and the purity can reach 90%.

[0099] VIII. Verification of circular RNAs by reverse transcription PCR:

[0100] The effect of reverse transcription treatment was verified by 3% gel electrophoresis. The verification results are as Figure 7 shown.

[0101] It should be noted that in this text, relational terms such as first and second are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any actual relationship or order between these entities or operations. Moreover, the terms "comprising", "including" or any other variant thereof are intended to cover non-exclusive inclusion, such that a process, method, article or device comprising a series of elements includes not only those elements but also other elements not expressly listed, or elements inherent to such process, method, article or device.

[0102] Although the embodiments of the present invention have been shown and described, those of ordinary skill in the art can understand that various changes, modifications, substitutions and variations can be made to these embodiments without departing from the principles and spirit of the present invention. The scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for preparing circular RNA, characterized in that: The following steps are involved:

1. Synthesize template: design PCR primers, gene synthesis vectors, and enzyme digestion vectors for amplifying the EGFP gene; 2. Template for synthesizing circular RNA: Use supercoiled plasmids. The plasmids must be completely linearized to ensure that the double strands have blunt ends or the 5' end has a protruding structure. Use EcoRV endonuclease to linearize the plasmids, and use PCR A to recover the linearized templates.

3. In vitro transcription: T7 RNA polymerase is used for in vitro transcription, and RNase inhibitors are added to the transcription system to protect RNA from degradation; 4. DNA template removal: After the IVT reaction is completed, DNase I is used to remove the DNA template to reduce the impact on subsequent reactions; 5. Perform cyclization reaction: First, recover the uncircularized RNA after the IVT reaction using NEB RNA recovery column, and then cyclize the purified RNA according to the following cyclization conditions: 2-10 μg of purified RNA was reacted at 65°C for 3 min, then mixed with 100 Mm GTP and 2 μL type I buffer, supplemented with NF water to a solution of 20 μL, and reacted at 55°C for 30 min to obtain circularized RNA. The circularized RNA was purified and recovered using a NEB column and stored at -20°C for later use; 6. RNase R treatment to enrich circular RNA: Mix 2 μL of 10× RNase R Reaction Buffer, 1 μg of RNA sample, and 2 U of RNase R, add NF water to a solution of 20 μL, incubate at 37°C for 20 min, and react at 70°C for 10 min to inactivate the reaction; 7. HPLC verification of the purity of the purified circular RNA; 8. Reverse transcription PCR verification of circular RNA.

2. A method for preparing circular RNA according to claim 1, characterized in that: The primers are ZT1-EGFP-F1, ZT2-EGFP-F2, ZT3-EGFP-R1, and ZT3-EGFP-R1; The sequence of the ZT1-EGFP-F1 is: atgataatatggccacaaccATGGTGAGCAAGGGCGAGGA; The sequence of the ZT2-EGFP-F2 is: gtgacttatacttgtaatctatctaaacggggaacctctctagtagacaatcccgtgctaaattgtagga; The sequence of the ZT3-EGFP-R1 is: agattacaagtataagtcaccttatactcaggcctcaattaacccaagaaaacatctctgTTACTTGTACAGCTCGTCCA; The sequence of the ZT2-EGFP-R2 is: cagtcgacgggcccgggatcgatatcctagaaatctgataaatggaattagtcctacaatttagcacggga.

3. The method for preparing circular RNA according to claim 1, characterized in that: The PCR amplification steps are: 1.5 μL of primer F, 1.5 μL of primer R, 1 μL of template and 1 μL of enzyme were added to 45 μL of working solution and subjected to a PCR procedure to obtain PCR primers.

4. The method for preparing circular RNA according to claim 1, characterized in that: The PCR program is: Pre-denaturation at 96 degrees for 3 minutes, denaturation at 98 degrees for 10 seconds, annealing at 68 degrees for 25 seconds, and extension at 72 degrees for 30 seconds. The three steps of denaturation, annealing, and extension are cycled 25 times, and final extension is performed at 72 degrees for 2 minutes. Finally, it is permanently stored at 4 degrees.

5. The method for preparing circular RNA according to claim 1, characterized in that: The steps for digesting the vector are: Mix 2 μL of BstxI / BamHI, 5 μL of 10X buffer, and 2 μg of plasmid, add NF water until the solution volume is 50 μL, and incubate at 37°C for 2 h to obtain the enzyme-cut vector.

6. The method for preparing circular RNA according to claim 1, characterized in that: The steps for EGFP vector are: The PCR product and the enzyme-cut vector were recombined and transformed into Escherichia coli, plated, and tested the next day to screen positive clones. After testing, the complete EGFP vector was constructed.

7. The method for preparing circular RNA according to claim 1, characterized in that: The cyclization reaction buffer system is: 10×I-type intron circularization buffer, 500mM Tris-HCl, pH=7.5, 100mM MgCl2, 10mM DTT.

Images