Knockout plasmid, kit, method and application of sphingosine Alaskia

By providing a knockout plasmid for Alaska sphinosine bacteria, the target genes in the strain are accurately and efficiently knockout, which is difficult to achieve in the prior art, and in-depth research on the physiological mechanism of the strain is promoted.

CN120138014AActive Publication Date: 2025-06-13HUAZHONG NORMAL UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510292444.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-12
Publication Date
2025-06-13
Estimated Expiration
2045-03-12

AI Technical Summary

Technical Problem

The prior art is difficult to achieve accurate and efficient traceless knockout of target genes in Alaska sphinosine bacteria, which limits in-depth research on the cell growth, metabolism regulation and environmental adaptation mechanism of this strain.

Method used

A knockout plasmid is provided, including the PAK405 plasmid sequence, homologous sequences inserted at specific enzyme cleavage sites, and upstream and downstream homologous sequences for achieving precise knockout of target genes in Alaska Sphingosine RB2256. The plasmid was knocked out without trace by homologous recombination and streptomycin screening techniques.

Benefits of technology

The efficient and precise knock-out of the target gene in Alaska sphinosine bacteria was achieved, various gene deletion mutants were constructed, and the specific role of different genes in cell growth, metabolic regulation and environmental adaptation were deeply explored.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138014A_ABST
    Figure CN120138014A_ABST
Patent Text Reader

Abstract

The invention relates to a knockout plasmid, a kit, a method and application of sphingosine Alaskia. According to the knockout plasmid, the kit, the method and the application of the sphingosine Alaskia, stable genetic manipulation in the sphingosine Alaskia RB2256 can be realized, and traceless knockout of genes is achieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the technical field of gene editing of Sphingopyxis alaskensis, and specifically relates to a knockout plasmid, a kit, a method and an application of Sphingopyxis alaskensis. Background Art

[0002] Sphingopyxis alaskensis does not form spores and is Gram-negative. It reproduces by fission, is a heterotrophic bacterium, requires oxygen for growth, does not require sunlight, and has a positive catalase reaction. The optimum growth temperature is about 30 °C, the optimum environmental pH is about 7.0, and no growth factors and other nutrients need to be added during the growth process.

[0003] The β-glucosidase derived from Sphingopyxis alaskensis, a variant obtained by mutations such as N166S / E351A or Q20E, has improved catalytic ability and / or thermal stability and reduced substrate inhibition, and can directly convert common ginsenosides such as Rb1 and Rd to produce rare ginsenosides such as Rh2 and Rg3, providing favorable conditions for the large-scale industrial production of ginsenosides. Strains of the genus Sphingomonas have the ability to degrade aromatic compounds in environmental protection. As a kind of Sphingomonas, Sphingopyxis alaskensis may also have similar potential for degrading organic pollutants, such as the degradation of pollutants such as polycyclic aromatic hydrocarbons, and has certain research value in the field of environmental remediation. Summary of the Invention

[0004] This application provides a knockout plasmid, a kit, a method and an application of Sphingopyxis alaskensis. The knockout plasmid, the kit, the method and the application can achieve precise and efficient scarless knockout of target genes in the strain, construct various gene deletion mutants, and further deeply explore the specific roles played by different genes in Sphingopyxis alaskensis RB2256 in many aspects such as cell growth, metabolic regulation, and environmental adaptation.

[0005] To this end, the embodiments of this application at least disclose the following technical solutions:

[0006] In one aspect, the embodiment discloses a knockout plasmid, including the PAK405 plasmid sequence shown in SEQ ID NO:1; the sequence shown in SEQ ID NO:2 inserted between the BglII restriction enzyme site and the ApaI restriction enzyme site of the PAK405 plasmid; and the upstream homologous sequence and the downstream homologous sequence inserted between the BamHI restriction enzyme site and the SalI restriction enzyme site of the PAK405 plasmid; wherein, both the upstream homologous sequence and the downstream homologous sequence are homologous to the genomic sequence of Sphingopyxis alaskensis RB2256.

[0007] In some embodiments, the upstream homologous sequence is homologous to the nucleotide sequence of the 800 nt upstream of the Sala_1737 gene of Sphingomonas alaskensis RB2256, and the downstream homologous sequence is homologous to the nucleotide sequence of the 800 nt downstream of the Sala_1737 gene of Sphingomonas alaskensis RB2256. The Sala_1737 gene is located at 1829693 - 1830805 nt of the genome CP000356.1 of Sphingomonas alaskensis RB2256.

[0008] In some embodiments, the upstream homologous sequence is homologous to the nucleotide sequence of the 800 nt upstream of the Sala_2677 gene of Sphingomonas alaskensis RB2256, and the downstream homologous sequence is homologous to the nucleotide sequence of the 800 nt downstream of the Sala_2677 gene of Sphingomonas alaskensis RB2256. The Sala_2677 gene is located at 2822946 - 2825048 nt of the genome CP000356.1 of Sphingomonas alaskensis RB2256.

[0009] In a second aspect, the embodiment discloses a kit. The kit includes the knockout plasmid described in the first aspect and Escherichia coli ST18.

[0010] In a third aspect, the embodiment discloses a kit. The kit includes Escherichia coli ST18 into which the knockout plasmid described above has been transferred.

[0011] In a fourth aspect, the embodiment discloses a method for knocking out a target region of the genome of Sphingomonas alaskensis RB2256, which includes obtaining the knockout plasmid described in the first aspect; obtaining a conjugation donor bacterium containing the knockout plasmid; performing homologous recombination between the activated conjugation donor bacterium and Sphingomonas alaskensis RB2256; and screening the positive colonies after the homologous recombination with streptomycin, thereby knocking out the target region of Sphingomonas alaskensis RB2256.

[0012] In some embodiments, the target region is the Sala_1737 gene or the Sala_2677 gene of Sphingomonas alaskensis RB2256.

[0013] In a fifth aspect, the embodiment discloses the application of the knockout plasmid described in the first aspect or the kit described in the second aspect in knocking out the Sala_1737 gene or the Sala_2677 gene of Sphingomonas alaskensis RB2256. Brief Description of the Drawings

[0014] Figure 1Colony PCR verification gel electrophoresis diagram of the basic plasmid PAK405-Cm provided for the examples. Lanes 1-20 are all positive colony samples of the constructed basic plasmid PAK405-Cm.

[0015] Figure 2 Gel electrophoresis diagram of the upstream homologous sequence (lane 1) and downstream homologous sequence (lane 2) of the target gene Sala_1737 provided for the examples.

[0016] Figure 3 Gel electrophoresis diagram of the upstream homologous sequence (lane 1) and downstream homologous sequence (lane 2) of the target gene Sala_2677 provided for the examples.

[0017] Figure 4 Colony PCR verification gel electrophoresis diagram of the knockout plasmid PAK405-Cm-Δ1737 provided for the examples. Except for lanes 7, 8, 14, 17, 18, 19, 20, the remaining lanes are all positive colony samples of Escherichia coli carrying the knockout plasmid PAK405-Cm-Δ1737.

[0018] Figure 5 Colony PCR verification gel electrophoresis diagram of the knockout plasmid PAK405-Cm-Δ2677 provided for the examples. Except for lanes 4, 14, 19, 21, the remaining lanes are all positive colony samples of Escherichia coli carrying the knockout plasmid PAK405-Cm-Δ2677.

[0019] Figure 6 Colony PCR electrophoresis detection diagram of positive colonies of homologous recombination between the conjugation donor bacterium containing the knockout plasmid PAK405-Cm-Δ1737 and Sphingomonas alaskensis RB2256 provided for the examples. Lanes 1-15 are all positive colonies of Sphingomonas alaskensis RB2256 carrying the knockout plasmid PAK405-Cm-Δ1737 obtained by chloramphenicol resistance screening.

[0020] Figure 7 Colony PCR electrophoresis detection diagram of positive colonies of homologous recombination between the conjugation donor bacterium containing the knockout plasmid PAK405-Cm-Δ2677 and Sphingomonas alaskensis RB2256 provided for the examples. Lanes 1-19 are all positive colonies of Sphingomonas alaskensis RB2256 carrying the knockout plasmid PAK405-Cm-Δ2677 obtained by chloramphenicol resistance screening.

[0021] Figure 8 Colony PCR electrophoresis detection diagram of positive colonies of streptomycin counter-selection for the knockout of the Sala_1737 gene in Sphingomonas alaskensis RB2256 provided for the examples. Lanes 1-20 are all sample solutions of Sphingomonas alaskensis RB2256 with the Sala_1737 gene knocked out.

[0022] Figure 9 Colony PCR electrophoresis detection map of streptomycin counter-selection positive colonies with the Sala_2677 gene knocked out in Sphingopyxis alaskensis RB2256 provided for the example. Lanes 1-16 are all sample solutions of Sphingopyxis alaskensis with the Sala_2677 gene knocked out.

[0023] Figure 10 Schematic diagrams of the PAK405 plasmid and the PAK405-Cm plasmid provided for the example. Detailed implementation manners

[0024] In order to make the objectives, technical solutions and advantages of the present application clearer and more understandable, the present application will be further described in detail below in conjunction with examples. It should be understood that the specific examples described herein are only used to explain the present application and are not used to limit the present application. Reagents not described in detail and separately in the present application are all conventional reagents and can be obtained from commercial channels; methods not described in detail and particularly are all conventional experimental methods and can be learned from the prior art.

[0025] The example provides a knockout plasmid, a kit and a method for knocking out the Sala_1737 gene or the Sala_2677 gene of Sphingopyxis alaskensis RB2256. Among them, the kit includes the knockout plasmid. The method includes the step of transferring the knockout plasmid into Sphingopyxis alaskensis RB2256.

[0026] The example provides a scarless knockout plasmid. The knockout plasmid includes the PAK405 plasmid sequence shown in SEQ ID NO: 1; the sequence shown in SEQ ID NO: 2 inserted between the BglII restriction enzyme site and the ApaI restriction enzyme site of the PAK405 plasmid; and the upstream homologous sequence and the downstream homologous sequence inserted between the BamHI restriction enzyme site and the SalI restriction enzyme site of the PAK405 plasmid. Among them, both the upstream homologous sequence and the downstream homologous sequence are homologous to the genomic sequence of Sphingopyxis alaskensis RB2256.

[0027] In some examples, the upstream homologous sequence is homologous to the nucleotide sequence of the upstream 800 nt of the Sala_1737 gene of Sphingopyxis alaskensis RB2256, the downstream homologous sequence is homologous to the nucleotide sequence of the downstream 800 nt of the Sala_1737 gene of Sphingopyxis alaskensis RB2256, and the ID number of the Sala_1737 gene is ABF53450.1.

[0028] In some embodiments, the upstream homologous sequence is homologous to the nucleotide sequence of 800 nt upstream of the Sala_2677 gene of Sphingomonas alaskensis RB2256, the downstream homologous sequence is homologous to the nucleotide sequence of 800 nt downstream of the Sala_2677 gene of Sphingomonas alaskensis RB2256, and the ID number of the Sala_2677 gene is ABF54382.1.

[0029] In some embodiments, the knockout plasmid is prepared by inserting the upstream homologous sequence and the downstream homologous sequence into a basic plasmid. The basic plasmid (PAK405-Cm, SEQ ID NO: 31) is prepared by inserting the sequence shown in SEQ ID NO: 2 from the suicide plasmid pDM4 into the original plasmid PAK405. Among them, the suicide plasmid pDM4 can be referred to the literature in JBacteriol. 1996, 178(5): 1310-9 and Figure 1 provided. The original plasmid is PAK405 and can be prepared according to "Kaczmarczyk A, Vorholt JA, Francez-Charlot A. Markerless gene deletion system for sphingomonads. Applied and environmental microbiology. 2012, 78(10): 3774-3777. doi: 10.1128 / AEM.07347-11)".

[0030] In some embodiments, the preparation process of the basic plasmid PAK405-Cm includes:

[0031] 1) Prepare the sequence shown in SEQ ID NO: 2

[0032] Using Cm-BglII-F1 and Cm-ApaI-R1 as primer pairs, and using the PDM4 plasmid as a template for PCR amplification, the sequence shown in SEQ ID NO: 1 is obtained from the amplification product.

[0033] Among them, Cm-BglII-F1: gatctgatggcgcaggggatca AGATCT gaataaatacctgtgacgg, the underlined part is the BglII restriction enzyme sequence, SEQ ID NO: 3

[0034] Cm-ApaI-R1: cttcgcggcgatccgtcaaccat GGGCCC gaagcacacggtcacactgc, the underlined part is the ApaI restriction enzyme sequence, SEQ ID NO: 4

[0035] Among them, the PCR amplification system contains, based on 50 μL: 45 μL of 1.1×S4 Fidelity PCR Mix, 2.0 μL of 10 μM upstream primer, 2.0 μL of 10 μM downstream primer, and 1 μL of PDM4. The PCR amplification steps include: pre-denaturation at 98 °C for 2 min; denaturation at 98 °C for 10 sec, annealing at 55 °C for 15 sec, extension at 72 °C for 15 sec, for 30 cycles; extension at 72 °C for 5 min, and hold at 4 °C indefinitely. In addition, the PCR amplification product is detected by agarose gel electrophoresis, and the upstream homologous sequence and downstream homologous sequence are recovered and stored at -20 °C.

[0036] 2) Digest PAK405 with enzymes

[0037] The PAK405 plasmid is digested with BglII and ApaI, and the linearized PAK405 fragment is recovered from the digestion product. Among them, the enzyme digestion reaction system contains, based on 30 μL: 10 μL of PAK405, 3 μL of 10×Fast digest green buffer, 1 μL of BglII, 1 μL of ApaI, and the balance of ddH 2 O.

[0038] 3) Gibson assembly

[0039] The fragment of SEQ ID NO:2 is ligated to the linearized PAK405 fragment by Gibson assembly. The ligation product is transformed into competent Escherichia coli DH5α, positive colonies are screened, and verified by colony PCR to obtain positive transformants. The basic plasmid PAK405-Cm is extracted from the verified positive transformants. Among them, the colony PCR primers are shown as SEQ ID NO:5 and 6. As Figure 1 shown, if the electrophoresis band of the colony PCR product is between 1000 - 1500 bp, the corresponding colony is a positive colony.

[0040] Among them, the Gibson assembly reaction system contains, based on 10 μL: 4 μL of 2×MultiF Seamless Assembly Mix (RK21020 from ABclonal Technology), 2 μL of linearized PAK405, 2 μL of the fragment of SEQ ID NO:1, and 1 μL of double-distilled water. The Gibson assembly reaction is carried out in a 50 °C metal bath for 50 min.

[0041] Some embodiments provide knockout plasmids for the Sala_1737 gene or the Sala_2677 gene. The construction method of the knockout plasmid includes:

[0042] (1) Synthesize the upstream homologous sequence and the downstream homologous sequence

[0043] The genome of Sphingomonas alaskensis RB2256 (BJ-J4148, Bangjing) was extracted as a template, and in vitro PCR amplification was performed with the primer pair Sala_1737-left flank-F1 (SEQ ID NO.7) and Sala_1737-left flank-R1 (SEQ ID NO.8) to obtain the upstream homologous sequence shown in SEQ ID NO.9; in vitro PCR amplification was performed with the primer pair Sala_1737-rightflank-F1 (SEQ ID NO.10) and Sala_1737-right flank-R1 (SEQ ID NO.11) to obtain the downstream homologous sequence shown in SEQ ID NO.12. As Figure 2 shown, the upstream homologous sequence and the downstream homologous sequence of the target gene Sala_1737 were obtained.

[0044] Sala_1737-left flank-F1: cgaattcgagctcggtacccggGGATCCCaatcgcggacttgccacg

[0045] Sala_1737-left flank-R1: gacgcaaggggcccggttcGtgggagcgagcgccagcgaa

[0046] Sala_1737-right flank-F1: ttcgctggcgctcgctcccaCgaaccgggccccttgcgtc

[0047] Sala_1737-right flank-R1: gtgccaagcttgcatgcctgcagGTCGACcgcggcgccgccgcacgtcg

[0048] The genome of Sphingomonas alaskensis RB2256 (BJ-J4148, Bangjing) was extracted as a template, and in vitro PCR amplification was performed with the primer pair Sala_2677-left flank-F1 (SEQ ID NO.13) and Sala_2677-left flank-R1 (SEQ ID NO.14) to obtain the upstream homologous sequence shown in SEQ ID NO.15; in vitro PCR amplification was performed with the primer pair Sala_2677-rightflank-F1 (SEQ ID NO.16) and Sala_2677-right flank-R1 (SEQ ID NO.17) to obtain the downstream homologous sequence shown in SEQ ID NO.18. AsFigure 3 As shown, the upstream homologous sequence and downstream homologous sequence of the target gene Sala_2677 were obtained.

[0049] Sala_2677-left flank-F1: cgaattcgagctcggtacccgg GGATCC Gatttcggcggtcagcgcc

[0050] Sala_2677-left flank-R1: gaagcgggcggaaccaaccgctgtcgcccttggcgcgcata

[0051] Sala_2677-right flank-F1: tatgcgcgccaagggcgacagcggttggttccgcccgcttc

[0052] Sala_2677-right flank-R1: gtgccaagcttgcatgcctgcag GTCGAC catgcccagcagtgcaaagg

[0053] Among them, the PCR amplification system contains, based on 50 μL: 45.0 μL of 1.1×S4 Fidelity PCR Mix, 2.0 μL of 10 μM upstream primer, 2.0 μL of 10 μM downstream primer, and 1 μL of Sphingomonas alaskensis RB2256 genomic template. The PCR amplification steps include: pre-denaturation at 98°C for 2 min; denaturation at 98°C for 10 sec, annealing at 55°C for 15 sec, extension at 72°C for 15 sec, for 35 cycles; extension at 72°C for 5 min, hold at 4°C indefinitely. In addition, the PCR amplification products were detected by agarose gel electrophoresis, and the upstream homologous sequence and downstream homologous sequence were recovered and stored at -20°C.

[0054] (2) Digest PAK405-Cm with enzymes

[0055] The plasmid PAK405-Cm was digested with BamHI and SalI simultaneously at 37°C in a water bath for 1.5 h. After detection by agarose gel electrophoresis, the digested products were recovered by cutting the gel to obtain linearized PAK405-Cm, which was stored at -20°C. Among them, the enzyme digestion reaction system contains, based on 30 μL: 10 μL of PAK405-Cm, 3 μL of 10×Fast digest green buffer, 1 μL of BamHI, 1 μL of SalI, and 15 μL of ddH 2 O.

[0056] (3) Gibson assembly

[0057] The upstream homologous sequence and the downstream homologous sequence were assembled with linearized PAK405-Cm through Gibson assembly reaction to obtain a ligation fragment. The Gibson assembly reaction system contained, in a volume of 10 μL: 5 μL of 2×MultiF Seamless Assembly Mix (RK21020 from ABclonal Technology), 2 μL of linearized PAK405-Cm, 1 μL of upstream homologous sequence, 1 μL of upstream homologous sequence, and 1 μL of double-distilled water. The Gibson assembly reaction was carried out in a 50 °C metal bath for 50 min.

[0058] (4) Transformation, screening, verification, and extraction to obtain the knockout plasmid

[0059] The reaction product of Gibson assembly was transformed into competent Escherichia coli DH5α, positive colonies were screened, and verified by colony PCR to obtain positive transformants. The knockout plasmids PAK405-Cm-Δ1737 and PAK405-Cm-Δ2677 were extracted from the verified positive transformants.

[0060] As Figure 4 shown, if the electrophoresis band of the colony PCR product was between 1000 - 1500 bp, the corresponding colony was a positive colony, which was Sphingomonas alaskensis containing the gene for knocking out Sala_1737. The knockout plasmid PAK405-Cm-Δ1737 was extracted from this positive colony.

[0061] As Figure 5 shown, if the electrophoresis band of the colony PCR product was between 1000 - 1500 bp, the corresponding colony was a positive colony, which was Sphingomonas alaskensis containing the gene for knocking out Sala_2677. The knockout plasmid PAK405-Cm-Δ2677 was extracted from this positive colony.

[0062] In some embodiments, the colony PCR reaction system contained, in a volume of 25 μL: 12.5 μL of 2×GS Taq PCR Mix, 1.0 μL of 10 μM upstream primer, 1.0 μL of 10 μM downstream primer, and 10.5 μL of ddH 2O. The colony PCR amplification steps include: pre-denaturation at 95°C for 3 min; denaturation at 94°C for 25 sec, annealing at 55°C for 25 sec, extension at 72°C for 30 sec, for 35 cycles; extension at 72°C for 5 min, and hold at 4°C. Among them, the colony PCR primer pairs for detecting the knockout plasmid PAK405-Cm-Δ1737 are Sala_1737-F2 (SEQ ID NO.19) and Sala_1737-R2 (SEQ ID NO.20), and the colony PCR primer pairs for detecting the knockout plasmid PAK405-Cm-Δ2677 are Sala_2677-F2 (SEQ ID NO.21) and Sala_2677-R2 (SEQ ID NO.22).

[0063] The examples disclose a method for knocking out a target region of the Sphingomonas alaskensis RB2256 genome, which includes obtaining the knockout plasmid described in the first aspect; obtaining a conjugation donor bacterium containing the knockout plasmid; performing homologous recombination between the activated conjugation donor bacterium and Sphingomonas alaskensis RB2256; and screening the positive colonies obtained by the homologous recombination with streptomycin, thereby knocking out the target region of Sphingomonas alaskensis RB2256.

[0064] In some examples, the conjugation donor bacterium is Escherichia coli ST18λpair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λpair containing PAK405-Cm-Δ2677.

[0065] In some examples, the steps of homologous recombination include:

[0066] 1) Overnight culture Escherichia coli ST18λpair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λpair containing PAK405-Cm-Δ2677 at 37°C in LB medium containing 50 μg / mL ALA and 25 μg / mL chloramphenicol, and transfer the culture the next day. Culture Sphingomonas alaskensis RB2256 in LB medium at 30°C.

[0067] 2) When the culture broth of Escherichia coli ST18λ pair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λ pair containing PAK405-Cm-Δ2677 is close to the OD600 of the culture broth of Sphingomonas alaskensis RB2256, take 2 mL of each and mix them. Then centrifuge at 12,000 rpm for 2 min. Take the cell precipitate of Escherichia coli ST18λ pair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λ pair containing PAK405-Cm-Δ2677 and wash it twice with 1.5 mL of LB containing 50 μg / mL ALA. After centrifuging the cell precipitate of Sphingomonas alaskensis RB22, discard the supernatant and keep the precipitate.

[0068] 3) Resuspend the washed cell precipitate of Escherichia coli ST18λ pair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λ pair containing PAK405-Cm-Δ2677 separately with 100 μL of LB medium containing 50 μg / mL ALA at the final concentration. Then mix them with the washed cell precipitate of Sphingomonas alaskensis RB2256 respectively. Centrifuge the obtained mixture at 12,000 rpm for 3 min to obtain a mixed precipitate. Resuspend it again with 100 μL of LB medium containing 50 μg / mL ALA at the final concentration. Inoculate the obtained resuspended mixed precipitate solution onto the filter paper on the LB plate containing 50 μg / mL ALA. Incubate in a 30 °C incubator for 24 h, then take the filter paper. Resuspend the colonies on the filter paper with 500 μL of LB. Screen the colonies with the obtained resuspended bacterial solution on the chloramphenicol resistance plate. Verify the obtained screened colonies by colony PCR.

[0069] Among them, the primers for colony PCR are as follows:

[0070] Sala_1737-F3:gtgccgacgatgtcgatctg, SEQ ID NO.23

[0071] Sala_1737-R3:gccgttcattaacgggctgc, SEQ ID NO.24

[0072] Sala_2677-F3:ggagcagattgtcgtcggag, SEQ ID NO.25

[0073] Sala_2677-R3:cgtaaagcgtaacaaccagc, SEQ ID NO.26

[0074] If the electrophoresis band of the colony PCR product is 894 bp, it is a positive colony in which the conjugative donor bacterium containing the knockout plasmid PAK405-Cm-Δ1377 has undergone homologous recombination with Sphingomonas alaskensis RB2256. As Figure 6 can be seen, the band sizes in lanes 1-15 are all correct, and the conjugation positive rate is 100%.

[0075] If the electrophoresis band of the colony PCR product is 943 bp, it is a positive colony in which the conjugative donor bacterium containing the knockout plasmid PAK405-Cm-Δ2677 has undergone homologous recombination with Sphingomonas alaskensis RB2256. As Figure 7 can be seen, except for lane 11, the band sizes in the remaining lanes are all correct, and the conjugation positive rate is 90%.

[0076] In some embodiments, the steps of streptomycin screening include: after activating the positive colonies obtained in the homologous recombination step in LB for 15 h, diluting and spreading them on a resistance plate containing 100 μg / mL streptomycin, and placing them in an incubator at 30 °C for about 3 days. After single colonies grow out, the target knockout bacteria after successful double exchange are verified by primers at both ends of the genomic DNA outside the homologous arms to exclude the possibility of wild-type bacteria appearing after the second homologous recombination. Among them, the colony PCR verification primers are as follows:

[0077] Sala_1737-F4: gtcgaaattgggggaccagc, SEQ ID NO.27

[0078] Sala_1737-R4: ccagagcgtctatcgttacg, SEQ ID NO.28

[0079] Sala_2677-F4: gatgaccggcgccggatgcg, SEQ ID NO.29

[0080] Sala_2677-R4: cagcctgcggaccaacaccg, SEQ ID NO.30

[0081] If the electrophoresis band of the colony PCR product is 1954 bp, it is a positive colony of the streptomycin reverse screening positive colony with the Sala_1737 gene knocked out in Sphingomonas alaskensis RB2256. As Figure 8 shown, lanes 6, 14, and 16 are all Sphingomonas alaskensis RB2256 with the Sala_1737 gene correctly knocked out.

[0082] If the electrophoresis band of the colony PCR product is 1873 bp, it is a positive colony of the streptomycin counter-selection positive colony with the Sala_2677 gene knocked out in Sphingomonas alaskensis RB2256. As Figure 9 shown, lanes 1, 2, 6, 7, 12, 13, and 14 are all Sphingomonas alaskensis RB2256 with the Sala_1737 gene knocked out and the correct band of the Sala_2677 gene.

[0083] As described above, it is only a preferred specific embodiment of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed in the present application should be covered within the protection scope of the present application.

Claims

1. A knockout plasmid, comprising: The plasmid sequence of PAK405 as shown in SEQ ID NO: 1; The sequence shown in SEQ ID NO: 2 is inserted between the BglII restriction site and the ApaI restriction site of the PAK405 plasmid; and The upstream homologous sequence and the downstream homologous sequence are inserted between the BamHI restriction site and the SalI restriction site of the PAK405 plasmid; wherein the upstream homologous sequence and the downstream homologous sequence are both homologous to the genome sequence of Sphingopyxis alaskensis RB2256.

2. The knockout plasmid according to claim 1, wherein the upstream homologous sequence is homologous to the nucleotide sequence of the upstream 800nt of the Sala_1737 gene of Alaska Sphingobacterium RB2256, and the downstream homologous sequence is homologous to the nucleotide sequence of the downstream 800nt of the Sala_1737 gene of Alaska Sphingobacterium RB2256, and the Sala_1737 gene ID number is ABF53450.

1.

3. The knockout plasmid according to claim 1, wherein the upstream homologous sequence is homologous to the nucleotide sequence of the upstream 800nt of the Sala_2677 gene of Alaska Sphingobacterium RB2256, and the downstream homologous sequence is homologous to the nucleotide sequence of the downstream 800nt of the Sala_2677 gene of Alaska Sphingobacterium RB2256, and the Sala_2677 gene ID number is ABF54382.

1.

4. The knockout plasmid according to claim 2, wherein the upstream homologous sequence is shown as SEQ ID NO.9, and the downstream homologous sequence is shown as SEQ ID NO.12; or the upstream homologous sequence is shown as SEQ ID NO.15, and the downstream homologous sequence is shown as SEQ ID NO.

18.

5. A kit comprising the knockout plasmid according to any one of claims 1 to 3 and Escherichia coli ST18.

6. A kit comprising Escherichia coli ST18 transformed with the knockout plasmid according to any one of claims 1 to 3.

7. A method for knocking out a target region of the genome of Sphingobacterium alaskaense RB2256, comprising: Obtaining a knockout plasmid as claimed in any one of claims 1 to 4; obtaining a conjugative donor bacterium containing the knockout plasmid; The activated conjugation donor bacteria are subjected to homologous recombination with Sphingobacterium alaska RB2256; The positive colonies obtained through homologous recombination are then screened by streptomycin to knock out the target region of Sphingobacterium alaska RB2256.

8. The method according to claim 8, wherein: The target region is the Sala_1737 gene or the Sala_2677 gene of Sphingobacterium alaska RB2256.

9. Use of the knockout plasmid according to any one of claims 1 to 4 or the kit according to any one of claims 6 to 7 in knocking out the Sala_1737 gene or the Sala_2677 gene of Sphingobacterium alaska RB2256.

Citation Information

Patent Citations

  • Process for the manipulation of nucleic acids

    CN110914432A

  • Recombinant genetically engineered bacterium as well as construction method and application thereof

    CN116410912A

  • Knockout plasmid, kit, method and application of vibrio natriticus

    CN118726433A