Knockout plasmid, kit, method and application of alaskabacillus

By constructing knockout plasmids and kits, and utilizing homologous recombination and streptomycin screening methods, we achieved precise and efficient gene knockout in Alaskan sphingosine monocytogenes RB2256, solving the gene knockout problem that is difficult to achieve in existing technologies, and promoting research on cell growth, metabolic regulation and environmental adaptation.

CN120138014BActive Publication Date: 2026-05-19HUAZHONG NORMAL UNIV
View PDF 2 Cites 0 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
HUAZHONG NORMAL UNIV
Filing Date
2025-03-12
Publication Date
2026-05-19

AI Technical Summary

Technical Problem

Existing technologies make it difficult to achieve precise, efficient, and scarless knockout of target genes in Alaskan sphingosine bacteria, which affects research on cell growth, metabolic regulation, and environmental adaptation.

Method used

Using knockout plasmids and kits, a gene deletion mutant strain of Alaska sphingosine monophosphate RB2256 was constructed through homologous recombination and streptomycin screening. Gene knockout was then performed using PAK405 plasmid and Escherichia coli ST18, achieving precise and efficient gene knockout.

Benefits of technology

Precise and efficient gene knockout in Alaskan sphingosine bacteria was achieved, enabling in-depth research into its specific role in cell growth, metabolic regulation, and environmental adaptation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138014B_ABST
    Figure CN120138014B_ABST
Patent Text Reader

Abstract

The application relates to a knockout plasmid, a kit, a method and application of Alaska sphingobium. The knockout plasmid, the kit, the method and the application of Alaska sphingobium can realize stable genetic operation in Alaska sphingobium RB2256, and achieve scarless knockout of genes.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This application relates to the field of gene editing technology of Sphingosine Bacteria in Alaska, specifically to knockout plasmids, kits, methods, and applications of Sphingosine Bacteria in Alaska. Background Technology

[0002] *Sphingopyxis alaskensis* is a non-spore-forming, Gram-negative bacterium. It reproduces through fission, is heterotrophic, requires oxygen to grow, does not require sunlight, and is positive for contact enzymes. The optimal growth temperature is around 30°C, and the optimal pH is around 7.0. No growth factors or other nutrients are required during its growth.

[0003] β-glucosidase derived from *Sphingosine Monopodioides alaska*, through mutations such as N166S / E351A or Q20E, exhibits enhanced catalytic activity and / or thermal stability, along with reduced substrate inhibition. This allows for one-step conversion of common ginsenosides like Rb1 and Rd into rarer ginsenosides such as Rh2 and Rg3, providing favorable conditions for large-scale industrial production of ginsenosides. Strains of the *Sphingosine Monopodioides* genus possess the ability to degrade aromatic compounds in environmental protection. *Sphingosine Monopodioides alaska*, as a type of *Sphingosine Monopodioides*, may also have similar potential for degrading organic pollutants, such as polycyclic aromatic hydrocarbons (PAHs), making it valuable for research in environmental remediation. Summary of the Invention

[0004] This application provides knockout plasmids, kits, methods, and applications for *Sphingosine mononitrate* strain Alaska. These knockout plasmids, kits, methods, and applications enable precise, efficient, and traceless knockout of target genes in this strain, allowing for the construction of various gene-deletion mutant strains. This, in turn, facilitates in-depth investigation of the specific roles of different genes in *Sphingosine mononitrate* RB2256 in cell growth, metabolic regulation, environmental adaptation, and many other aspects.

[0005] Therefore, the embodiments of this application disclose at least the following technical solutions:

[0006] In this embodiment, an example discloses a knockout plasmid, comprising the PAK405 plasmid sequence as shown in SEQ ID NO:1; a sequence as shown in SEQ ID NO:2 inserted between the BglII restriction site and the ApaI restriction site of the PAK405 plasmid; and an upstream homologous sequence and a downstream homologous sequence inserted between the BamHI restriction site and the SalI restriction site of the PAK405 plasmid; wherein the upstream homologous sequence and the downstream homologous sequence are both homologous to the genome sequence of Sphingopyxis alaskensis RB2256.

[0007] In some embodiments, the upstream homologous sequence is homologous to the upstream 800 nt nucleotide sequence of the Sala_1737 gene of Sphingosine monophosphate RB2256, and the downstream homologous sequence is homologous to the downstream 800 nt nucleotide sequence of the Sala_1737 gene of Sphingosine monophosphate RB2256, wherein the Sala_1737 gene is located at 1829693-1830805 nt of CP000356.1 in the genome of Sphingosine monophosphate RB2256.

[0008] In some embodiments, the upstream homologous sequence is homologous to the upstream 800 nt nucleotide sequence of the Sala_2677 gene of Sphingosine monophosphate RB2256, and the downstream homologous sequence is homologous to the downstream 800 nt nucleotide sequence of the Sala_2677 gene of Sphingosine monophosphate RB2256, wherein the Sala_2677 gene is located at 2822946-2825048 nt of CP000356.1 in the genome of Sphingosine monophosphate RB2256.

[0009] Secondly, an embodiment discloses a kit. This kit includes the knockout plasmid described in this embodiment and *E. coli* ST18.

[0010] Thirdly, an embodiment discloses a kit. This kit comprises *E. coli* ST18 transformed with the aforementioned knockout plasmid.

[0011] Fourthly, the embodiments disclose a method for knocking out a target region of the genome of *Sphingosine monocytogenes* RB2256, comprising obtaining the knockout plasmid described in the first aspect; obtaining a conjugation donor bacterium containing the knockout plasmid; performing homologous recombination between the activated conjugation donor bacterium and *Sphingosine monocytogenes* RB2256; and further screening the positive colonies obtained from the homologous recombination with streptomycin to knock out the target region of *Sphingosine monocytogenes* RB2256.

[0012] In some embodiments, the target region is the Sala_1737 gene or the Sala_2677 gene of Sphingosine monocytogenes RB2256 from Alaska.

[0013] Fifthly, the examples disclose the application of the knockout plasmids described in the first aspect or the kits described in the second aspect in the knockout of the Sala_1737 or Sala_2677 gene in Sphingosine monocytogenes RB2256 in Alaska. Attached Figure Description

[0014] Figure 1The image shows a gel electrophoresis diagram of colony PCR verification of the basic plasmid PAK405-Cm provided in the example. Lanes 1 to 20 are all positive colony samples of the constructed basic plasmid PAK405-Cm.

[0015] Figure 2 Gel electrophoresis images of the upstream homologous sequence (lane 1) and downstream homologous sequence (lane 2) of the target gene Sala_1737 provided for the example.

[0016] Figure 3 Gel electrophoresis images of the upstream homologous sequence (lane 1) and downstream homologous sequence (lane 2) of the target gene Sala_2677 provided for the example.

[0017] Figure 4 The image shown is a gel electrophoresis diagram of colony PCR verification of the knockout plasmid PAK405-Cm-Δ1737 provided in the example. Except for lanes 7, 8, 14, 17, 18, 19, and 20, the other lanes are all Escherichia coli positive colony samples carrying the knockout plasmid PAK405-Cm-Δ1737.

[0018] Figure 5 The image shown is a gel electrophoresis diagram of colony PCR verification of the knockout plasmid PAK405-Cm-Δ2677 provided in the example. Except for lanes 4, 14, 19, and 21, all other lanes are positive Escherichia coli colony samples carrying the knockout plasmid PAK405-Cm-Δ2677.

[0019] Figure 6 The image shows a colony PCR electrophoresis detection of positive colonies of conjugation donor bacteria containing the knockout plasmid PAK405-Cm-Δ1737 and Alaska sphingosine monophosphate RB2256, provided in the example. Lanes 1 to 15 are all Alaska sphingosine monophosphate RB2256 positive colonies carrying the knockout plasmid PAK405-Cm-Δ1737, obtained through chloramphenicol resistance screening.

[0020] Figure 7 The image shows a colony PCR electrophoresis detection of positive colonies of conjugation donor bacteria containing the knockout plasmid PAK405-Cm-Δ2677 and Alaska sphingosine monophosphate RB2256, provided in the example. Lanes 1-19 are all Alaska sphingosine monophosphate RB2256 positive colonies carrying the knockout plasmid PAK405-Cm-Δ2677, obtained through chloramphenicol resistance screening.

[0021] Figure 8 The image shows the colony PCR electrophoresis detection of streptomycin-reactive streptomycin-positive colonies in Sala_1737 gene knockout of Sphingosine Alaska provided in the example. Lanes 1 to 20 are all Sala_1737 gene knockout Alaskan sphingosine Alaska sample solutions.

[0022] Figure 9 The image shows the colony PCR electrophoresis detection of streptomycin-positive colonies with the Sala_2677 gene knocked out in Sphingosine Alaska RB2256 provided in the example. Lanes 1 to 16 are all Sala_2677 gene knocked out Alaskan sphingosine Alaska sample solutions.

[0023] Figure 10 The diagram shows the structure of the PAK405 plasmid and PAK405-Cm plasmid provided in the examples. Detailed Implementation

[0024] To make the objectives, technical solutions, and advantages of this application clearer, the following detailed description is provided in conjunction with embodiments. It should be understood that the specific embodiments described herein are merely illustrative and not intended to limit the scope of this application. Reagents not specifically described in detail herein are all conventional reagents and are commercially available; methods not specifically described in detail are all conventional experimental methods and can be learned from the prior art.

[0025] The examples provide a knockout plasmid, kit, and method for knocking out the Sala_1737 or Sala_2677 gene in Sphingopyxis alaskensis RB2256. The kit includes the knockout plasmid. The method includes the step of transferring the knockout plasmid into Sphingopyxis alaskensis RB2256.

[0026] This embodiment provides a traceless knockout plasmid. The knockout plasmid includes the PAK405 plasmid sequence as shown in SEQ ID NO:1; the sequence shown in SEQ ID NO:2 inserted between the BglII and ApaI restriction sites of the PAK405 plasmid; and upstream and downstream homologous sequences inserted between the BamHI and SalI restriction sites of the PAK405 plasmid. Both the upstream and downstream homologous sequences are homologous to the genome sequence of *Sphingopyxis alaskensis* RB2256.

[0027] In some embodiments, the upstream homologous sequence is homologous to the upstream 800 nt nucleotide sequence of the Sala_1737 gene of Sphingosine monophosphate RB2256 in Alaska, and the downstream homologous sequence is homologous to the downstream 800 nt nucleotide sequence of the Sala_1737 gene of Sphingosine monophosphate RB2256 in Alaska, wherein the Sala_1737 gene ID number is ABF53450.1.

[0028] In some embodiments, the upstream homologous sequence is homologous to the upstream 800 nt nucleotide sequence of the Sala_2677 gene of Sphingosine monophosphate RB2256 in Alaska, and the downstream homologous sequence is homologous to the downstream 800 nt nucleotide sequence of the Sala_2677 gene of Sphingosine monophosphate RB2256 in Alaska, wherein the Sala_2677 gene ID number is ABF54382.1.

[0029] In some embodiments, the knockout plasmid is prepared by inserting upstream and downstream homologous sequences into a base plasmid. The base plasmid (PAK405-Cm, SEQ ID NO:31) is prepared by inserting the sequence shown in SEQ ID NO:2 from the suicide plasmid pDM4 into the original plasmid PAK405. The suicide plasmid pDM4 can be found in JBacteriol. 1996, 178(5):1310-9. Figure 1 Provided. The original plasmid is PAK405, which can be prepared according to "KaczmarczykA,Vorholt JA,Francez-Charlot A. Markerless gene deletion system for sphingomonads.Applied and environmental microbiology.2012,78(10):3774-3777.doi:10.1128 / AEM.07347-11".

[0030] In some embodiments, the preparation process of the basic plasmid PAK405-Cm includes:

[0031] 1) Prepare the sequence shown in SEQ ID NO:2

[0032] Using Cm-BglII-F1 and Cm-ApaI-R1 as primer pairs and PDM4 plasmid as template, PCR amplification was performed, and the sequence shown in SEQ ID NO:1 was obtained from the amplification product.

[0033] Among them, Cm-BglII-F1:gatctgatggcgcaggggatca AGATCT gaataaatacctgtgacgg, the underlined part is the BglII restriction enzyme sequence, SEQ ID NO:3

[0034] Cm-ApaI-R1:cttcgcggcgatccgtcaaccat GGGCCC gaagcacacggtcacactgc, the underlined part is the ApaI restriction enzyme sequence, SEQ ID NO:4

[0035] The PCR amplification system, in 50 μL increments, contained: 45 μL of 1.1×S4 Fidelity PCR Mix, 2.0 μL of 10 μM upstream primer, 2.0 μL of 10 μM downstream primer, and 41 μL of PDM. The PCR amplification steps included: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 sec, 55℃ for 15 sec, 72℃ extension for 15 sec, 30 cycles; 72℃ for 5 min, 4℃ infinite. The PCR amplification products were detected by agarose gel electrophoresis, and the upstream and downstream homologous sequences were recovered and stored at -20℃.

[0036] 2) Enzyme digestion of PAK405

[0037] The PAK405 plasmid was double-digested with BglII and ApaI, and the linearized PAK405 fragment was recovered from the digestion products. The digestion reaction system, in 30 μL volumes, contained: 10 μL PAK405, 3 μL 10×Fast digestgreen buffer, 1 μL BglII, 1 μL ApaI, and the remainder ddH2O.

[0038] 3) Gibson Assembly

[0039] The fragment shown in SEQ ID NO:2 was ligated to the linearized PAK405 fragment using Gibson assembly. The ligation product was transformed into competent Escherichia coli DH5α cells, and positive colonies were screened. Positive transformants were obtained by colony PCR verification, and the basal plasmid PAK405-Cm was extracted from the verified positive transformants. The colony PCR primers are shown in SEQ ID NO:5 and 6. Figure 1 As shown, if the electrophoretic band of the colony PCR product is between 1000 and 1500 bp, the corresponding colony is a positive colony.

[0040] The Gibson assembly reaction system, in 10 μL increments, contained: 4 μL of 2×MultiF Seamless Assembly Mix (ABclonal Technology's RK21020), 2 μL of linearized PAK405, 2 μL of the fragment as shown in SEQ ID NO:1, and 1 μL of double-distilled water. The Gibson assembly reaction was carried out in a 50°C metal bath for 50 min.

[0041] Some embodiments provide knockout plasmids for the Sala_1737 or Sala_2677 gene. The method for constructing the knockout plasmid includes:

[0042] (1) Synthesize upstream and downstream homologous sequences.

[0043] The genome of *Sphingosine monocytogenes* RB2256 (BJ-J4148, Bangjing) was extracted and used as a template. In vitro PCR amplification was performed using primer pairs *Sala_1737-left flank-F1* (SEQ ID NO. 7) and *Sala_1737-left flank-R1* (SEQ ID NO. 8) to obtain the upstream homologous sequence shown in SEQ ID NO. 9. In vitro PCR amplification was performed using primer pairs *Sala_1737-right flank-F1* (SEQ ID NO. 10) and *Sala_1737-right flank-R1* (SEQ ID NO. 11) to obtain the downstream homologous sequence shown in SEQ ID NO. 12. Figure 2 As shown, the upstream and downstream homologous sequences of the target gene Sala_1737 were obtained.

[0044] Sala_1737-left flank-F1:cgaattcgagctcggtacccggGGATCCCaatcgcggacttgccacg

[0045] Sala_1737-left flank-R1:gacgcaaggggcccggttcGtgggagcgagcgccagcgaa

[0046] Sala_1737-right flank-F1:ttcgctggcgctcgctcccaCgaaccgggccccttgcgtc

[0047] Sala_1737-right flank-R1:gtgccaagcttgcatgcctgcagGTCGACcgcggcgccgccgcacgtcg

[0048] The genome of *Sphingosine monocytogenes* RB2256 (BJ-J4148, Bangjing) was extracted and used as a template. In vitro PCR amplification was performed using primer pairs *Sala_2677-left flank-F1* (SEQ ID NO.13) and *Sala_2677-left flank-R1* (SEQ ID NO.14) to obtain the upstream homologous sequence shown in SEQ ID NO.15. In vitro PCR amplification was performed using primer pairs *Sala_2677-right flank-F1* (SEQ ID NO.16) and *Sala_2677-right flank-R1* (SEQ ID NO.17) to obtain the downstream homologous sequence shown in SEQ ID NO.18. Figure 3As shown, the upstream and downstream homologous sequences of the target gene Sala_2677 were obtained.

[0049] Sala_2677-left flank-F1:cgaattcgagctcggtacccgg GGATCC Gatttcggcggtcagcgcc

[0050] Sala_2677-left flank-R1:gaagcgggcggaaccaaccgctgtcgcccttggcgcgcata

[0051] Sala_2677-right flank-F1:tatgcgcgccaagggcgacagcggttggttccgcccgcttc

[0052] Sala_2677-right flank-R1:gtgccaagcttgcatgcctgcag GTCGAC catgcccagcagtgcaaagg

[0053] The PCR amplification system, in 50 μL volumes, contained: 45.0 μL of 1.1×S4 Fidelity PCR Mix, 2.0 μL of 10 μM upstream primer, 2.0 μL of 10 μM downstream primer, and 1 μL of *Sphingosine monocytogenes* RB2256 genomic template. The PCR amplification steps included: 98℃ pre-denaturation for 2 min; 98℃ denaturation for 10 sec, 55℃ for 15 sec, 72℃ extension for 15 sec, 35 cycles; 72℃ for 5 min, 4℃ at infinity. The PCR amplification products were detected by agarose gel electrophoresis, and the upstream and downstream homologous sequences were recovered and stored at -20℃.

[0054] (2) Enzymatic digestion of PAK405-Cm

[0055] The plasmid PAK405-Cm was simultaneously digested with BamHI and SalI at 37°C for 1.5 h. After detection by agarose gel electrophoresis, the digestion products were recovered by gel excision to obtain linearized PAK405-Cm, which was stored at -20°C. The digestion reaction system, in 30 μL volumes, contained: 10 μL PAK405-Cm, 3 μL 10×Fast digest green buffer, 1 μL BamHI, 1 μL SalI, and 15 μL ddH2O.

[0056] (3) Gibson Assembly

[0057] The upstream and downstream homologous sequences were assembled with linearized PAK405-Cm via a Gibson assembly reaction to obtain the linker fragment. The Gibson assembly reaction system, per 10 μL, contained: 5 μL 2×MultiF Seamless AssemblyMix (ABclonal Technology RK21020), 2 μL linearized PAK405-Cm, 1 μL upstream homologous sequence, 1 μL upstream homologous sequence, and 1 μL double-distilled water. The Gibson assembly reaction was carried out in a 50°C metal bath for 50 min.

[0058] (4) Transformation, screening, validation and extraction to obtain knockout plasmids

[0059] The Gibson assembly reaction product was transformed into competent Escherichia coli DH5α cells, positive colonies were screened, and positive transformants were obtained by colony PCR verification. Knockout plasmids PAK405-Cm-Δ1737 and PAK405-Cm-Δ2677 were extracted from the verified positive transformants.

[0060] like Figure 4 As shown, if the electrophoretic band of the colony PCR product is between 1000 and 1500 bp, the corresponding colony is a positive colony, which is Alaskan sphingosine bacteria containing the Sala_1737 gene for knockout. The knockout plasmid PAK405-Cm-Δ1737 was extracted from this positive colony.

[0061] like Figure 5 As shown, if the electrophoretic band of the colony PCR product is between 1000 and 1500 bp, the corresponding colony is a positive colony, which is Alaska sphingosine bacteria containing the Sala_2677 gene for knockout. The knockout plasmid PAK405-Cm-Δ2677 is extracted from this positive colony.

[0062] In some embodiments, the colony PCR reaction system, in 25 μL volumes, contains: 12.5 μL of 2×GS Taq PCR Mix, 1.0 μL of 10 μM upstream primer, 1.0 μL of 10 μM downstream primer, and 10.5 μL of ddH2O. The colony PCR amplification steps include: 95°C pre-denaturation for 3 min; 94°C denaturation for 25 sec, 55°C for 25 sec, 72°C extension for 30 sec, 35 cycles; 72°C for 5 min, and 4°C hold. The colony PCR primer pairs used to detect the knockout plasmid PAK405-Cm-Δ1737 are Sala_1737-F2 (SEQ ID NO.19) and Sala_1737-R2 (SEQ ID NO.20), and the colony PCR primer pairs used to detect the knockout plasmid PAK405-Cm-Δ2677 are Sala_2677-F2 (SEQ ID NO.21) and Sala_2677-R2 (SEQ ID NO.22).

[0063] The embodiments disclose a method for knocking out a target region of the genome of *Sphingosine monocytogenes* RB2256, comprising obtaining the knockout plasmid described in the first aspect; obtaining a conjugation donor bacterium containing the knockout plasmid; performing homologous recombination between the activated conjugation donor bacterium and *Sphingosine monocytogenes* RB2256; and screening the positive colonies of the homologous recombination with streptomycin to knock out the target region of *Sphingosine monocytogenes* RB2256.

[0064] In some embodiments, the conjugation donor bacteria are Escherichia coli ST18λpair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λpair containing PAK405-Cm-Δ2677.

[0065] In some embodiments, the homologous recombination step includes:

[0066] 1) Incubate Escherichia coli ST18λpair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λpair containing PAK405-Cm-Δ2677 overnight at 37°C in LB medium containing 50 μg / mL LALA and 25 μg / mL chloramphenicol, and then transfer the culture the next day. Incubate Alaskan sphingosine monocytogenes RB2256 in LB medium at 30°C.

[0067] 2) When the OD600 of the culture medium containing either Escherichia coli ST18λpair (PAK405-Cm-Δ1737) or Escherichia coli ST18λpair (PAK405-Cm-Δ2677) is close to that of the culture medium of *Sphingosine monocytogenes* RB2256, take 2 mL of each and mix them. Centrifuge at 12000 rpm for 2 min. Take the bacterial pellet containing either Escherichia coli ST18λpair (PAK405-Cm-Δ1737) or Escherichia coli ST18λpair (PAK405-Cm-Δ2677) and wash twice with 1.5 mL of 50 μg / mL LB solution. After centrifuging the *Sphingosine monocytogenes* RB22 bacterial pellet, discard the supernatant and retain the pellet.

[0068] 3) The washed Escherichia coli ST18λpair containing PAK405-Cm-Δ1737 or Escherichia coli ST18λpair containing PAK405-Cm-Δ2677 were resuspended in 100 μL LLB medium with a final concentration of 50 μg / mL LALA. These were then mixed with washed Alaskan sphingosine monocytogenes RB2256 bacterial pellets. The resulting mixture was centrifuged at 12000 rpm for 3 min to obtain a mixed precipitate, which was then resuspended again in 100 μL LLB medium with a final concentration of 50 μg / mL LALA. The resuspended mixed precipitate was inoculated onto filter paper on LB agar plates containing 50 μg / mL LALA. After incubation at 30°C for 24 h, the filter paper was removed, and the colonies on the filter paper were resuspended in 500 μL LLB. The resuspended bacterial solution was screened for colonies on chloramphenicol-resistant plates, and the selected colonies were verified by colony PCR.

[0069] The primers for colony PCR are as follows:

[0070] Sala_1737-F3:gtgccgacgatgtcgatctg,SEQ ID NO.23

[0071] Sala_1737-R3:gccgttcattaacgggctgc, SEQ ID NO.24

[0072] Sala_2677-F3:ggagcagattgtcgtcggag, SEQ ID NO.25

[0073] Sala_2677-R3:cgtaaagcgtaacaaccagc, SEQ ID NO.26

[0074] If the electrophoretic band of the colony PCR product is 894 bp, it indicates a positive colony of conjugation donor bacteria containing the knockout plasmid PAK405-Cm-Δ1377 and Alaskan sphingosine monocytogenes RB2256 that has undergone homologous recombination. Figure 6 It can be seen that the size of lanes 1-15 is correct, and the conjugation positivity rate is 100%.

[0075] If the electrophoretic band of the colony PCR product is 943 bp, it indicates a positive colony of conjugation donor bacteria containing the knockout plasmid PAK405-Cm-Δ2677 and Alaskan sphingosine monocytogenes RB2256 that has undergone homologous recombination. Figure 7 It can be seen that, except for lane 11, the band sizes in the other lanes are correct, and the conjugation positivity rate is 90%.

[0076] In some embodiments, the streptomycin screening step includes: activating the positive colonies obtained from the homologous recombination step in LB broth for 15 hours, diluting and plating them onto antibiotic-resistant plates containing 100 μg / mL streptomycin, and incubating at 30°C for approximately 3 days. After single colonies have grown, the target knockout bacteria are verified by using primers at both ends of the genome on the outer side of the homologous arm to confirm successful double recombination, thus ruling out the possibility of wild-type bacteria appearing after a second homologous recombination. The colony PCR verification primers are as follows:

[0077] Sala_1737-F4:gtcgaaattgggggaccagc, SEQ ID NO.27

[0078] Sala_1737-R4:ccagagcgtctatcgttacg, SEQ ID NO.28

[0079] Sala_2677-F4:gatgaccggcgccggatgcg, SEQ ID NO.29

[0080] Sala_2677-R4:cagcctgcggaccaacaccg, SEQ ID NO.30

[0081] If the electrophoretic band of the colony PCR product is 1954 bp, then it is a positive colony of streptomycin reverse screening colony with the Sala_1737 gene knocked out in Sphingosine monophosphate RB2256 from Alaska. For example... Figure 8 As shown, lanes 6, 14, and 16 all contain Sala_1737 from Alaskan sphingosine monocytogenes RB2256 with the Sala_1737 gene knocked out, and the correct bands are observed.

[0082] If the electrophoretic band of the colony PCR product is 1873 bp, then it is a positive colony of streptomycin reverse screening colony with the Sala_2677 gene knocked out in Sphingosine monophosphate RB2256 from Alaska. For example... Figure 9 As shown, lanes 1, 2, 6, 7, 12, 13, and 14 all contain Sala_1737 from Alaskan sphingosine monocytogenes RB2256, whose Sala_2677 gene has been knocked out, with the correct bands.

[0083] The above description is merely a preferred embodiment of this application, but the scope of protection of this application is not limited thereto. Any variations or substitutions that can be easily conceived by those skilled in the art within the scope of the technology disclosed in this application should be included within the scope of protection of this application.

Claims

1. A kit for knocking out a target gene in the genome of *Sphingosine monocytogenes* RB2256, comprising: (a) The first component is a knockout plasmid, which consists of the PAK405-Cm basic plasmid backbone shown in SEQ ID NO: 31, and a specific homologous arm sequence inserted between the BamHI and SalI restriction sites in the backbone; (b) The second component, which is Escherichia coli ST18, is used as the conjugation donor for the knockout plasmid; The specific homologous arm sequence is one of the following: (i) The upstream homologous sequence shown in SEQ ID NO: 9 and the downstream homologous sequence shown in SEQ ID NO: 12 used to knock out the Sala_1737 gene, wherein the ID number of the Sala_1737 gene is ABF53450.1; or (ii) An upstream homologous sequence as shown in SEQ ID NO: 15 and a downstream homologous sequence as shown in SEQ ID NO: 18 for knocking out the Sala_2677 gene; the ID number of the Sala_2677 gene is ABF54382.

1.

2. A method for knocking out a target gene in the genome of *Sphingosine monocytogenes* RB2256 using the kit described in claim 1, comprising the following steps: (1) Transform the knockout plasmid in the kit of claim 1 into the Escherichia coli ST18 to obtain a conjugation donor bacterium containing the knockout plasmid; (2) The activated conjugation donor bacteria are conjugated with Alaskan sphingosine monocytogenes RB2256 to transfer the knockout plasmid into RB2256 and cause the first homologous recombination. (3) Screening for positive colonies that have undergone the first homologous recombination using a chloramphenicol-containing culture medium; (4) After the positive colonies obtained in step (3) are cultured without antibiotics, colonies that have undergone a second homologous recombination are screened by using a culture medium containing streptomycin to obtain the Alaskan sphingosine bacillus RB2256 strain with the target gene knocked out.