TsRNA markers for diagnostic evaluation of cardiac muscle aging, kits and applications thereof

Abstract

The application discloses a kind of detection tsRNA marker's material and application, including one or more of the following applications A1) in the preparation of diagnostic myocardial aging product Application;A2) in the preparation of screening myocardial aging product Application;tsRNA marker is tsRNA-5006c, nucleotide sequence as shown in SEQ ID No.1.The tsRNA-5006c marker provided in the application is significantly increased in the expression amount in the plasma of myocardial aging patient compared with healthy control, indicating that tsRNA-5006c is a potential myocardial aging biomarker.The ROC curve of the efficiency of tsRNA-5006c in diagnosing myocardial aging patients shows that tsRNA-5006c has good diagnostic efficiency.

Description

Technical Field

[0001] This invention relates to a biomarker for diagnosing myocardial aging, specifically a tsRNA biomarker, and also to a kit for detecting the tsRNA biomarker and its application, belonging to the field of medical molecular diagnostics. Background Technology

[0002] Age is a key determinant of cardiovascular health. In individuals aged 65 and older, cardiovascular disease (CVD) accounts for 40% of all deaths, making it the leading cause of death, and the costs of treatment and hospitalization increase by more than 200%. Therefore, myocardial aging has become an important area of ​​clinical research, requiring in-depth exploration of the molecular biological reasons why age is a key etiological factor in cardiovascular disease. Previously, research in the molecular biology of cardiovascular disease and aging was largely independent, with most studies on atherosclerosis or cardiomyopathy conducted on young mice. Studies on gene and drug interventions to extend lifespan rarely assessed improvements in cardiovascular disease or cardiac function. Recently, with increasing attention paid to changes in the cardiovascular system with age, improving the early diagnostic capabilities of myocardial aging has become an important direction in cardiovascular disease research.

[0003] tRNA-derived small RNAs (tsRNAs) are non-coding small RNAs produced by the splicing of precursor or mature tRNAs under adverse conditions such as starvation, oxidative stress, and hypoxia via specific endonucleases. Based on the splicing site, they are classified into tRNA fragments (tRFs) and stress-induced derived small RNAs (tsRNAs). The development of high-throughput sequencing technology has revealed important biological functions of tsRNAs, including inhibiting apoptosis, epigenetic regulation, intercellular communication, translation, and gene expression regulation. Abnormal expression of tsRNAs and their involvement in various pathological processes are observed in multiple diseases. Although this field is still in its early stages, it holds significant value for in-depth research in the treatment of non-tumor diseases. Studies have reported that tsRNAs participate in the development and progression of cardiovascular diseases; whether they are involved in myocardial aging and whether they can serve as diagnostic biomarkers for myocardial aging requires further investigation.

[0004] Myocardial aging develops insidiously, and there is a lack of accurate diagnostic and laboratory methods in clinical practice, especially in the early stages when cardiac function is not significantly weakened, making accurate intervention difficult. There is an urgent need to discover new biomarkers for myocardial aging. Early changes in cardiomyocytes release abnormal metabolites, which, if detected and verified, can serve as diagnostic markers. Currently, commonly used biomarkers in clinical practice are proteins, such as cardiac troponin (cTn), creatine kinase isoenzyme (CK), and myoglobin (Myo). Changes in non-coding RNA occur upstream of transcription and occur earlier and more rapidly than protein markers. Previously, due to immature detection methods, tsRNA was difficult to detect. However, with technological advancements, tsRNA detection methods are becoming increasingly sophisticated and hold promise as a new biomarker for the diagnosis and assessment of myocardial aging. Summary of the Invention

[0005] The primary technical problem this invention aims to solve is to provide a novel application of tsRNA biomarkers. These tsRNA biomarkers can be used to prepare substances for diagnosis, screening, disease assessment, and differentiation of myocardial aging from other heart diseases.

[0006] Another technical problem to be solved by this invention is to provide a kit for detecting this tsRNA biomarker. This kit can be used for diagnosis, screening, disease assessment, and differentiating myocardial aging from other heart diseases.

[0007] The third technical problem to be solved by this invention is to provide a primer for detecting this tsRNA marker. This primer can be used for diagnosis, screening, disease assessment, and differentiation of myocardial aging from other heart diseases.

[0008] To achieve the above-mentioned technical objectives, the present invention adopts the following technical solution:

[0009] According to a first aspect of the present invention, an application of a substance for detecting tsRNA biomarkers is provided, comprising one or more of the following applications:

[0010] A1) Application in the preparation of diagnostic products for myocardial aging;

[0011] A2) Application in the preparation of products for screening myocardial aging;

[0012] A3) Application in the preparation of products for treating myocardial aging;

[0013] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0014] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0015] The tsRNA marker is tsRNA-5006c, and its nucleotide sequence is shown in SEQ ID No. 1.

[0016] The "products" described above can be products used to diagnose myocardial aging by detecting the expression level of tsRNA-5006c through RT-PCR, real-time quantitative PCR, in situ hybridization, microarray or high-throughput sequencing platforms.

[0017] In the above applications, tsRNA-5006c expression was significantly upregulated in plasma samples from patients with myocardial aging; the expression level of tsRNA-5006c in healthy individuals was significantly lower than that in patients with myocardial aging.

[0018] Preferably, the substance is a reagent for detecting the expression level of tsRNA-5006c, or for specifically recognizing tsRNA-5006c, or for detecting the content of tsRNA-5006c.

[0019] Preferably, the substance is a substance used for detecting tsRNA-5006c, specifically a), b), or c) below.

[0020] a) Primers used to detect or specifically recognize tsRNA-5006c;

[0021] b) A reagent group containing the reagents described in a);

[0022] c) A kit containing either a) or b).

[0023] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0024] According to a second aspect of the present invention, a kit for detecting tsRNA biomarkers is provided, the kit comprising one or more of the following applications:

[0025] A1) Application in the preparation of diagnostic products for myocardial aging;

[0026] A2) Application in the preparation of products for screening myocardial aging;

[0027] A3) Application in the preparation of products for treating myocardial aging;

[0028] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0029] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0030] The tsRNA marker is tsRNA-5006c, and its nucleotide sequence is shown in SEQ ID No. 1. The kit includes reagents for detecting or specifically recognizing tsRNA-5006c, or reagents for detecting the expression level of tsRNA-5006c.

[0031] Using the kit provided by this invention, the expression of the tsRNA-5006c characteristic gene sequence shown in SEQ ID NO.1 in the peripheral blood of the subject can be detected. Then, based on the information of upregulation or downregulation of these gene expressions, the probability of myocardial aging in the subject can be determined, thereby realizing the diagnosis of myocardial aging.

[0032] The kit provided by this invention may include appropriate packaging and instructions for use in the methods disclosed herein. Preferably, the detection kit provided by this invention is a nucleic acid detection kit, including reagents required for RNA extraction and quantitative real-time PCR (qRT-PCR). The kit may further include appropriate buffers and polymerases. This kit also includes control primers and / or probes.

[0033] Preferably, the reagent used for detecting or specifically recognizing tsRNA-5006c is a specific primer, wherein the specific primer is the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0034] According to a third aspect of the present invention, a primer for detecting tsRNA markers is provided, the primer comprising one or more of the following applications:

[0035] A1) Application in the preparation of diagnostic products for myocardial aging;

[0036] A2) Application in the preparation of products for screening myocardial aging;

[0037] A3) Application in the preparation of products for treating myocardial aging;

[0038] A4) Application in the preparation of prognostic assessment products for myocardial aging;

[0039] A5) Application in the preparation of products for differentiating and distinguishing myocardial aging from other diseases;

[0040] The primers are used to detect the expression level of tsRNA-5006c or to specifically recognize tsRNA-5006c.

[0041] Preferably, the primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

[0042] Compared with the prior art, the present invention has the following technical effects:

[0043] (1) The tsRNA-5006c provided by this invention can be used as a new biomarker for the diagnosis of myocardial aging. Clinical validation trials have shown that the expression level of tsRNA-5006c in the plasma of patients with myocardial aging is significantly higher than that in the plasma of healthy controls, indicating that tsRNA-5006c is a potential biomarker for myocardial aging.

[0044] (2) The ROC curve of tsRNA-5006c in diagnosing patients with myocardial aging shows that tsRNA-5006c has good sensitivity and specificity, indicating that it has good diagnostic efficacy.

[0045] (3) In clinical trials, the relationship between human plasma BNP and tsRNA-5006c expression levels showed a positive correlation between BNP and tsRNA-5006c expression. BNP is a peptide hormone synthesized by the heart when the ventricular wall is expanded or stretched, reflecting the heart's compensatory function and serving as a marker for evaluating cardiac function, primarily used to diagnose heart failure. tsRNA-5006c levels were positively correlated with BNP levels. These results indicate that plasma tsRNA-5006c levels can reflect the severity of myocardial aging.

[0046] (4) The expression levels of galactosidase, a marker of cardiomyocyte aging, and tsRNA-5006c showed a good correlation and a positive correlation, indicating that there is a solid relationship between tsRNA-5006c and cell aging and that it has good diagnostic efficacy.

[0047] (5) In in vitro cell experiments, the expression level of tsRNA-5006c in D-gal-treated AC16 cells was higher than that in normal controls; this indicates that the level of tsRNA-5006c increases during cardiomyocyte senescence, which is the cellular and molecular basis for tsRNA-5006c as a diagnostic biomarker for myocardial senescence. This experiment further verified the relationship between tsRNA-5006c and myocardial senescence. Knockdown of tsRNA-5006c in the D-gal-induced cell senescence model alleviated the senescence condition, which also proves that tsRNA-5006c is expected to become a new diagnostic biomarker and therapeutic target for myocardial senescence.

[0048] (6) Immunofluorescence assay showed that the expression level of galactosidase decreased after knocking down tsRNA-5006c. This result indicates that the degree of cell senescence induced by D-gal was reduced after knocking down tsRNA-5006c, and the effect of antagonizing senescence was achieved. This shows that tsRNA-5006c may be a therapeutic target for myocardial senescence at the cellular level. Attached Figure Description

[0049] Figure 1 Volcano plot showing the differential expression of tsRNA in senescent cardiomyocytes and normal controls obtained through sequencing;

[0050] Figure 2 To determine the tsRNA-5006c content in the plasma of patients with myocardial aging and normal controls using qRT-PCR;

[0051] Figure 3 ROC curve for tsRNA-5006c in diagnosing myocardial aging patients;

[0052] Figure 4To further determine the tsRNA-5006c content in the plasma of patients with myocardial aging and normal controls in the external validation population using qRT-PCR;

[0053] Figure 5 ROC curves for tsRNA-5006c diagnosis in an external validation population of patients with myocardial aging.

[0054] Figure 6 The relationship between human plasma BNP and tsRNA-5006c expression levels;

[0055] Figure 7 The relationship between the positive rate of galactosidase, a marker of aging, in D-gal-induced cardiomyocytes and the expression level of tsRNA-5006c.

[0056] Figure 8A The expression of tsRNA-5006c after transfection of AC16 with tsRNA-5006c small interfering RNA (siRNA) is shown.

[0057] Figure 8B This is a graph showing the mRNA expression level after tsRNA-5006c knockdown.

[0058] Figure 9A The expression of D-gal-induced P21 mRNA in cardiomyocytes after siRNA knockdown of tsRNA-5006c was shown.

[0059] Figure 9B The expression of D-gal-induced IL-1β mRNA in cardiomyocytes after siRNA knockdown of tsRNA-5006c;

[0060] Figure 10 To reduce the expression level of BNP in the supernatant of cardiomyocytes after D-gal treatment in cardiomyocytes knocked down tsRNA-5006c and control group;

[0061] Figure 11 To determine the expression of galactosidase, a marker of cardiomyocyte senescence, under light microscopy after knocking down tsRNA-5006c. Detailed Implementation

[0062] The technical content of the present invention will be described in detail below with reference to the accompanying drawings and specific embodiments. These embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments, unless otherwise specified, are generally performed under conventional conditions or as recommended by the manufacturer. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the art. Furthermore, any methods and materials similar to or equivalent to those described herein can be applied to the methods provided by the present invention. The preferred embodiments and materials described herein are for illustrative purposes only.

[0063] The research and development process and approach of this invention: First, total RNA was extracted from three naturally aging cardiomyocytes (AC16) and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for tsRNA sequencing. tsRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. Then, the levels of the top 10 tsRNAs in patient plasma were measured using qRT-PCR, and the most significantly elevated tsRNA was used for subsequent experiments. The inventors then further verified the relationship between tsRNA-5006c expression and myocardial aging using in vitro cellular experiments. Specific data are as follows:

[0064] Example 1: Screening and Correlation Study of tsRNA Markers for Myocardial Aging

[0065] 1. Clinical Samples:

[0066] Venous blood was collected upon admission from 50 patients aged 60-90 years who were hospitalized at the General Hospital of the People's Liberation Army between 2020 and 2023, excluding those with heart disease. Venous blood was also collected from 50 healthy individuals aged ≤30 years during physical examinations. The participants were divided into two groups: a control group and an aging group, for subsequent measurement of plasma tsRNA levels.

[0067] The external validation population consisted of 52 inpatients aged 60–90 years who were hospitalized at Fuwai Hospital, Chinese Academy of Medical Sciences, between 2022 and 2023, excluding those with other heart diseases. Additionally, 44 healthy individuals aged ≤30 years were included. Venous blood samples were collected upon admission, and the participants were divided into a control group and an aging group. Clinical data were recorded for all participants.

[0068] Inclusion criteria:

[0069] (1) Inpatients aged 60 to 90 years;

[0070] (2) Healthy individuals aged ≤30 years undergoing physical examinations;

[0071] (3) Complete blood sample data is available.

[0072] Exclusion criteria: malignant tumors, severe liver and kidney dysfunction, severe autoimmune diseases, severe hematologic diseases or other cardiovascular diseases such as coronary heart disease, valvular heart disease and cardiomyopathy.

[0073] 2. Plasma extraction:

[0074] Human peripheral blood was collected using EDTA anticoagulant blood collection tubes. The tubes were centrifuged at 2500g for 15 minutes, and the supernatant plasma was transferred to a 2ml sterile tube and stored at -80℃.

[0075] 3. RNA extraction and quantitative real-time PCR (qRT-PCR):

[0076] Total RNA was extracted from AC16 using the RNA Simple Total RNA Kit (DP419, TIANGEN, Beijing, China).

[0077] 3.1 RNA Extraction

[0078] RNA was extracted from plasma samples according to the TRIZOL Reagent (Invitrogen) instructions. 1 ml of TRIZOL Reagent (Invitrogen) and 200 μL of chloroform were added to the plasma, vortexed for 20 seconds, and incubated at room temperature for 10 minutes. The plasma was then centrifuged at 13000 rpm for 15 minutes at 4°C. The supernatant was carefully aspirated, and 800 μL of isopropanol was added. The mixture was gently mixed by inverting the container and incubated at -20°C for 1 hour. The supernatant was then discarded after centrifugation at 13000 rpm for 15 minutes at 4°C. 1 ml of 75% ethanol was added to gently wash the precipitate. The precipitate was centrifuged at 4°C for 13000 rpm for 5 minutes, and the supernatant was removed. The precipitate was dried. An appropriate amount of enzyme-free water was added, and the RNA was dissolved at 65°C for 10 minutes. The OD value and concentration of the RNA were then measured and stored at -80°C for later use.

[0079] 3.2 RNA reverse transcription to synthesize cDNA

[0080] 500 ng of RNA was reverse transcribed into cDNA using a reverse transcription kit (Takara RR037A). 3.3 Reverse transcription of tsRNA:

[0081] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0082] Table 1

[0083]

[0084] 3.4 Reverse transcription of mRNA:

[0085] Perform the operation on ice, using 20 μL for each reaction system, as shown in the table below:

[0086] Table 2

[0087]

[0088] The reaction procedure was: 37℃ for 45 min, 85℃ for 5 min, and maintained at 4℃.

[0089] 3.5 qRT-PCR

[0090] Design tsRNA primer sequences according to the principles of tsRNA primer design.

[0091] The cDNA obtained from the reverse transcription reaction was diluted 1:10 and then subjected to the following qRT-PCR reaction:

[0092] Perform on ice, with 20 μL for each reaction system, as shown in the table below:

[0093] Table 3

[0094]

[0095] After mixing the reaction solution, the Real-time PCR program is as follows:

[0096] Stage 1: 95℃ for 2 minutes;

[0097] Stage 2: Cycle 35, 94℃ for 5s, 60℃ for 1min;

[0098] Stage 3: 95℃15s, 60℃1min, 95℃5s;

[0099] The relative levels of each mRNA were quantified using GAPDH and expressed as relative ratios.

[0100] 4. tsRNA sequencing analysis:

[0101] Total RNA was extracted from three naturally aging AC16 cardiomyocytes and three normal control cells and sent to Guangzhou Epigenetics Co., Ltd. for tsRNA sequencing. tsRNAs with significantly different expression levels (Fold change ≥ 2.0, P < 0.05) were screened. The levels of the top 10 tsRNAs in the patient's plasma were then measured using qRT-PCR, and the most significantly elevated tsRNA was used for subsequent experiments. Figure 1 As shown, Figure 1 This is a volcano plot showing the differential expression of tsRNAs in senescent cardiomyocytes and normal controls obtained through sequencing. Table 4 shows the top 10 upregulated tsRNAs obtained through sequencing; the tsRNAs with the highest expression levels were selected for subsequent experiments.

[0102] Table 4 shows the top 10 upregulated tsRNAs obtained from sequencing data.

[0103]

[0104] 5. ROC curve plotting:

[0105] The receiver operating characteristic (ROC) curve is a curve obtained by plotting the true positive rate and false positive rate, and it can be used to reflect the relationship between sensitivity and specificity. It is plotted with sensitivity on the ordinate and 1-specificity on the abscissa, using a series of cutoff values ​​based on the measurements of the experimental and control groups. Sensitivity and specificity are calculated separately for each cutoff value, and the lines connecting these points form the ROC curve. The ROC curve was plotted using GraphPad Prism software. The ROC curve reflects the diagnostic efficacy of the biomarker for the disease.

[0106] 6. Statistical Analysis:

[0107] For normally distributed variables, t-tests and ANOVA were used; for non-normally distributed variables, Mann-Whitney U tests and Kruskal-Wallis tests were used. Statistical analysis was performed using R software (v 3.4.2) and GraphPad Prism software (v 8.00). Biological replicates were displayed as individual data points superimposed on a bar chart. P < 0.05 was considered statistically significant.

[0108] 7. Experimental Results:

[0109] like Figure 2 As shown, the tsRNA-5006c content in the plasma of patients with myocardial aging was determined using qRT-PCR. The results showed that the expression of tsRNA-5006c in the plasma of patients with myocardial aging was significantly higher than that in healthy controls, indicating that tsRNA-5006c is a potential biomarker of myocardial aging.

[0110] like Figure 3 The ROC curve of tsRNA-5006c in diagnosing patients with myocardial aging is shown in the figure; it indicates that tsRNA-5006c has good sensitivity and specificity, demonstrating its good diagnostic efficacy.

[0111] like Figure 4 As shown, after selecting an external validation population, the tsRNA-5006c content in the plasma of patients with myocardial aging was measured by qRT-PCR. The results showed that the expression level of tsRNA-5006c in the plasma of patients with myocardial aging was significantly higher than that in the plasma of healthy controls, verifying the reliability of tsRNA-5006c as a biomarker of myocardial aging.

[0112] like Figure 5 As shown in the figure, the ROC curve of tsRNA-5006c in diagnosing patients with myocardial aging in the external validation set shows that it has excellent specificity and sensitivity, indicating that tsRNA-5006c also has good diagnostic efficacy in the external validation set.

[0113] Example 2: Experiment on the relationship between BNP and tsRNA-5006c expression levels

[0114] 1. Experimental objective:

[0115] B-type natriuretic peptide (BNP) and its N-terminal precursor (N-terminal BNP) (in patients with median levels or higher) are biomarkers of cardiac function and are the preferred biomarkers for the diagnosis and differential diagnosis of heart failure, as well as for assessing disease severity and prognosis. In healthy adults, the normal BNP level should be <100 ng / L. BNP levels gradually increase with age and decline in cardiac function, and are generally considered abnormal when greater than 100 ng / L. The diagnostic criteria are based on the 2004 American College of Cardiology (ACC) expert consensus: if BNP <100 ng / L, the likelihood of heart failure is extremely low (90% negative predictive value); if BNP >500 ng / L, the likelihood of heart failure is extremely high (90% positive predictive value). A normal BNP level should be <100 ng / L; BNP levels within the normal range can rule out acute heart failure.

[0116] BNP is mainly found in the left and right atria of the heart, with the right atrium containing more than three times the amount in the left atrium. The ventricular BNP content is low because BNP precursors are not stored in the ventricles. Only when the ventricular wall tension increases will it rapidly stimulate the high expression of the BNP gene, resulting in the synthesis and secretion of large amounts into the blood. In other words, the increase in plasma BNP indicates that the heart's systolic or diastolic function is impaired, which prevents the heart from fully expelling venous blood, causing ventricular traction. Moreover, the increase in BNP exhibits a dynamic pattern.

[0117] Myocardial aging is the process by which the heart muscle gradually loses function and efficiency with age. This process may lead to weakened cardiac pumping function and poor blood circulation, thereby increasing the release of BNP. Therefore, BNP levels can serve as an important indicator for assessing myocardial aging and the risk of heart failure.

[0118] 2. Experimental Methods:

[0119] BNP Assay: The BNP / Brain Natriuretic Peptide (BNP) EILSA assay kit (ZC-34225) was used to measure plasma or cell supernatant. First, add 100 μL of standard or test sample to each well. Equilibrate the kit to room temperature for 30 min. Then, remove the required strips from the foil pouch, and seal the remaining strips in a resealable bag and return to 4℃. Add 50 μL of different concentrations of standard to each standard well. Add 50 μL of the test sample to each sample well; do not add any to the blank wells. Except for the blank wells, add 100 μL of horseradish peroxidase (HPP)-labeled detection antibody to each standard and sample well. Seal the reaction wells with sealing film and incubate at 37℃ for 60 minutes in a water bath or incubator. Discard the liquid, blot dry on absorbent paper, add 350 μL of washing buffer to each well, let stand for 1 minute, discard the washing buffer, blot dry on absorbent paper, and repeat this washing process 5 times (or a plate washer can be used). Add 50 μL of substrate A and substrate B to each well and incubate at 37°C in the dark for 15 minutes. Add 50 μL of stop solution to each well, and measure the OD value of each well at 450 nm within 15 minutes.

[0120] 3. Experimental Results

[0121] Figure 6 The figure shows the relationship between plasma BNP and tsRNA-5006c expression levels. BNP is a marker protein of heart failure, and tsRNA-5006c is positively correlated with BNP levels. These results indicate that plasma tsRNA-5006c levels can reflect the severity of myocardial aging and can be used for risk and disease assessment of myocardial aging.

[0122] Example 3 uses galactosidase staining to verify the relationship between tsRNA-5006c and myocardial aging.

[0123] 1. Experimental objective:

[0124] Normal cells cease dividing after a finite number of divisions, exhibiting irreversible growth arrest, at which point the cell enters a senescent state, and senescence-related galactosidases are activated. Galactosidases are hydrolytic enzymes within lysosomes, but their activity is upregulated in senescent cells. Based on this phenomenon and principle, using galactosides as substrates, senescent cell-specific galactosidases catalyze the substrate to produce a blue product, manifested as blue deposits in the cytoplasm. Cells or tissues expressing galactosidase, turning blue, can be easily observed under a light microscope. Galactosidase staining is the gold standard for determining cellular senescence in cell and molecular experiments.

[0125] 2. Cell culture:

[0126] Human cardiomyocyte line (AC16) was purchased from Wuhan Pronosai. The cells were cultured in RPMI-1640 medium with 10% fetal bovine plasma in a 37°C 5% carbon dioxide incubator.

[0127] 3. Cell-induced senescence treatment:

[0128] Cultured AC16 cardiomyocytes were exposed to 10 mM D-galactose to induce cellular senescence. D-galactose (D-gal) is a well-established senescence model inducing agent, a more potent glycation agent than glucose, and capable of inducing oxidative stress. D-gal concentrations induced cytotoxicity and senescence-like changes, leading to increased BNP secretion levels in AC16 cells. Further analysis was performed after 24 hours of treatment.

[0129] 4. Galactosidase staining:

[0130] Staining was performed using the Beyotime galactosidase staining kit (C0602). Cardiomyocytes cultured in 6-well plates were stained. The cell culture medium was aspirated, and the cells were washed once with PBS. 1 mL of galactosidase staining fixative was added, and the plates were fixed at room temperature for 15 minutes. The cell fixative was then aspirated, and the cells were washed three times with PBS for 3 minutes each time. PBS was then aspirated, and 1 mL of staining working solution was added to each well. The staining working solution was prepared as follows: 10 μL of galactosidase staining solution a, 10 μL of galactosidase staining solution b, 930 μL of galactosidase staining solution c, and 50 μL of X-Gal solution. The plates were incubated overnight at 37°C, and the 6-well plates were sealed with plastic wrap to prevent evaporation. Note: Incubation at 37°C cannot be performed in a CO2 incubator. Observation was performed under a regular optical microscope.

[0131] 5. Statistical analysis methods:

[0132] Cells stained blue under an optical microscope were considered positive cells. The number of positive cells per 100 cells in a randomly selected field of view was counted to determine the percentage of positive cells (%). Correlation analysis was performed between the percentage of positive cells in each sample and tsRNA-5006c.

[0133] 6. Experimental Results:

[0134] like Figure 7 As shown, the expression levels of galactosidase and tsRNA-5006c, markers of cardiomyocyte aging, are well correlated and positively correlated, indicating that there is a solid relationship between tsRNA-5006c and cellular aging and that it has good diagnostic efficacy.

[0135] Example 4: In vitro cellular experiments further validated the relationship between tsRNA-5006c expression levels and myocardial aging. relation

[0136] 1. Cell culture:

[0137] The cell culture method is the same as in Example 3.

[0138] Small interfering RNA (siRNA) knockdown method: siRNA was ordered from Thermo Fisher Scientific. According to the instructions, it was added when the cell confluence reached 70%, and the knockdown effect was measured by qRT-PCR after 24 hours of induction.

[0139] 2. Cell senescence-inducing treatment was the same as in Example 3. The levels of miRNA in cardiomyocytes and BNP in cardiomyocyte supernatant were compared with those in the control group.

[0140] 3. The method for measuring BNP in myocardial cell supernatant is the same as in Example 3.

[0141] 4. The qRT-PCR method is the same as in Example 1.

[0142] 5. The galactosidase staining method is the same as in Example 3.

[0143] 6. Experimental Results:

[0144] Figure 8A The expression of tsRNA-5006c was decreased after AC16 cardiomyocytes were transfected with siRNA. Figure 8B The results show that the total amount of mRNA remained unchanged after transfection, indicating that the tsRNA-5006c knockdown was successful, and subsequent experiments were conducted based on this.

[0145] Figure 9A and Figure 9B To detect the mRNA expression of two cellular senescence markers (P21, a cellular senescence protein marker, and IL-1β, a cellular senescence secretion-related phenotypic marker) in AC16 cardiomyocytes after transfection with siRNA, it was found that after knocking down tsRNA-5006c, Figure 9A P21 and Figure 9B The reduced expression of IL-1β mRNA suggests that knocking down tsRNA-5006c can slow down cellular senescence, and tsRNA-5006c may serve as a therapeutic target for myocardial aging.

[0146] Figure 10 To reduce the expression levels of tsRNA-5006c and BNP in AC16 cardiomyocytes (both knockout and control groups) after D-gal treatment, the results showed that D-gal-induced senescence increased tsRNA-5006c expression, while BNP expression decreased after tsRNA-5006c knockout. This provides the cellular and molecular basis for tsRNA-5006c as a diagnostic tool for the severity of myocardial aging and as a therapeutic target for myocardial aging.

[0147] Figure 11To investigate the expression levels of galactosidase (a marker of cellular senescence) in AC16 cardiomyocytes treated with D-gal after tsRNA-5006c knockdown and control groups, we used staining assays. The results show that the control group treated with D-gal exhibited increased blue substrate staining for galactosidase, indicating more severe cellular senescence. The decrease in galactosidase expression after tsRNA-5006c knockdown suggests that D-gal-induced cellular senescence was mitigated, achieving an anti-senescence effect. This demonstrates at the cellular level that tsRNA-5006c may serve as a therapeutic target for myocardial senescence.

[0148] The above experimental results indicate that tsRNA-5006c is significantly correlated with myocardial aging, making it a novel biomarker for myocardial aging. tsRNA-5006c expression is upregulated in cardiomyocytes treated with the aging-inducing agent D-gal; ROC curves show that tsRNA-5006c has good diagnostic capabilities for patients with myocardial aging, suggesting that tsRNA-5006c may be involved in the aging-inducing effect of D-gal on cardiomyocytes. In conclusion, tsRNA-5006c shows promise as a novel diagnostic biomarker and therapeutic target for myocardial aging.

[0149] Example 5: Composition of the sequence, primers, and reagent kit involved in this invention.

[0150] The nucleotide sequence of the myocardial aging biomarker tsRNA-5006c provided by this invention is shown in SEQ ID No. 1.

[0151] SEQ ID No.1: CGGCTAGCTCAGTCGGTAGAGCATGG

[0152] The primer pair specifically recognizing tsRNA-5006c provided by this invention includes the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3:

[0153] SEQ ID No.2: CGGCTAGCTCAGTCGGTAGA

[0154] SEQ ID No. 3

[0155] GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCATGC

[0156] The reagent kit provided by this invention consists of:

[0157] 5x primer buffer, reaction enzyme combination I, Random 6mers, Oligo dT primers, RNase-free purified water, SYBR probe II (Tli RNaseH Plus) (2x), PCR primers (F+R) (10μM), ROX Reference dye (50x).

Claims

1. The application of a reagent for detecting tsRNA biomarkers, characterized in that... It can be one or more of the following applications: A1) Application in the preparation of diagnostic products for myocardial aging; A2) Application in the preparation of products for screening myocardial aging; The tsRNA marker is tsRNA-5006c, and its nucleotide sequence is shown in SEQ ID No.

1.

2. The application as described in claim 1, characterized in that: The product is designed to diagnose myocardial aging by detecting the expression level of tsRNA-5006c using RT-PCR, real-time quantitative PCR, in situ hybridization, microarray, or high-throughput sequencing platforms.

3. The application as described in claim 1, characterized in that: The reagent is used to detect the expression level of tsRNA-5006c or to detect the content of tsRNA-5006c.

4. The application as described in claim 1, characterized in that: The reagent is for detecting tsRNA-5006c, specifically a), b), or c) below. a) Primers used to detect or specifically recognize tsRNA-5006c; b) A reagent group containing the reagents described in a); c) A kit containing either a) or b).

5. The application as described in claim 4, characterized in that: The primers are the upstream primer shown in SEQ ID No. 2 and the downstream primer shown in SEQ ID No. 3.

Images