Molecular markers closely linked to the QTL QGns.siacu-2H for grain number per ear and their applications

Abstract

The application discloses a molecular marker closely linked with spike grain number QTL QGns.siacu-2H and application thereof, relates to the technical field of molecular biology and genetic breeding. The nucleotide sequence of the molecular marker M11 is shown in SEQ ID NO. 4, and a SNP site exists at the 20th base of the nucleotide sequence, which is a T / C mutation. The application discloses, for the first time, a molecular marker M11 for accurately detecting the QTL of regulating the spike grain number of barley based on a fluorescence quantitative PCR platform, and the molecular marker M11 is a codominant marker, and the detection is accurate, efficient, convenient, stable, and the like. The molecular marker M11 disclosed by the application is significantly related to the spike grain number QTL QGns.siacu-2H of barley, presents the characteristics of a closely linked marker, is high in accuracy of molecular marker assisted selection, can improve the selection and identification efficiency of high yield of different barley varieties, is high in success rate, and thus is favorable for greatly accelerating the breeding process of high-yield barley varieties.

Description

Technical Field

[0001] This invention relates to the fields of molecular biology and genetic breeding technology, and in particular to molecular markers closely linked to the number of grains per ear (QTLQGns.siacu-2H) and their applications. Background Technology

[0002] Barley (Hordeum vulare L.) is a plant belonging to the genus Hordeum in the tribe Triticeae of the family Gramineae. It is an annual, self-pollinating, diploid crop. As the world's fourth largest cereal crop, after maize, wheat, and rice, it is used for food, feed, and brewing. Developing high-quality, high-yield barley varieties is an effective means to address the issue of increasing grain crop yields in my country, and it is gradually becoming a key objective for the sustainable development of my country's agriculture, animal husbandry, and brewing industries. This is of great significance for promoting the development of the barley industry and enhancing my country's core competitiveness in the global barley market.

[0003] Several quantitative trait loci (QTLs) controlling grain number per spike have been detected in barley, but their genetic effects are low, and only a very few are consistently detectable across multiple populations and experimental sites. For example, Mikolajczak et al. identified a major-effect QTL controlling grain number on chromosome 2H, QNGS.MC-2H (Mikolajczak K, Ogrodowicz P, ...), using three different recombinant inbred line populations. K, et al. Quantitative trait loci for yield and yield-related traits in springbarley populations derived from crosses between European and syrian cultivars[J]. Plos One, 2016, 11(5):e0155938.). Breeders are using these few QTLs that regulate grain number per spike for marker-assisted selection. However, in production practice, the high-yield context is becoming increasingly narrow, while the production demand is increasing. Therefore, discovering genetically significant and stable QTLs for grain number per spike in barley and developing molecular markers closely linked to them will help accelerate barley breeding progress. Summary of the Invention

[0004] The purpose of this invention is to provide a molecular marker closely linked to the grain number QTL QGns.siacu-2H and its application, in order to solve the problems existing in the prior art. This molecular marker is significantly correlated with the barley grain number QTL, exhibiting the characteristics of a closely linked marker. It has high accuracy in marker-assisted selection, which can improve the efficiency of high-yield selection and identification of different barley varieties, with a high success rate, thereby greatly accelerating the breeding process of high-yield barley varieties.

[0005] To achieve the above objectives, the present invention provides the following solution:

[0006] This invention provides a molecular marker M11 for identifying the number of grains per barley ear using the QTL QGns.siacu-2H. The nucleotide sequence of the molecular marker M11 is shown in SEQ ID NO.4. At position 20 of the nucleotide sequence, there is an SNP site, which is a T / C mutation.

[0007] The present invention also provides a KASP primer combination for identifying the number of grains per barley ear, comprising two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3.

[0008] This invention also provides the application of the above-mentioned KASP primer combination in the preparation of products for identifying the grain number trait of barley ears.

[0009] Furthermore, the product is a reagent kit.

[0010] The present invention also provides a product for identifying the number of grains per barley ear, comprising the above-mentioned KASP primer combination.

[0011] Furthermore, the product is a reagent kit.

[0012] The present invention also provides the application of the above-mentioned KASP primer combination or product in identifying the number of grains per barley ear.

[0013] The present invention also provides a method for identifying the number of grains per barley ear, comprising the following steps:

[0014] DNA was extracted from the barley to be tested;

[0015] Using the DNA as a template, real-time PCR amplification was performed using the above-mentioned KASP primer combination to obtain the genotype of the barley to be tested. Based on the genotype, the number of grains per spike of the barley to be tested was determined: the number of grains per spike of CC genotype barley was higher than that of TT genotype barley.

[0016] Furthermore, the reaction system for the real-time PCR amplification is as follows: 4.5 μL of 2×KASP Mastermix, 1.5 μL of KASP Assay Mix, 2 μL of template DNA, and 2 μL of Dnase / RNase-free deionized water.

[0017] Furthermore, the reaction procedure for the quantitative real-time PCR amplification is as follows: pre-denaturation at 95℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 61℃ for 60 s, repeated 10 times, with the annealing and extension temperature decreasing by 0.6℃ each time; denaturation at 95℃ for 20 s, annealing and extension at 55℃ for 40 s, repeated 42 times; fluorescence signal acquisition at 25℃ for 60 s.

[0018] The present invention discloses the following technical effects:

[0019] This invention discloses for the first time the QTL QGns.siacu-2H for barley grain number, located on chromosome 2H, which significantly increases the number of grains per ear. This QTL has high utilization value in high-yield barley breeding. This invention also discloses for the first time a molecular marker M11, which is a co-dominant marker and can be accurately and efficiently detected, and is convenient and stable for amplification, based on a quantitative real-time PCR platform. The molecular marker M11 disclosed in this invention is significantly correlated with the barley grain number QTL QGns.siacu-2H, exhibiting tight linkage characteristics. It has high accuracy for marker-assisted selection, can improve the efficiency of high-yield selection and identification of different barley varieties, and has a high success rate, thus greatly accelerating the breeding process of high-yield barley varieties. Attached Figure Description

[0020] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0021] Figure 1 This is a graph showing the results of identifying regions associated with barley grain number QTLs using BSR-seq.

[0022] Figure 2 Genetic map of the genetic location of the barley grain number QTL on chromosome 2H and molecular marker M11;

[0023] Figure 3 The results of genotyping of the closely linked marker M11 with QGns.siacu-2H in the F9 population;

[0024] Figure 4This is the result of genotyping different strains using real-time PCR primers in Example 3;

[0025] Figure 5 The results show the phenotypic detection results of different strains in Example 3. Detailed Implementation

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0028] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0029] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0030] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0031] Example 1: Using BSR-seq to identify the number of grains per barley ear (QTL)

[0032] In this invention, the barley grain count (QTL) is obtained through the following method:

[0033] 1. Construction of the drawing group

[0034] Using barley with a high number of grains per spike (CIHO11333) as the male parent and barley with a low number of grains per spike (AWCS276) as the female parent, hybrid F1 was obtained. F2 was obtained by self-pollination of individual plants in the F1 generation. The F9 generation RIL population was obtained by single-grain propagation. 239 lines were randomly selected to form a genetic mapping population.

[0035] 2. Field identification of the spikelet number phenotypic traits of the parents and the plant population.

[0036] Barley CIHO11333, barley AWCS276, and F9 recombinant inbred lines were planted in the field. At the mature stage, five main ears of uniform growth (excluding edge rows) from each material were selected to determine the number of grains per ear, specifically the total number of grains fertilized on each single ear.

[0037] 3. Construct parental pools and extreme phenotype pools for transcriptome sequencing.

[0038] By combining phenotypic data from Wenjiang and Chongzhou, 26 materials with extreme values ​​in grain number per ear were selected from each region. All materials with extreme values ​​at both ends of the grain number range were pooled into one pool, and RNA was extracted from each pool (i.e., one extreme pool). RNA was also extracted from the two parents of this population, CIHO11333 and AWCS276. These extracted RNA samples were sent to Beijing Novogene Technology Co., Ltd. for sequencing using the Illumina HiSeq4000 sequencing platform (sequencing depth 10G) to obtain sequencing data. After alignment and SNP calling, 40,936 high-quality differential SNPs distributed across the seven barley chromosomes were obtained.

[0039] Based on the high-quality SNPs obtained above, the ΔSNP-index method was used to locate the QTLs regulating the grain number-related traits in barley on the seven barley chromosomes. The formula for calculating the ΔSNP-index method is as follows:

[0040]

[0041] To further reduce background noise, the 99th percentile was used as the threshold to screen for significant SNP markers. The barley grain count QTL QGns.siacu-2H was located in the 450.51-451.74 Mb interval on the long arm of chromosome 2H. Figure 1 ).

[0042] 4. Construction of genetic maps

[0043] Using QTL IciMapping 4.2 software, a molecular genetic linkage map of barley was constructed from the obtained population genotype data. The optimal number and order of markers were identified to determine the linkage groups to be used subsequently. Combined with the phenotypic data of the plotted barley population regarding grain number, the QTLs regulating barley grain number were located within a 0.42 cM segment on chromosome 2H (flanking markers M10 and M11). Figure 2 ).

[0044] Example 2: QTL molecular mapping of barley ear grain number and identification of tightly linked marker M11

[0045] 1. DNA extraction

[0046] The experimental materials were selected from the recombinant inbred lines CIHO11333, AWCS276 and F9 of barley. DNA was extracted from the leaves of the barley samples using the CTAB method.

[0047] 2. Identification of molecular markers for barley ear grain number QTLs

[0048] Based on the differential SNPs within the QTL physical range of barley ear grain number in Example 1, KASP markers were developed according to the corresponding SNP markers. KASP primers were designed using the Polymarker website (http: / / www.polymarker.info / ), including two forward primers and one universal downstream primer. The design criteria for quantitative real-time PCR primers were: amplification primer length 18–30 bp, amplification product length 45–70 bp, annealing temperature 57–62℃, and GC content between 40% and 60%. The synthesized primer sequences are as follows:

[0049] Forward primer 1 (M11-F1): 5'-GAAGGTGACCAAGTTCATGCTtgccaaagaagcaggtatcC-3' (SEQ ID NO.1);

[0050] Forward primer 2 (M11-F2): 5'-GAAGGTCGGAGTCAACGGATTtgccaaagaagcaggtatcT-3' (SEQ ID NO.2);

[0051] Reverse primer (M11-R): 5'-TGTTCATTACCAATCACAAAGGCA-3' (SEQ ID NO.3);

[0052] The underlined part represents the HEX tag sequence, and the wavy part represents the FAM tag sequence.

[0053] The nucleotide sequence of molecular marker M11 is shown in SEQ ID NO.4.

[0054] SEQ ID NO.4:

[0055] TGCCAAAGAAGCAGGTATCYCCATCAAATTTATTTTTTGATACACAAATAACTAGCA TTAAGAGTCTATAGAATACATTTGCCTTTGTGATTGGTAATGAACA; Y represents C or T.

[0056] 3. Detection of differences between primers and their parents using a real-time PCR platform.

[0057] (1) Extract DNA from leaves of barley CIHO11333, AWCS276 and F9 recombinant inbred lines.

[0058] (2) Using the genomic DNA of the barley to be tested as a template, primers were designed based on the KASP detection platform technology to perform real-time PCR amplification;

[0059] The primer sequences for step (2) are shown in SEQ ID NO.1-3. Furthermore, the 5' ends of primers M11-F1 and M11-F2 are respectively connected to HEX and FAM groups.

[0060] The quantitative real-time PCR amplification reaction system consisted of: 4.5 μL of 2×KASP Mastermix, 1.5 μL of KASPAssay Mix, 2 μL of template DNA, and 2 μL of Dnase / RNase-free deionized water. The KASPAssay Mix contained primer sets as shown in SEQ ID NO. 1-3, with a volume ratio of 2:2:5. Specifically, primers M11-F1, M11-F2, and M11-R at a concentration of 100 μM were mixed in the KASPAssay Mix at a volume ratio of 2:2:5.

[0061] The quantitative real-time PCR program was as follows: 95℃ pre-denaturation for 15 min; 95℃ denaturation for 20 s, 61℃ annealing and extension for 60 s, for 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ each time; 95℃ denaturation for 20 s, 55℃ annealing and extension for 40 s, for 42 cycles; and finally, fluorescence signal acquisition at 25℃ for 60 s.

[0062] (3) The specific methods for analyzing PCR products are as follows: The barley genotype CIHO11333 and the F9 line carrying the same genotype, exhibiting HEX fluorescence (i.e., CC genotype), are denoted as type A, representing lines containing the barley high-ear grain number QTL; the barley genotype AWCS276 and the F9 line carrying the same genotype, exhibiting FAM fluorescence (i.e., TT genotype), are denoted as type B, representing lines not containing the barley high-ear grain number QTL. The genotyping results of barley CIHO11333, AWCS276, and some F9 lines using M11 primers are shown below. Figure 3 .

[0063] Example 3: Application of molecular markers for barley ear grain number QTLs

[0064] 1. Field identification of the number of grains per ear phenotype of parents and population plants

[0065] In the field, barley lines Baudin (containing the same high grain number as CIHO11333) and AWCS276 (containing the same low grain number as CIHO11333) and their F7 recombinant inbred lines were planted. At the mature plant stage, five main ears of uniform growth (excluding edge rows) from each material were selected for grain number determination, specifically determining the total number of grains fertilized on each single ear.

[0066] 2. Applicability of primer sequences M11-F1 / F2 / R during population detection

[0067] (1) Extract DNA from the leaves of all materials in the above population.

[0068] (2) Using the DNA obtained in step (1) as a template, quantitative real-time PCR amplification was performed using the KASP primers designed in Example 2. The quantitative real-time PCR amplification reaction system and procedure were the same as in Example 2.

[0069] (3) The specific methods for analyzing PCR products are as follows: The plant genotype (i.e., CC genotype) that shows HEX fluorescence signal in barley Baudin and F7 lines carrying the same genotype is denoted as type A, which is a line containing the barley high spike grain number QTL; the plant genotype (i.e., TT genotype) that shows FAM fluorescence in barley AWCS276 and F7 lines carrying the same genotype is denoted as type B, which is a line not containing the barley high spike grain number QTL.

[0070] The results of genotyping of barley Baudin, AWCS276 and some F7 lines using M11 primers are shown below. Figure 4 The results of grain number detection based on genotyping results are shown below. Figure 5The results showed that the number of grains per ear in lines containing the high grain number QTL was significantly higher than that in lines without the high grain number QTL. The actual results were consistent with the expected results, indicating that the barley grain number QTL of the present invention does indeed have the ability to significantly increase the number of grains per ear in barley, and that the molecular marker M11 can be used to track and identify genes related to barley grain number.

[0071] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of a KASP primer combination in the preparation of products for identifying the grain number trait in barley ears, characterized in that, The KASP primer combination was used to detect the genotype of the molecular marker M11; The KASP primer combination includes two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3; The nucleotide sequence of the molecular marker M11 is shown in SEQ ID NO.

4. There is an SNP site at position 20 of the nucleotide sequence, which is a T / C mutation. The number of grains per spike in the barley samples was determined based on the genotype of the SNP locus: the number of grains per spike in CC genotype barley was higher than that in TT genotype barley. The barley is any one of the varieties shown in (1)-(5): (1) Barley CIHO11333; (2) Barley AWCS276; (3) Barley (Baudin); (4) Recombinant inbred lines constructed using barley CIHO11333 and barley AWCS276; (5) Recombinant inbred lines were constructed using barley Baudin and barley AWCS276.

2. The application according to claim 1, characterized in that, The product in question is a reagent kit.

3. The application of a product for identifying the number of grains per barley ear in identifying the number of grains per barley ear, characterized in that, The product includes a KASP primer combo; The KASP primer combination was used to detect the genotype of the molecular marker M11; The KASP primer combination includes two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3; The nucleotide sequence of the molecular marker M11 is shown in SEQ ID NO.

4. There is an SNP site at position 20 of the nucleotide sequence, which is a T / C mutation. The number of grains per spike in the barley samples was determined based on the genotype of the SNP locus: the number of grains per spike in CC genotype barley was higher than that in TT genotype barley. The barley is any one of the varieties shown in (1)-(5): (1) Barley CIHO11333; (2) Barley AWCS276; (3) Barley (Baudin); (4) Recombinant inbred lines constructed using barley CIHO11333 and barley AWCS276; (5) Recombinant inbred lines were constructed using barley Baudin and barley AWCS276.

4. The application according to claim 3, characterized in that, The product in question is a reagent kit.

5. The application of KASP primer combinations in identifying the number of grains per barley ear, characterized in that, The KASP primer combination was used to detect the genotype of the molecular marker M11; The KASP primer combination includes two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3; The nucleotide sequence of the molecular marker M11 is shown in SEQ ID NO.

4. There is an SNP site at position 20 of the nucleotide sequence, which is a T / C mutation. The number of grains per spike in the barley samples was determined based on the genotype of the SNP locus: the number of grains per spike in CC genotype barley was higher than that in TT genotype barley. The barley is any one of the varieties shown in (1)-(5): (1) Barley CIHO11333; (2) Barley AWCS276; (3) Barley (Baudin); (4) Recombinant inbred lines constructed using barley CIHO11333 and barley AWCS276; (5) Recombinant inbred lines were constructed using barley Baudin and barley AWCS276.

6. A method for identifying the number of grains per barley ear, characterized in that, Includes the following steps: DNA was extracted from the barley to be tested; Using the DNA as a template, quantitative real-time PCR was performed with KASP primers to obtain the genotype of the barley to be tested. The number of grains per spike of the barley to be tested was determined based on the genotype: the number of grains per spike of CC genotype barley was higher than that of TT genotype barley. The KASP primer combination includes two forward primers and one universal reverse primer; the nucleotide sequences of the two forward primers are shown in SEQ ID NO.1 and SEQ ID NO.2, respectively, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.3; The barley is any one of the varieties shown in (1)-(5): (1) Barley CIHO11333; (2) Barley AWCS276; (3) Barley (Baudin); (4) Recombinant inbred lines constructed using barley CIHO11333 and barley AWCS276; (5) Recombinant inbred lines were constructed using barley Baudin and barley AWCS276.

7. The method according to claim 6, characterized in that, The reaction system for the quantitative real-time PCR amplification was as follows: 4.5 μL of 2×KASP Mastermix, 1.5 μL of KASP Assay Mix, 2 μL of template DNA, and 2 μL of Dnase / RNase-free deionized water.

8. The method according to claim 6, characterized in that, The reaction procedure for the quantitative PCR amplification was as follows: pre-denaturation at 95℃ for 15 min; denaturation at 95℃ for 20 s, annealing and extension at 61℃ for 60 s, for 10 cycles, with the annealing and extension temperature decreasing by 0.6℃ each time; denaturation at 95℃ for 20 s, annealing and extension at 55℃ for 40 s, for 42 cycles; and fluorescence signal acquisition at 25℃ for 60 s.

Images