Primer probe combination and kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of infectious bombyx mori softening disease virus and application of primer probe combination and kit

By providing a combination of primer probes for specific nucleotide sequences for fluorescence quantitative PCR detection, the problem of low sensitivity of BmIFV detection in the prior art is solved, high sensitivity and specificity detection is achieved, and reliable means for early detection is provided.

CN120138231APending Publication Date: 2025-06-13SOUTHWEST UNIV
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510426115.5
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-04-07
Publication Date
2025-06-13

AI Technical Summary

Technical Problem

The existing fluorescence quantitative PCR detection methods have low sensitivity to infectious softening disease virus (BmIFV) in silkworms, making it difficult to achieve accurate and early detection.

Method used

A combination of primer probes including a specific nucleotide sequence is provided for fluorescence quantitative PCR detection. The combination includes upstream primers, downstream primers and probes. The probe has a fluorescent group marked at the 5' end and a quenching group marked at the 3' end. It has strong specificity and can detect BmIFV with high sensitivity.

Benefits of technology

It realizes high sensitivity detection of BmIFV, and can successfully detect viruses at extremely low concentrations (48copies/μL). It is suitable for artificial infection samples and diseased silkworm samples collected at the breeding site, providing a reliable means of early detection.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120138231A_ABST
    Figure CN120138231A_ABST
Patent Text Reader

Abstract

The invention provides a primer probe combination and a kit for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of infectious bombyx mori softening disease virus and application of the primer probe combination and the kit, and belongs to the technical field of molecular biological detection. The invention provides a primer and probe combination for fluorescent quantitative PCR (Polymerase Chain Reaction) detection of a bombyx mori infectious softening disease virus (BmIFV). The primer and probe combination comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a probe with a nucleotide sequence as shown in SEQ ID NO.3, the 5'end of the probe is marked with a fluorophore, and the 3 'end of the probe is marked with a quenching group. The primer probe combination is high in specificity and sensitivity, only BmIFV can be amplified, other pathogens of bombyx mori cannot be amplified, and the detection limit reaches 48 copies / microliter. The primer probe combination can be used for early detection of BmIFV in the silkworm breeding process.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of molecular biology detection, and particularly relates to a primer-probe combination, a kit and an application for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus. Background Art

[0002] Bombyx mori infectious flacherie is an epidemic viral disease that seriously affects sericulture production, and its pathogen is Bombyx mori infectious flacherie virus (BmIFV). Microscopic observation has been widely used for the detection of pathogenic microorganisms in Bombyx mori, but since BmIFV is a non-inclusion virus, virus particles cannot be observed under an ordinary optical microscope. In sericulture production practice, the detection of this virus mainly relies on empirical disease discrimination. However, the problem is that the symptoms caused by BmIFV are extremely similar to those of Bombyx mori densonucleosis and bacterial diseases, making it difficult to achieve accurate and early diagnosis based solely on disease symptoms, and thus prone to the occurrence of mass infections. The serological discrimination method has the characteristics of strong specificity and high sensitivity, but there are relatively high cross-reactions and non-specific reactions. With the development of molecular biotechnology, infectious flacherie virus can be detected by PCR after reverse-transcribing viral RNA into cDNA by designing specific primers in conserved regions. Real-time fluorescence PCR (Real-time PCR) is to add a fluorescent probe or fluorescent dye to the PCR reaction system, use the accumulation of fluorescent signals to monitor the entire PCR process in real time, and finally analyze the results through the amplification curve. However, the current method for fluorescence quantitative PCR detection of BmIFV has the problem of low sensitivity and urgently needs to be further improved. Summary of the Invention

[0003] The purpose of the present invention is to provide a primer-probe combination, a kit and an application for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus. The primer-probe combination and kit of the present invention can be used to establish a rapid detection method for BmIFV and achieve highly sensitive detection of BmIFV.

[0004] The present invention provides a primer-probe combination for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus, including an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2, and a probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0005] The present invention also provides a kit for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus, including the above-mentioned fluorescence probe combination.

[0006] In a preferred embodiment of the present invention, it further includes a reaction solution for fluorescence quantitative PCR.

[0007] The present invention also provides the application of the above primer-probe combination or the above kit in the fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus for non-diagnostic purposes.

[0008] The present invention also provides a method for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus for non-diagnostic purposes, including the following steps:

[0009] Extract the total RNA of the sample to be tested;

[0010] Reverse transcribe the total RNA into cDNA;

[0011] Using the cDNA as a template, perform fluorescence quantitative PCR with the primer-probe combination described in claim 1 or the kit described in claim 2 or 3.

[0012] In a preferred embodiment of the present invention, the reaction system of the fluorescence quantitative PCR is 10 μL in total, including the following components: 0.1 μL of probe, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 7.5 μL of reaction solution, and 2 μL of template; the final concentration of the probe is 100 nM, and the final concentrations of the upstream primer and the downstream primer are 200 nM respectively.

[0013] In a preferred embodiment of the present invention, the reaction program of the fluorescence quantitative PCR includes: 37°C for 2 min; 95°C for 30 s; 95°C for 10 s, 60°C for 30 s, for 40 cycles.

[0014] In a preferred embodiment of the present invention, after the fluorescence quantitative PCR, the detection result is determined; the criteria for determining the detection result include:

[0015] When the amplification result of the sample has a specific amplification curve and the Ct value ≤ 38, it can be determined as positive;

[0016] When the amplification result of the sample has no specific amplification curve or no Ct value, it can be determined as negative;

[0017] When the amplification result of the sample has a specific amplification curve and 38 < Ct value ≤ 40, it can be determined as a positive suspicious sample;

[0018] The positive suspicious sample is retested. If the Ct value of the retest ≤ 40 and a specific amplification curve appears, it can be determined as positive; if the amplification result of the retest has no Ct value or no specific amplification curve, it can be determined as negative.

[0019] In a preferred embodiment of the present invention, after performing fluorescence quantitative PCR, it further includes combining the Ct value and the standard curve to obtain the quantitative result of Bombyx mori infectious flacherie virus in the sample to be tested; the standard curve is constructed with the logarithm of the standard plasmid concentration 10 as the abscissa and the Ct value as the ordinate; the standard plasmid is diluted in a ten-fold gradient, and the concentrations are: 4.8×10 7 ~4.8×10 0 copies / μL.

[0020] In a preferred embodiment of the present invention, the formula of the standard curve is: y = -3.338x + 40.64, R 2 = 0.992, slope = -3.34.

[0021] Beneficial effects: The present invention provides a primer-probe combination for fluorescence quantitative PCR (qPCR) detection of Bombyx mori infectious flacherie virus (BmIFV), including an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2, and a probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group. The primer-probe combination of the present invention has strong specificity and can only amplify BmIFV, not other pathogens of Bombyx mori, and can be used for specific detection of BmIFV. The primer-probe combination of the present invention has high sensitivity, and when the standard plasmid is diluted to 48 copies / μL (the standard plasmid concentration is 0.11 fg / μL), the BmIFV signal can still be detected. In addition, for artificially infected samples and diseased silkworm samples collected from the breeding site, fluorescence quantitative PCR detection using the primer-probe combination of the present invention can successfully detect BmIFV, providing a reliable means for early detection of BmIFV during the breeding process of Bombyx mori. Description of the Drawings

[0022] Figure 1 Shows the verification result of the specificity of the BmIFV primer; among them, M: nucleic acid Marker; the templates are respectively the genomic DNA of Nosema bombycis, the genomic DNA of Bombyx mori nucleopolyhedrovirus, the genomic DNA of Bombyx mori bidensovirus, the cDNA of Bombyx mori infectious flacherie virus, and the cDNA of Bombyx mori cytoplasmic polyhedrosis virus;

[0023] Figure 2 Shows the standard curve; among them, the standard plasmid is diluted in a 10-fold gradient (4.8×10 7 ~4.8×10 2 copies / μL), R 2 = 0.992, slope = -3.34;

[0024] Figure 3It is a result graph for the sensitivity analysis of the standard plasmid for fluorescence quantitative PCR detection; the template is the standard plasmid diluted in a 10-fold gradient (4.8×10 7 copies / μL - 4.8×10 0 copies / μL), and C is the negative control with ddH 2 O as the template. Specific implementation mode

[0025] The present invention provides a primer-probe combination for fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus, including an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2, and a probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

[0026] In the present invention, the fluorescent group is Cy5; the quenching group is HBQ2.

[0027] The primer-probe combination of the present invention is designed with the full-length RNA sequence of BmIFV as the detection target. The accession number of the Bombyx mori infectious flacherie virus RNA sequence in GenBank is EU868609.1. The primer - qIFV-257 is designed using Primer Premier 5 software. According to the amplified sequence of the primer qIFV-257, the probe - pIFV-257 is designed using Primer Premier 5 software. In the present invention, the nucleotide sequence of the amplified sequence of the primer qIFV-257 is as shown in SEQ ID NO.4, specifically: GGCATAGCATCTAACCATCCATGTCTTAAGTCCTCAGTAATAAGAGACGTTGGAGCGATGGATAGAAGGAGGGACATATTGGCACGGTGTGAATTTACCCCAGAAGTAGAAAAATATATAAAGTCTAAGAAGTTGTTGAATGTGGCATCTGCTTTACCAGAGGAAATGACGAGGAATAACAAACATTTGCGATATGGAGTGTTTAAGGATCCGACAAAGGTTAGACCGAATACGCAGGATGTGCGAGTGGAAACTAG, with a size of 257bp.

[0028] The primer-probe combination of the present invention has strong specificity and can only amplify BmIFV, and cannot amplify other pathogens of Bombyx mori. It can be used for specific detection of BmIFV; the other pathogens of Bombyx mori include one or several of Nosema bombycis, Bombyx mori nucleopolyhedrovirus, Bombyx mori bidensovirus, and Bombyx mori cytoplasmic polyhedrosis virus.

[0029] The primer-probe combination of the present invention has high sensitivity. When the standard plasmid is diluted to 48 copies / μL (the standard plasmid concentration is 0.11 fg / μL), BmIFV can still be detected. In addition, for artificially infected samples and diseased silkworm samples collected from the breeding site, fluorescence quantitative PCR detection using the primer-probe combination of the present invention can successfully detect BmIFV, providing a reliable means for the early detection of BmIFV during the silkworm breeding process. The fluorescence quantitative PCR detection method for BmIFV established based on the primers and probes of the present invention has good specificity, high sensitivity, simple operation, requires few instruments, can be used for the specific detection of BmIFV in the early stage of silkworm infection, and can be quickly popularized and used in sericulture production through simple training.

[0030] The present invention also provides a kit for fluorescence quantitative PCR detection of infectious flacherie virus of silkworm, including the fluorescence probe combination described in the above solution.

[0031] In the specific implementation process of the present invention, the kit further includes a reaction solution for fluorescence quantitative PCR; the reaction solution is a premixed solution for fluorescence quantitative PCR (probe method) using DNA or cDNA as a template, and its core components are: hot start Taq DNA polymerase modified by antibody, dUTP / UDG (which can effectively control the contamination of amplification products), purchased from Qingdao Lijian Biotechnology Co., Ltd., specification: 1 mL / branch, 5 branches / package.

[0032] The present invention also provides the application of the primer-probe combination or the kit described in the above solution in the fluorescence quantitative PCR detection of infectious flacherie virus of silkworm for non-diagnostic purposes.

[0033] The present invention also provides a method for fluorescence quantitative PCR detection of infectious flacherie virus of silkworm for non-diagnostic purposes, including the following steps:

[0034] Extract the total RNA of the sample to be tested;

[0035] Reverse transcribe the total RNA into cDNA;

[0036] Using the cDNA as a template, perform fluorescence quantitative PCR using the primer-probe combination or the kit described in the above solution.

[0037] In the specific implementation process of the present invention, the method for extracting the total RNA of the sample to be tested is the Trizol method.

[0038] In the specific implementation process of the present invention, taking 10 μL as the reaction system of the fluorescence quantitative PCR, it includes the following components: 0.1 μL of probe, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 7.5 μL of reaction solution and 2 μL of template; the final concentration of the probe is 100 nM, and the final concentrations of the upstream primer and the downstream primer are both 200 nM.

[0039] In the specific implementation process of the present invention, the reaction program of the fluorescence quantitative PCR includes: 37 °C for 2 min; 95 °C for 30 s; 95 °C for 10 s, 60 °C for 30 s, for 40 cycles. The reaction program of the present invention can ensure the specificity and sensitivity of the detection and obtain the best amplification efficiency.

[0040] In the specific implementation process of the present invention, after the fluorescence quantitative PCR, the detection result is determined; the criteria for determining the detection result include:

[0041] When the amplification result of the sample has a specific amplification curve and the Ct value ≤ 38, it can be determined as positive;

[0042] When the amplification result of the sample has no specific amplification curve or no Ct value, it can be determined as negative;

[0043] When the amplification result of the sample has a specific amplification curve and 38 < Ct value ≤ 40, it can be determined as a positive suspicious sample;

[0044] The positive suspicious sample is rechecked. If the Ct value of the recheck ≤ 40 and a specific amplification curve appears, it can be determined as positive; if the amplification result of the recheck has no Ct value or no specific amplification curve, it can be determined as negative.

[0045] After the fluorescence quantitative PCR, the present invention also includes combining the Ct value and the standard curve to obtain the quantitative result of Bombyx mori infectious flacherie virus in the sample to be detected; the standard curve is constructed with the concentration of the standard plasmid as the abscissa and the Ct value as the ordinate; the standard plasmid is serially diluted by tenfold, and the concentrations are: 4.8×10 7 ~4.8×10 0 copies / μL.

[0046] In the specific implementation process of the present invention, the standard curve formula is y = -3.338x + 40.64, R 2 = 0.992, slope = -3.34

[0047] To further illustrate the present invention, the following describes in detail a primer-probe combination, a kit and its application for the fluorescence quantitative PCR detection of Bombyx mori infectious flacherie virus provided by the present invention with reference to the drawings and examples, but they should not be construed as limiting the protection scope of the present invention.

[0048] Example 1

[0049] 1. Primer design

[0050] Select the Bombyx mori infectious flacherie virus RNA sequence (GenBank: EU868609.1), and use Primer Premier 5 software to design and synthesize primers for specific detection. The primer sequences for detection are as follows:

[0051] qIFV-257F: 5'-GGCATAGCATCTAACCATC-3' (SEQ ID NO.1);

[0052] qIFV-257R: 5'-CTAGTTTCCACTCGCACAT-3' (SEQ ID NO.2).

[0053] 2. Primer specificity verification

[0054] Use the genomes of common pathogens in sericulture production as templates to verify the specificity of the designed primer qIFV-257 and check whether it can specifically amplify BmIFV only.

[0055] 2.1 Obtaining BmIFV cDNA

[0056] Take the midgut of Bombyx mori infected with BmIFV, place it in a mortar, add 1 mL of sterile water and grind thoroughly to make a virus suspension. Take 200 μL of the virus suspension, extract RNA by the Trizol method and then reverse transcribe. The main steps are as follows:

[0057] 1) Transfer the virus suspension to a 1.5 mL RNase-free centrifuge tube, add 1 mL of Trizol, mix well by shaking, and let it stand at room temperature for 5 - 10 min;

[0058] 2) Add 200 μL of chloroform, mix well by shaking for 15 s, and let it stand at room temperature for 10 min;

[0059] 3) Centrifuge at 12000g for 15 min at 4℃, and pipette the upper aqueous phase into a new 1.5 mL enzyme-free centrifuge tube;

[0060] 4) Add 500 μL of isopropanol, mix well, and let it stand at room temperature for 5 - 10 min;

[0061] 5) Centrifuge at 12000g for 10 min at 4℃, and discard the supernatant;

[0062] 6) Add 1 mL of 75% ethanol, gently shake, centrifuge at 8000g for 5 min at 4℃, and discard the supernatant;

[0063] 7) Dry at room temperature for 5 min;

[0064] 8) Add 50 μL of DEPC water to dissolve the RNA, measure the concentration, and store it at -80 °C.

[0065] 9) Reverse transcribe the extracted RNA into cDNA. The main steps are as follows:

[0066] 10) Take a 0.5 mL RNase-free centrifuge tube, add 3 μL of 5×gDNA digester Mix, 2 μL of RNA template, and 10 μL of RNase-free H 2 2O, incubate at 42 °C for 2 min;

[0067] 11) Add Ⅲ superplus 5 μL and perform reverse transcription. The program is as follows:

[0068] 25 °C for 5 min, 55 °C for 15 min, 85 °C for 5 min.

[0069] The product obtained above is the cDNA of Bombyx mori infectious flacherie virus.

[0070] 2.2. Genomic DNA extraction of Nosema bombycis, Bombyx mori nucleopolyhedrovirus, and Bombyx mori bidensovirus

[0071] 1) Take 200 μL of the pathogen suspension in a 1.5 mL centrifuge tube, add 600 μL of 2% CTAB and 25 μL of proteinase K, mix well, and incubate at 56 °C for 1 h;

[0072] 2) After incubation, centrifuge at 12000 rpm for 3 min, transfer the supernatant to a nucleic acid purification column with a collection tube, centrifuge at 12000 rpm for 2 min, and discard the liquid in the collection tube;

[0073] 3) Add 700 μL of 75% alcohol, centrifuge at 12000 rpm for 2 min, discard the liquid in the collection tube, and repeat once;

[0074] 4) Spin empty, that is, do not add any liquid to the nucleic acid purification column and directly centrifuge at 12000 rpm for 2 min;

[0075] 5) Place the nucleic acid purification column in a new sterile 1.5 mL centrifuge tube, add 50 μL of ddH 2 O on the filter membrane of the nucleic acid purification column, let it stand for 1 min, and centrifuge at 12000 rpm for 1 min to elute the genomic DNA into the 1.5 mL centrifuge tube, and the genomic DNA extraction is completed.

[0076] 2.3 Obtaining cDNA of Bombyx mori cytoplasmic polyhedrosis virus

[0077] Take 200 μL of Bombyx mori cytoplasmic polyhedrosis virus suspension for RNA extraction and reverse transcription. The specific method is the same as that for obtaining BmIFV cDNA.

[0078] 2.4 Primer specificity verification

[0079] Using the primers designed above, with the genomic DNAs of BmNPV, Nosema bombycis, and Bombyx mori bidensovirus (BmBDV), as well as the cDNAs of Bombyx mori cytoplasmic polyhedrosis virus and Bombyx mori infectious flacherie virus as templates, perform PCR amplification. The amplification system and reaction program are as follows:

[0080] The reaction system is 25 μL, mainly including: 12.5 μL of PrimeSTAR Max Premix (2×), 1 μL each of the upstream and downstream primers, 1 μL of the template, and the remaining ddH 2 O, and the final concentration of each primer is 400 nM;

[0081] The reaction program is: pre-denaturation at 98 °C for 3 min; cycling segment at 98 °C for 10 s, 55 °C for 15 s, 72 °C for 10 s, a total of 30 cycles, and final extension at 72 °C for 7 min.

[0082] The results are as Figure 1 shown. qIFV-257 can only amplify BmIFV and cannot amplify other pathogens of Bombyx mori, indicating that qIFV-257 has strong specificity and can be used for specific detection of BmIFV.

[0083] 3. Probe design and verification

[0084] According to the amplified sequence of primer qIFV-257, use Primer Premier 5 software to design a probe and synthesize probe pIFV-257. The probe sequence is: 5'-AAGTCCTCAGTAATAAGAGACGTTGG-3' (SEQ ID NO.3), with Cy5 labeled at the 5' end and HBQ2 labeled at the 3' end.

[0085] 3.1 Standard plasmid preparation

[0086] 1) Select qIFV-257 as the primer, and use the obtained BmIFV cDNA as the template for PCR amplification. The amplification system and amplification program are the same as those in 2.4.

[0087] 2) Detect the PCR amplification product by nucleic acid gel, and recover the single DNA fragment at 257 bp;

[0088] 3) Ligate the DNA obtained from the above recycling with the pESI-Blunt simple vector, transfer it into DH5α competent cells, then spread it on an LB solid culture plate containing Amp resistance, and culture it overnight at 37°C in an inverted position;

[0089] 4) Pick 8 single colonies and inoculate them into 300 μL of LB liquid medium containing Amp resistance;

[0090] 5) After culturing for 4 h, perform electrophoresis of the bacterial solution;

[0091] 6) Select the bacterial solution in which the DNA fragment has been successfully ligated with the pESI-Blunt simple vector, perform DNA sequencing, and submit the sequencing results to the NCBI website for comparison;

[0092] 7) Inoculate the corresponding bacterial solution that has been successfully transferred with the plasmid for qIFV-257 amplification product into 5 mL of LB liquid medium containing Amp, and culture it at 37°C and 180 rpm for 12 - 16 h.

[0093] 3.2. Standard Plasmid Extraction

[0094] 1) Take 5.0 mL of the bacterial solution and centrifuge at 12000 rpm for 1 min at room temperature to collect bacteria.

[0095] 2) Add 250 μL of Solution I / RNaseA mixture, vortex to completely suspend the bacterial cells.

[0096] 3) Add 250 μL of Solution II to the resuspended mixture, gently invert and mix 4 - 6 times.

[0097] 4) Add 350 μL of Solution III, gently invert several times until a white flocculent precipitate forms, and centrifuge at 13000 rpm for 10 min at room temperature.

[0098] 5) Transfer the supernatant to a Miniprep DNA binding column nested in a 2 mL collection tube, centrifuge at 13000 rpm for 1 min, and discard the effluent. Miniprep DNA binding column, centrifuge at 13000 rpm for 1 min, and discard the effluent.

[0099] 6) Add 500 μL of HBC Buffer to the binding column, centrifuge at 13000 rpm for 1 min, and discard the effluent.

[0100] 7) Add 700 μL of DNAWash Buffer to the binding column, centrifuge at 13000 rpm for 1 min, discard the effluent, centrifuge at 13000 rpm for 2 min without sample, and spin dry the liquid in the binding column.

[0101] 8) Load the binding column into a sterile 1.5 mL centrifuge tube and add 50 μL of Elution Buffer to the filter membrane of the binding column.

[0102] 9) Let it stand for 1 min, centrifuge at 13,000 rpm for 1 min. The liquid in the 1.5 mL centrifuge tube is the standard plasmid. The measured concentration is 111.4 ng / μL, and the calculated copy number is 4.8×10 10 copies / μL. Store it at -20 °C.

[0103] 3.3 Establishment of the fluorescence quantitative PCR standard curve

[0104] Perform 10-fold serial dilutions of the standard plasmid (4.8×10 7 ~4.8×10 2 copies / μL), and use the serially diluted plasmids as templates for fluorescence quantitative PCR detection.

[0105] Fluorescence quantitative PCR system: 0.1 μL of probe (10 μM), 0.2 μL each of upstream and downstream primers (10 μM), 7.5 μL of reaction solution (purchased from Qingdao Lijian Biotechnology Co., Ltd.), and 2 μL of template.

[0106] Reaction program: 37 °C for 2 min; 95 °C for 30 s; 95 °C for 10 s, collect fluorescence at 60 °C for 30 s, 40 cycles.

[0107] Result analysis: Under the Cy5 signal channel, when the amplification result of the sample has a specific amplification curve and the Ct value ≤ 38, it can be determined as positive;

[0108] When the amplification result of the sample has no specific amplification curve or no Ct value, it can be determined as negative;

[0109] When the amplification result of the sample has a specific amplification curve and 38 < Ct value ≤ 40, it can be preliminarily determined as a positive suspicious sample;

[0110] Retest the preliminarily determined suspicious samples. If the Ct value of the retest ≤ 40 and a specific amplification curve appears, it is finally determined as positive; if the amplification result of the retest has no Ct value or no specific amplification curve, it is finally determined as negative.

[0111] As Figure 2 shown, the qIFV-257 standard curve formula is: y = -3.338x + 40.64, R 2 = 0.992, slope = -3.34.

[0112] 3.4 Verification of the sensitivity of fluorescence quantitative PCR

[0113] Perform 10-fold serial dilutions of the standard plasmid (4.8×10 7~4.8×10 0 copies / μL), using the standard plasmid as a template, qIFV-257 as the primer, and pIFV-257 as the probe, fluorescence quantitative PCR amplification was carried out. The amplification system and procedure were the same as those in 3.3. The results were as Figure 3 shown. When the BmIFV standard plasmid was diluted to 48 copies / μL (the standard plasmid concentration was 0.11 fg / μL), it could still be detected, indicating that the detection sensitivity of this primer and probe was high.

[0114] Example 2 Fluorescence Quantitative PCR Detection of Diseased Silkworm Samples

[0115] Diseased silkworm samples artificially infected with BmIFV virus in the laboratory and diseased silkworm samples at the breeding site were collected and subjected to BmIFV detection respectively. The midguts were correspondingly ground into homogenates, and 200 μL was taken for cDNA preparation. The extraction method was the same as that described in 2.1 of Example 1. The obtained cDNA was used as a template for fluorescence quantitative PCR detection. The reaction system and procedure were the same as those in 3.3 of Example 1.

[0116] Result analysis: As shown in Table 1, for artificially infected samples and diseased silkworm samples at the breeding site, fluorescence quantitative PCR could successfully detect them, indicating that the fluorescence quantitative PCR detection method established by the present invention could provide a reliable means for the early detection of BmIFV during the silkworm breeding process.

[0117] Table 1 Fluorescence Quantitative PCR Detection of BmIFV in Diseased Silkworms

[0118]

[0119] In summary, the present invention established a rapid detection method for BmIFV based on fluorescence quantitative PCR (probe method). It can not only be quickly applied to sericulture production, but also achieve high-specificity, high-sensitivity, and high-throughput early detection of BmIFV, thereby realizing the precise prevention and control of infectious flacherie of silkworms. The popularization of this method helps to reduce the economic losses caused by infectious flacherie of silkworms and provides technical support for promoting the green and healthy development of the sericulture industry.

[0120] Although the above embodiments have described the present invention in detail, they are only a part of the embodiments of the present invention, not all embodiments. People can also obtain other embodiments according to these embodiments without creative efforts, and these embodiments all belong to the protection scope of the present invention.

Claims

1. A primer-probe combination for fluorescent quantitative PCR detection of silkworm infectious malarial disease virus, characterized in that: It comprises an upstream primer with a nucleotide sequence as shown in SEQ ID NO.1, a downstream primer with a nucleotide sequence as shown in SEQ ID NO.2 and a probe with a nucleotide sequence as shown in SEQ ID NO.3; the 5' end of the probe is labeled with a fluorescent group, and the 3' end is labeled with a quenching group.

2. A kit for detecting silkworm infectious malarial disease virus by fluorescence quantitative PCR, characterized in that: The invention comprises the fluorescent probe combination as claimed in claim 1.

3. The kit according to claim 2, characterized in that It also includes a fluorescence quantitative PCR reaction solution.

4. Use of the primer-probe combination of claim 1 or the kit of claim 2 or 3 in fluorescent quantitative PCR detection of Bombyx mori infectious malarial disease virus for non-diagnostic purposes.

5. A method for detecting Bombyx mori infectious malarial disease virus by fluorescence quantitative PCR for non-diagnostic purposes, characterized in that: The following steps are involved: Extracting total RNA from samples to be tested; Reverse transcribing the total RNA into cDNA; Using the cDNA as a template, the primer-probe combination of claim 1 or the kit of claim 2 or 3 is used to perform fluorescent quantitative PCR.

6. The method according to claim 5, characterized in that The reaction system of the fluorescent quantitative PCR is 10 μL, including the following components: 0.1 μL of probe, 0.2 μL of upstream primer, 0.2 μL of downstream primer, 7.5 μL of reaction solution and 2 μL of template; the final concentration of the probe is 100 nM, and the final concentrations of the upstream primer and the downstream primer are 200 nM respectively.

7. The method according to claim 5 or 6, characterized in that: The reaction procedure of the fluorescent quantitative PCR includes: 37° C., 2 min; 95° C., 30 s; 95° C., 10 s, 60° C., 30 s, 40 cycles.

8. The method according to claim 5, characterized in that After the fluorescent quantitative PCR, the test result is determined; the criteria for determining the test result include: When the amplification result of the sample has a specific amplification curve and the Ct value is ≤38, it is judged as positive; When the amplification result of the sample has no specific amplification curve or Ct value, it is judged as negative; When the amplification result of the sample has a specific amplification curve and the Ct value is 38<Ct value≤40, it is judged as a positive suspected sample; The positive suspected sample is retested. If the Ct value of the retest is ≤40 and a specific amplification curve appears, it is judged as positive; if the amplification result of the retest has no Ct value or no specific amplification curve, it is judged as negative.

9. The method according to claim 8, characterized in that After the fluorescence quantitative PCR is performed, the method also includes combining the Ct value and the standard curve to obtain the quantitative result of the silkworm infectious malarial disease virus in the sample to be tested; the standard curve is based on the standard plasmid concentration Log 10 The standard plasmid was diluted in a ten-fold gradient, and the concentration was: 4.8×10 7 ~4.8×10 0 copies / μL.

10. The method according to claim 9, characterized in that The standard curve formula is: y = -3.338x + 40.64, R 2 =0.992, slope =-3.34.