Application of engineered exosome rich in RHOT1 in preparation of medicine for improving insulin resistance

By forming a recombinant protein with the polypeptide P15 and RHOT1 protein and expressing it in the form of exosomes, the difficulty of RHOT1 protein in the treatment of insulin resistance is solved, and the improvement of mitochondrial function and the therapeutic effect of insulin resistance is achieved.

CN120154742AActive Publication Date: 2025-06-17GUANGZHOU SUYUAN BIOTECHNOLOGY CO LTD +1

Patent Information

Application Number
CN202510646714.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-05-20
Publication Date
2025-06-17
Estimated Expiration
2045-05-20

AI Technical Summary

Technical Problem

The prior art is difficult to effectively express and apply the RHOT1 protein through exosome form, limiting its application in the treatment of insulin resistance.

Method used

The cells were transfected to extract RHOT1-Exo-rich RHOT1-Exo- by forming the recombinant protein RHOT1-P15 with the RHOT1 protein and constructing a recombinant plasmid expressing the recombinant protein.

Benefits of technology

The RHOT1 protein was successfully transported and enriched across organelles through exosome form, which significantly promoted mitochondrial oxidative phosphorylation, improved mitochondrial dysfunction, and had the effect of treating insulin resistance.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120154742A_ABST
    Figure CN120154742A_ABST
Patent Text Reader

Abstract

The invention discloses an application of an engineered exosome rich in RHOT1 in preparation of a medicine for improving insulin resistance. The engineering exosome RHOT1-Exo rich in RHOT1 is obtained by the following steps: screening to obtain a polypeptide P15 targeting CD81, forming a recombinant protein RHOT1-P15 from the P15 and RHOT1, then constructing a recombinant plasmid for expressing the recombinant protein, transfecting cells, culturing, and extracting the exosome, thereby obtaining the engineering exosome RHOT1-Exo rich in RHOT1. The RHOT1-Exo is used for treating insulin-resistant cells, and the research shows that the RHOT1-Exo can effectively improve the ATP content of mitochondria, improve the oxidative phosphorylation level, enhance the antioxidant enzyme activity of cells and reduce ROS (reactive oxygen species), finally improve the mitochondrial network structure and improve the expression of insulin signal channel related proteins, and can be used for treating insulin-resistant cells. The obvious mitochondrial function repairing potential and the insulin resistance improving effect are shown. According to the invention, the RHOT1 protein is successfully applied to the treatment of insulin resistance in the form of exosome, and a scientific strategy is provided for the application of the medicine for clinically treating insulin resistance.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the field of biotechnology, and more specifically, relates to the application of engineered exosomes rich in RHOT1 in the preparation of a medicament for treating insulin resistance. Background Art

[0002] Mitochondrial dysfunction is closely linked to the occurrence of insulin resistance syndrome (IRS). IR includes disorders of glucose metabolism, hyperinsulinemia, dyslipidemia, hypertension, etc. For example, in type 2 diabetic IR patients, mitochondrial function is significantly impaired, and the resulting β-oxidation disorder will lead to the accumulation of fatty acids and an increase in ROS, activating corresponding stress proteins, thereby inhibiting insulin signal transduction. When the body undergoes oxidative metabolism, the ETC in mitochondria is prone to a large amount of electron leakage, reducing oxygen molecules to form reactive oxygen species (ROS). Excessive ROS leads to mtDNA mutations, causing mitochondrial dysfunction and affecting mitochondrial homeostasis, further exacerbating the progression of IR. Therefore, it is expected to improve insulin resistance by improving mitochondrial dysfunction.

[0003] RHOT1 is a key regulator of insulin secretion in human islets, and its function in cells is closely related to the morphology and function of mitochondria. Research shows that the activity of RHOT1 is regulated by multiple signaling pathways, including post-transcriptional modifications such as phosphorylation and dephosphorylation, which directly affect the function of RHOT1 and the dynamic balance of mitochondria. Silencing of RHOT1 in cells will lead to an increase in ROS, a decrease in intracellular ATP levels, resulting in abnormal mitochondrial function and reduced insulin secretion. Overexpression of RHOT1 can reduce ROS levels, alleviate oxidative stress damage to cells, improve mitochondrial dysfunction, and improve insulin resistance.

[0004] Exosomes are small vesicles secreted by cells containing nucleic acids, proteins, and lipids. Exosomes have high targeting and the ability to penetrate biological barriers, low immunogenicity and high biocompatibility, multi-functional payloads and potential for combination therapy, can reduce side effects and enhance stability, and have natural sources and potential for large-scale production. Therefore, they can be used as drug delivery carriers for the treatment of various diseases. However, the RHOT1 protein itself cannot be effectively expressed in exosomes, which limits the application of the RHOT1 protein in the treatment of insulin resistance in the form of exosomes. However, the RHOT1 protein does not exist in exosomes in its natural state, limiting its application in the treatment of mitochondrial dysfunction in the form of exosomes. Summary of the Invention

[0005] The object of the present invention is to overcome the above-mentioned defects and deficiencies existing in the prior art, and to provide the use of engineered exosomes rich in RHOT1 in the preparation of drugs for treating insulin resistance.

[0006] The second object of the present invention is to provide the use of engineered exosomes rich in RHOT1 in the preparation of drugs for treating insulin resistance caused by mitochondrial dysfunction.

[0007] The above objects of the present invention are achieved by the following technical solutions:

[0008] The present invention first prepared engineered exosomes rich in RHOT1 (RHOT1-Exo). First, a polypeptide P15 with an amino acid sequence shown in any one of SEQ ID No. 1-4 is combined with RHOT1 to form a recombinant protein RHOT1-P15. Then, a recombinant plasmid expressing the recombinant protein is constructed and transfected into cell culture, and exosomes are extracted to obtain engineered exosomes RHOT1-Exo rich in RHOT1; that is, the coding gene of the polypeptide P15 with an amino acid sequence shown in any one of SEQ ID No. 1-4 is ligated to the 3' end or 5' end of the RHOT1 protein coding gene to obtain a chimeric gene. Then, a recombinant plasmid expressing the chimeric gene is constructed and transfected into cells for expression, and exosomes are extracted to obtain engineered exosomes RHOT1-Exo rich in RHOT1.

[0009] Polypeptides (Molecular glue) are a class of artificially synthesized substances. Polypeptides can be enzymes, transcription factors, structural proteins, etc. Polypeptides can promote the interaction between proteins, thereby forming stable ternary complexes or enhancing existing protein-protein interactions.

[0010] CD81 is a tetraspanin protein widely present on the cell surface and naturally exists in exosomes. It is one of the important markers of exosomes and can be used for the identification and separation of exosomes. In the application of exosome targeting engineering, using CD81 for targeted modification can achieve precise targeted delivery of exosomes, thereby improving the therapeutic effect and reducing side effects, which has important scientific research and clinical significance.

[0011] In the present invention, a phage library is incubated with CD81 recombinant protein to screen out a polypeptide P15 that targets and binds to CD81. The polypeptide P15 is linked to the end of RHOT1 protein through genetic recombination technology to form a recombinant protein RHOT1-P15, so as to promote the binding of RHOT1 to CD81. Since CD81 is a molecular protein that already exists in exosomes, the polypeptide P15 can bind the RHOT1 protein to CD81, thereby helping the RHOT1 protein to achieve transcellular transport from inside the cell to exosomes, enabling it to be enriched in exosomes. Specifically, by constructing a recombinant plasmid expressing the recombinant protein RHOT1-P15 (that is, connecting the coding gene of polypeptide P15 to the 3' end or 5' end of the RHOT1 protein coding gene to obtain a chimeric gene, and then constructing a recombinant plasmid expressing this chimeric gene), and transfecting cells for culture; the polypeptide P15 can link RHOT1 to CD81 in target exosomes, promoting the binding of RHOT1 to CD81, and obtaining engineered exosomes (RHOT1-Exo) rich in RHOT1. When the amino acid sequences of RHOT1 protein and polypeptide P15 are known, those skilled in the art can obtain the coding gene sequences of RHOT1 protein and polypeptide P15 by conventional technical means and optimize them according to the host codon preference.

[0012] The present invention applies the engineered exosomes RHOT1-Exo to a HepG2 cell model with high-glucose-induced insulin resistance, and detects the antioxidant activity index of cell mitochondria and the expression of insulin signaling pathway proteins. The results show that the engineered exosomes RHOT1-Exo have a therapeutic effect on insulin resistance model cells, indicating that the RHOT1 protein successfully plays a role in the treatment of insulin resistance in the form of exosome expression.

[0013] Specifically, the present invention adds the engineered exosomes RHOT1-Exo to a HepG2 cell model with high-glucose-induced insulin resistance, evaluates its effects on the ATP content, mitochondrial membrane potential, ROS level and mtDNA content in the model cells, detects the expression level of insulin signaling pathway proteins. The research results show that the constructed engineered exosomes RHOT1-Exo significantly promote mitochondrial oxidative phosphorylation, promote the expression of antioxidant enzymes in animal cells and improve the mitochondrial network structure, have the effect of promoting the recovery of mitochondrial function, regulate the biological effects of various mitochondrial metabolic enzymes, enhance its antioxidant capacity, and have application value in insulin resistance caused by mitochondrial dysfunction.

[0014] Therefore, the present invention first provides the application of the above-mentioned engineered exosomes rich in RHOT1 in the preparation of drugs for improving insulin resistance.

[0015] The present invention also provides the use of the engineered exosomes rich in RHOT1 in the preparation of a drug for treating insulin resistance associated with mitochondrial dysfunction.

[0016] Furthermore, the insulin resistance is caused by mitochondrial dysfunction.

[0017] Furthermore, the drug is used in the preparation of a drug for treating insulin resistance by promoting mitochondrial oxidative phosphorylation in the cells of a subject, regulating the activities of mitochondrial metabolic enzymes and antioxidant enzymes, scavenging ROS, increasing the ATP content and promoting mitochondrial oxidative phosphorylation, enhancing mitochondrial network formation and restoring mitochondrial function.

[0018] Furthermore, the subject is selected from mammals.

[0019] Furthermore, the mammals are selected from mice, cats, dogs, pigs, cows, horses, sheep, monkeys, humans, etc.

[0020] Furthermore, the drug further comprises other pharmaceutically acceptable excipients.

[0021] Furthermore, the coding gene of the polypeptide P15 is linked to the RHOT1 protein coding gene through a Flag tag, that is, the polypeptide P15 is linked to the RHOT1 protein through a Flag tag.

[0022] Furthermore, the coding gene of the polypeptide P15 is linked to the 3' end of the RHOT1 protein coding gene, that is, the polypeptide P15 is linked to the C-terminus of the RHOT1 protein. The present invention constructs pcDNA3.1-RHOT1-P15-C and pcDNA3.1-RHOT1-P15-N recombinant plasmids, and links the polypeptide P15 to the C-terminus or N-terminus of the RHOT1 protein through gene recombination technology to form a RHOT1-polypeptide fusion protein expression system. After plasmid transfection into cells (engineered gene cells), engineered exosomes rich in RHOT1 are successfully constructed. By analyzing the content of RHOT1 in the transfected cells (engineered gene cells), exosomes (engineered exosomes), and target cells (target cells) in groups N + and C + groups, more co-localization of RHOT1 with mitochondria is visible in the target cells in the C + group, indicating that linking the polypeptide P15 to the C-terminus can more effectively promote the transport of RHOT1 to mitochondria in target cells.

[0023] Furthermore, the amino acid sequence of the polypeptide P15 is shown in SEQ ID No.1: GCSMMKYCATCAGCM. Four polypeptide sequences capable of binding to the CD81 recombinant protein were screened from a 12-peptide phage peptide library in the present invention. After phage ELISA detection, the polypeptide with the sequence GCSMMKYCATCAGCM has a stronger binding force.

[0024] Furthermore, the template plasmid of the recombinant plasmid is pcDNA3.1, that is, pcDNA3.1-RHOT1-P15 and pcDNA3.1-SDC4 recombinant plasmids are constructed.

[0025] Furthermore, the cell is a hepatocyte.

[0026] Preferably, the hepatocyte is a human hepatocyte, and the human hepatocyte is HepG2 cell.

[0027] Furthermore, the extraction method of the exosome is the ultracentrifugation method.

[0028] Compared with the prior art, the present invention has the following beneficial effects:

[0029] The present invention provides the application of engineered exosomes rich in RHOT1 in the preparation of drugs for treating insulin resistance. In the present invention, a phage library is incubated with a CD81 recombinant protein to screen out the targeting polypeptide P15. The polypeptide P15 and the RHOT1 protein form a recombinant protein RHOT1-P15. Then, a recombinant plasmid expressing the recombinant protein RHOT1-P15 is constructed and transfected into cells for culture. The polypeptide P15 can link CD81 in RHOT1-targeted exosomes, promote the binding of RHOT1 and CD81, and help the RHOT1 protein achieve trans-organelle transport and enrichment from the inside of the cell to exosomes. Finally, exosomes are extracted to obtain engineered exosomes RHOT1-Exo rich in RHOT1. The research results of the present invention show that the engineered exosomes RHOT1-Exo can significantly promote mitochondrial oxidative phosphorylation, promote the expression of cellular antioxidant enzymes and improve the mitochondrial network structure, and have the effects of promoting mitochondrial function recovery, improving insulin resistance and treating insulin resistance. Therefore, the present invention provides the application of exosomes RHOT1-Exo rich in RHOT1 in the preparation of drugs for treating insulin resistance. The present invention successfully realizes the application of the RHOT1 protein in the form of exosomes for the treatment of insulin resistance, providing an important theoretical basis for the clinical application of drugs for treating insulin resistance. Brief Description of the Drawings

[0030] Figure 1For the screening of CD81 - affinity peptides using phage ELISA in Example 1. Among them, *: p < 0.05, **: p < 0.01, ***: p < 0.001.

[0031] Figure 2 Schematic diagrams of two modes of connection between P15 and the C - terminus of RHOT1 in Example 1.

[0032] Figure 3 For the detection of the protein - binding effect of N + and C + recombinant proteins with CD81 by Co - IP in Example 1.

[0033] Figure 4 For the detection of the contents of Flag and RHOT1 in cells and exosomes by ELISA in Example 1. Among them, Figure 4 A is the content of Flag in HepG2 - RHOT1 transfected cells; B is the content of Flag and RHOT1 in exosomes secreted by HepG2 - RHOT1 cells; C is the content of Flag in cells after co - culturing HepG2 with exosomes induced by high glucose for 3 days. Among them, *: p < 0.05, ns: p > 0.05, (n = 3).

[0034] Figure 5 For the detection of engineered exosomes in Example 1. Among them, Figure 5 A is the microscopic structure image of Exo and RHOT1 - Exo under transmission electron microscopy (scale bar = 100 nm); B is the detection of the secretion levels of Exo and RHOT1 - Exo by BCA method, ns: p > 0.05 (n = 3); C is the detection of the particle size distribution of Exo and RHOT1 - Exo by nanoparticle tracking; D - E are the detection of exosome markers and RHOT1 protein in Exo and RHOT1 - Exo by Western blot, and the quantitative analysis of RHOT1 expression level based on the band gray value. Among them, p # <0.05 vs HepG2, p***<0.001 vs Exo, (n = 3).

[0035] Figure 6 For the effect of different concentrations of glucose on the survival rate of HepG2 cells in Example 2, p*<0.05, p**<0.01 vs 0 mmol / L, (n = 3).

[0036] Figure 7 For the glucose uptake of HepG2 cells in Example 2. Among them, p ## <0.01 vs HepG2, p*<0.05 vs high - glucose - HepG2, (n = 3).

[0037] Figure 8 For the detection of antioxidant enzyme expression levels, ROS, and mtDNA content in Example 2. Among them, Figure 8 In, A is the activity diagram of SOD1, SOD2, and CAT in cells detecting normal HepG2 cells (Control group), insulin-resistant HepG2 cells (high glucose group), and insulin-resistant group with RHOT1-Exo added (high glucose - RHOT1-Exo group); B - C are used to determine cellular ROS by staining with CM-H2DCFDA probe and measured by immunofluorescence and FACS (scale bar = 50 μm); D is the diagram for detecting mtDNA content in IR cells after RHOT1-Exo treatment. Among them, P* < 0.05, P** < 0.01 (n = 3).

[0038] Figure 9 For the ATP level detection diagram in Example 2. Among them, P** < 0.01.

[0039] Figure 10 For the fluorescence detection diagram of mitochondrial network structure (Mito-Tracker Green fluorescence probe) in Example 2. Among them, Figure 10 In, A is the mitochondrial network structure of HepG2 cells induced by high glucose; Figure 10 In, B is the mitochondrial network structure diagram of IR cells after RHOT1-Exo treatment.

[0040] Figure 11 For the detection results of proteins related to insulin signaling pathway in Example 2. Among them, p # < 0.05 vs HepG2, p* < 0.05 vs high glucose - HepG2, (n = 3). Detailed implementation manners

[0041] The present invention will be further described below in conjunction with the accompanying drawings of the specification and specific embodiments, but the embodiments do not impose any form of limitation on the present invention. Unless otherwise specified, the reagents, methods, and equipment used in the present invention are conventional reagents, methods, and equipment in the technical field.

[0042] Unless otherwise specified, the reagents and materials used in the following examples are all commercially available.

[0043] 1. Experimental materials

[0044] Table 1 Cell sources

[0045] Cell Characteristic description Source HepG2 Human hepatoma cells Merck KGaA <![CDATA[HepG2-RHOT1 (N + )]]> Human hepatoma cells transfected with pcDNA3.1-RHOT1-P15-N plasmid Constructed in the present invention <![CDATA[HepG2-RHOT1 (C + )]]> Human hepatoma cells transfected with pcDNA3.1-RHOT1-P15-C plasmid Constructed in the present invention E.coli DH5α Host bacterium for plasmid construction Stored in the laboratory

[0046] Table 2 Plasmid sources

[0047] Plasmid Genetic marker and construction Source pcDNA3.1-RHOT1-P15-N plasmid KpnI and XbaI restriction enzyme sites were designed at both ends of the P15-Flag-RHOT1 sequence Wuhan Kingcare pcDNA3.1-RHOT1-P15-C plasmid pcDNA3.1-SDC4 plasmid KpnI and XbaI restriction enzyme sites were designed at both ends of the RHOT1-Flag-P15 sequence and KpnI and XbaI restriction enzyme sites were designed at both ends of the SDC4 sequence Wuhan Kingcare

[0048] DMEM powder, Gibco; Antioxidant Enzyme Activity Assay Kit, Dojindo Molecular Technology Inc; Fetal Bovine Serum (FBS), ThermoFisher; HepG2 cells were stored in the laboratory.

[0049] 2. Experimental methods

[0050] 2.1 Cell culture

[0051] (1) Preparation work in the cell room: If the ultraviolet lamp is disinfecting in the cell room, it should be turned off and the fluorescent lamp should be turned on for illumination. Turn on the 37°C water bath, and put the DMEM medium and the PBS dedicated for cell treatment taken out from the 4°C chromatography cabinet into the water bath to heat. Change into the white coat and slippers dedicated for the cell room, wear a mask and a hat, spray the sleeves of the white coat with 75% ethanol and disinfect the hands. Disinfect the microscope stage with an alcohol cotton ball. After ultraviolet irradiation, start ventilation and fluorescent lamp illumination, and pull the glass baffle of the workbench to the appropriate position. Take out the DMEM medium and PBS that have returned to room temperature, disinfect them, and place them in the ultra-clean workbench for standby; Take out the sterilized pipette tips needed from the 55°C oven, disinfect them with 75% ethanol, and place them on the left side of the ultra-clean workbench for standby. Turn on the centrifuge dedicated for the cell room. Carefully take out the cells to be disposed of, place them on the sterilized microscope stage, and observe the cell growth status, whether there is contamination, etc. After preparation, start to process the cells.

[0052] (2) Cell culture conditions: HepG2 cells are adherent cells and are cultured using DMEM medium. Among them, 50 mL of fetal bovine serum (FBS) that has been filtered through a filter and 5 mL of penicillin-streptomycin (double antibody) are added to every 445 mL of DMEM to prepare a complete medium. The cells are placed in a sterile cell incubator at a temperature of 37°C and containing 5% CO2 for culture. Regularly observe the cell growth status and decide whether to further process. After the cells grow to an appropriate density, they are passaged, plated, cryopreserved, etc. after being digested with sterile trypsin for subsequent experimental needs.

[0053] (3) Cell resuscitation: Take a 15 mL centrifuge tube and add 3 mL of complete medium for standby. Take out the cryopreserved cells from liquid nitrogen, heat them in a 37°C water bath. After thawing, disinfect the surface of the cryopreservation tube, and quickly transfer the thawed cell suspension to the prepared complete medium in the ultra-clean workbench; Centrifuge at 800 rpm for five minutes. After centrifugation, discard the supernatant in the ultra-clean workbench, resuspend the cells with complete medium, transfer them to a T25 cell culture flask at a ratio of 1:1, shake gently, and then culture in the incubator.

[0054] (4)Cell passage: Take out the cell culture flask, discard the old culture medium, and wash it once with PBS; add an appropriate amount of trypsin. After an appropriate time, observe under the microscope. If the cells gradually become independent spherical shapes at this time, immediately add a complete culture medium with a volume 4 times that of the trypsin to terminate digestion; gently pipette the digested cells down, transfer them to a 15 mL centrifuge tube, and centrifuge at 800 rpm for 5 min; take back the centrifuged cells, discard the supernatant in the centrifuge tube in the laminar flow hood, add an appropriate amount of complete culture medium to resuspend, and gently pipette evenly. Then transfer them to a T25 cell culture flask according to a 1:3 ratio and continue culturing.

[0055] (5)Cell cryopreservation: Take out the cell culture flask, discard the old culture medium, and wash it once with PBS; add an appropriate amount of trypsin for digestion. After terminating digestion, gently pipette the cells and transfer them to a 15 mL centrifuge tube, and centrifuge at 800 rpm for 5 min; take back the centrifuged cells, discard the supernatant in the centrifuge tube in the laminar flow hood, add 1 mL of cell cryopreservation solution (prepared by mixing FBS: DMSO = 9:1) to resuspend, and gently pipette evenly. Then transfer them to a pre-prepared cryotube; finally, perform gradient cooling on the cells (4°C, 30 min; -20°C, 1.5 h; -80°C, 12 h), and then transfer them to liquid nitrogen for storage for future use.

[0056] Example 1 Preparation of Engineered Exosomes Rich in RHOT1

[0057] I. Experimental Methods

[0058] 1. Targeting peptide screening

[0059] Targeted peptide screening was performed using a 15-mer phage display peptide library. The library contains billions of phage clones, and each clone displays a random sequence of exogenous peptides at the N-terminus of the phage coat protein. First, the phage library was incubated in a culture flask at 37 °C for 1 hour to remove phages that specifically bind to the flask. Then, after pretreatment to remove non-specifically bound phages, the remaining phage library was incubated with recombinant CD81 protein at room temperature for 1 hour. The CD81 protein was washed 10 times with bovine serum albumin (BSA) / Tween wash buffer to remove unbound phages. Phages bound to the CD81 protein were eluted with a low pH elution buffer (0.1 N HCl, 1 mg / mL BSA, adjusted to pH 2.2 with glycine) for 10 minutes. The elution buffer was immediately neutralized with 1 M Tris-HCl (pH 8.8). The eluate from the first round of elution was concentrated using a Centricon 100 kDa ultrafiltration device (Merck millipore, Germany). Then, the concentrated eluate was transferred into Escherichia coli medium and incubated with continuous shaking at 37 °C for 24 hours. Phage clones that internalized the CD81 protein were recovered using cell lysis buffer (2% sodium dodecyl sulfate, 10 mM Tris-HCl, 2 mM EDTA, pH 8.0). The cells were centrifuged at 130 g for 10 minutes to remove the supernatant, and cell lysis buffer was added. Then the phages were amplified and further screened, similar to the first round process described above. After the third round of screening, the eluted phages were titrated, and 40 clones were randomly selected for sequencing to determine the sequences of the CD81-binding peptides.

[0060] 2. Affinity verification

[0061] The binding ability and specificity of the selected phages to CD81 were determined by enzyme-linked immunosorbent assay (ELISA). Prepare 150 μL of CD81 at a concentration of 100 μg / mL (dissolved in 0.1 M NaHCO3, pH 8.6) and coat it on a 96-well plate, then incubate it with gentle shaking at 4 °C for 30 minutes, and then incubate overnight at 4 °C. Subsequently, add 2×10 9 cfu of purified phages in blocking buffer and incubate at room temperature for 1 hour. Then, wash the plate three times with PBS containing 0.5% Tween 20, and then wash three more times with PBS. Thereafter, incubate the plate with alkaline phosphatase-conjugated anti-fd phage IgG (Abcam, MA, USA) at room temperature for 1 hour. After washing, add the substrate p-nitrophenyl phosphate to the wells and measure the absorbance at 405 nm using a plate reader.

[0062] 3. Plasmid synthesis and transfection

[0063] The present invention uses the pcDNA3.1 plasmid as a template, designs KpnI and XbaI restriction endonuclease sites at both ends of the P15-Flag-RHOT1 and RHOT1-Flag-P15 sequences, and constructs and names recombinant plasmids pcDNA3.1-RHOT1-P15-C (i.e., pcDNA3.1-RHOT1-Flag-P15) and pcDNA3.1-RHOT1-P15-N (i.e., pcDNA3.1-P15-Flag-RHOT1). HepG2 cells are evenly inoculated into a 6-well plate and cultured until the cell density reaches 30% - 50%. Take a 1.5 mL centrifuge tube, add 200 μL of serum-free medium and mix it with 3 μg of plasmid; take another centrifuge tube and mix 200 μL of serum-free medium with 6 μL of transfect-mate. Using the transfection method mediated by Lipofectamine 2000, react at room temperature for 5 minutes, then combine the contents of the two tubes and continue to react for 20 minutes. Add the transfection complex to the pre-laid 6-well plate containing 2 mL of serum-free medium, and shake well. Incubate in a cell culture incubator for 5 hours, replace it with complete medium, and continue to culture for 48 hours, then collect the cells for subsequent experiments. The cells transfected with pcDNA3.1-RHOT1-P15-N are named N + The cells transfected with pcDNA3.1-RHOT1-P15-C are named C + (the same as subsequent HepG2-RHOT1).

[0064] 4. Co-Immunoprecipitation (Co-IP)

[0065] Lyse the transfected cells, extract the proteins, and incubate them overnight with the primary antibody (anti-Flag) at 4°C. Incubate for 4 hours at 4°C according to the guidelines provided by the manufacturer (Invitrogen, Carlsbad, CA, USA). After completing the immunoprecipitation step, wash the magnetic beads three times with 1× phosphate buffer solution (PBS). Subsequently, elute the proteins from the magnetic beads using 40 μL of elution buffer and apply them to immunoblot analysis. Add sample buffer containing 5% β-mercaptoethanol to the samples and heat them at 55°C for 15 minutes, and then detect their binding to the target proteins by Western blotting. The target proteins to be detected are RHOT1 (dilution ratio 1:1000, dissolved in TBST buffer), CD81 (dilution ratio 1:1000, dissolved in TBST buffer), and Flag (dilution ratio 1:1000, dissolved in TBST buffer).

[0066] 5. Exosome Extraction

[0067] After incubating HepG2-RHOT1 and HepG2 cells in exosome-free medium for 48 hours, the culture supernatants were collected. First, the samples were centrifuged at 300 g for 10 minutes, and then ultracentrifuged at 2000 g for 10 minutes. Subsequently, ultracentrifugation was performed at 10000 g for 30 minutes. The resulting cell pellets, membranes, and debris were discarded, and the supernatants were filtered through a 0.22 μm filter membrane from MerckMillipore. Finally, ultracentrifugation was carried out at 120000 g for 90 minutes to isolate exosomes, and these exosomes were resuspended in PBS and washed at 120000 g for 90 minutes. The exosomes extracted from normal HepG2 were named Exo, and the exosomes extracted from HepG2-RHOT1 after transfection with the plasmid were named RHOT1-Exo.

[0068] 6. ELISA assay for mitochondrial internalization

[0069] High-glucose-induced HepG2 cells (as target cells) were seeded in culture dishes and cultured to an appropriate confluence (70%-90%) to ensure good growth status and the ability to receive exosomes during co-culture. Exosomes extracted from engineered gene cells in the N+ and C+ groups were separately added to the culture systems of high-glucose-induced HepG2 cells, and co-culture was carried out in a cell culture incubator. After co-culture, transfected cells (engineered gene cells in the N+ and C+ groups) and target cells (high-glucose-HepG2 cells) were collected separately. Mitochondrial proteins were extracted from transfected cells and target cells using a mitochondrial extraction kit. Proteins were then extracted from transfected cells, exosomes, and target cells respectively.

[0070] The ELISA kits for Flag and RHOT1 were used according to the instructions, and the contents of Flag and RHOT1 proteins in each group of samples were measured respectively. The absorbance values of the ELISA plates were read using a microplate reader, and the concentrations of Flag and RHOT1 in each group of samples were calculated based on the standard curves.

[0071] 7. Western Blot

[0072] After one cell passage, Western Blot detection was performed. Part of the protein lysate was extracted from the cells for Western Blot detection. First, the cells were washed with pre-cooled PBS at 4°C for 1 minute each time, for a total of 3 times, to ensure complete removal of residual liquid. Then, a lysis buffer was prepared by mixing 1 mL of RIPA with 10 μL of PMSF (100 mM), shaken well, and placed on ice. Subsequently, 400 μL of the lysis buffer was added to each flask of cells, and the cells were lysed on ice for 30 minutes, with intermittent shaking of the culture flask during this period to promote full reaction of the cells. After lysis, the cells were quickly scraped to one side of the culture flask using a cell scraper on ice, and the cell debris and lysis buffer were transferred to a 1.5 mL EP tube using a pipette. Then, these EP tubes were centrifuged at 8000 g at 4°C for 10 minutes. After centrifugation, the supernatant was taken and stored at -20°C for subsequent detection.

[0073] Subsequently, the BCA protein concentration was determined. First, BSA was dissolved in PBS to prepare a series of standard products with concentrations of 5, 2.5, 1, 0.5, 0.25, 0.125, 0.05, and 0.025 mg / mL. Then, 20 μL of each concentration of the standard product and the total protein sample were taken and added to a 96-well plate, and two replicates were set for each standard product and sample. Next, the A and B solutions of the BCA kit were mixed at a volume ratio of 50:1 to form a working solution. After adding 200 μL of the working solution to each well, the 96-well plate was placed in an incubator at 37°C for 30 minutes. Finally, the OD value at a wavelength of 562 nm was read using an enzyme-linked immunosorbent assay (ELISA) reader, and a standard curve was plotted based on the OD values and concentrations of the standard products to obtain the protein concentration of the total protein sample.

[0074] Next, an SDS-PAGE gel was prepared, including a 15% separating gel and a 5% stacking gel. First, the separating gel was injected into the gap between the glass plates to a position 1.5 cm from the upper edge, and an appropriate amount of 75% ethanol was added on the upper layer. After the separating gel solidified, the upper-layer ethanol was poured out, and the stacking gel was injected. Subsequently, a comb was inserted and allowed to air dry naturally.

[0075] Before electrophoresis, the total protein sample was heated in a 95°C water bath for 5 minutes and mixed with a protein loading buffer. Then, electrophoresis buffer was poured into the electrophoresis tank, 10 μL of protein Maker was added to the two side lanes, and 15 μL of the sample was added to each lane. During electrophoresis, first, a voltage of 90V was used for 30 minutes in the stacking gel stage, and then a voltage of 160V was used for electrophoresis in the separating gel stage until the bromophenol blue ran to the bottom of the gel.

[0076] (5) After the electrophoresis, transfer the membrane. First, cut filter paper and a 0.22 μm PVDF membrane of appropriate size, and activate the PVDF membrane with methanol for 1 minute. Then, assemble the transfer cassette in the order of "sponge - filter paper - gel - PVDF membrane - filter paper - sponge", and ensure there are no air bubbles in it. After assembly, insert the transfer cassette into the transfer tank and pour in the transfer buffer. Under ice bath conditions, perform the membrane transfer operation at a constant current of 200 mA for 60 minutes.

[0077] (6) After the membrane transfer, incubate with antibodies. First, wash the membrane with TBST solution for 5 minutes, and block it with 5% skim milk powder (prepared with PBS solution) at room temperature for 1 hour. Subsequently, wash the membrane with TBST solution 3 times, 5 minutes each time. Then, add the primary antibody diluted with the primary antibody dilution solution and incubate overnight at 4°C. The next day, wash the membrane with TBST solution 3 times, 5 minutes each time, then add the secondary antibody diluted with the secondary antibody dilution solution and incubate on a shaker at room temperature for 1 hour. Finally, wash the membrane with TBST solution 3 times again, 5 minutes each time.

[0078] (7) Finally, perform luminescence detection. After adding the ECL luminescence solution and incubating for 3 minutes, perform exposure imaging. Finally, use ImageJ software to measure the gray values of the internal reference gene and the target gene, thus completing the entire Western Blot detection process.

[0079] According to the recommendations of the "Minimum Information for Studies of Extracellular Vesicles (MISEV2018)", this invention uses Western Blot to detect the exosome positive markers RHOT1, CD9, and ALIX, and the corresponding antibodies used are diluted at ratios of 1:1000, 1:500, and 1:1000 respectively.

[0080] 8. Nanoparticle Tracking Analysis

[0081] Perform nanoparticle tracking analysis (NTA) using ZetaView PMX 110 (Particle Metrix) and its software (ZetaView 8.02.28). Dilute the exosomes in particle - free PBS and place them in the sample chamber. Subsequently, measure their size and concentration at a wavelength of 405 nm, and finally perform quantitative analysis and record the particle size of the exosomes.

[0082] 9. Transmission Electron Microscopy

[0083] 10 μL of the exosome sample was dropped onto a copper grid and incubated at room temperature for 10 minutes. Then, negative staining was performed with 2% uranyl acetate and air-dried at the edge of the filter paper. The prepared sample was imaged using an H-7650 transmission electron microscope (Hitachi) at 80 kV. The detection method for mitochondria was the same as described above.

[0084] 10. Statistical analysis

[0085] Continuous variables in statistical analysis were expressed as "mean ± standard deviation". Statistical analysis was performed using GraphPad Prism 10.0. Independent sample t-tests or one-way ANOVA were used to analyze the statistics between groups. A statistically significant difference was considered when p < 0.05.

[0086] II. Experimental results

[0087] 1. Four polypeptide sequences that could interact with the CD81 recombinant protein were screened out from a 15-mer phage peptide library. These polypeptide sequences and their binding frequencies are shown in Table 3. After phage ELISA detection, the polypeptide with the sequence GCSMMKYCATCAGCM had a stronger binding ability, and the results are as Figure 1 shown. This polypeptide sequence was named P15.

[0088] Table 3 Polypeptide sequences screened by phage and the binding frequencies of polypeptides to CD81

[0089] Polypeptide sequence Polypeptide binding frequency GCSMMKYCATCAGCM (SEQ ID No.1) 29 GCMMTKYASCLCMPA (SEQ ID No.2) 20 AGTCYASMCMKCMGA (SEQ ID No.3) 15 GCMSCASMTCMKYPG (SEQ ID No.4) 6

[0090] 2. After it was confirmed that P15 could bind to CD81, the coding sequences of the P15 sequence, Flag tag, and RHOT1 protein were ligated to a recombinant plasmid to express the RHOT1-P15 recombinant protein in cells, enabling this protein to have a targeted binding effect with CD81. Given that previous studies have not reported whether the ligation of polypeptides to RHOT1 affects its protein structure, it was planned to ligate Flag and P15 from the end of the protein sequence, but it was uncertain whether to ligate them to the N-terminus or C-terminus of RHOT1. Therefore, these two ligation methods were studied. When P15 was ligated to the N-terminus of RHOT1, it was named the N + group, and when ligated to the C-terminus, it was named the C + group, as Figure 2 shown.

[0091] 3. After constructing the above recombinant plasmid and transfecting HepG2 cells, the protein-protein interactions in the cells were detected by Co-IP. The results are as Figure 3 shown. It can be seen that there was no Flag band in the untransfected cells (HepG2 group), and the content of RHOT1 was significantly less than that in the N + and C +Group, because after plasmid transfection, RHOT1-P15 with Flag was overexpressed. After separation with Flag magnetic beads, it was found that the 104 kDa RHOT1-CD81 complex appeared in both the N + and C + groups, indicating that P15 can bind to CD81 regardless of which end of RHOT1 it is connected to, which clarifies the polypeptide function of P15.

[0092] 4. To clarify the content of RHOT1 in the N + and C + groups in transfected cells (engineered gene cells), exosomes (engineered exosomes), and target cells (target cells), exosomes were extracted from the N + and C + groups of cells respectively. The exosomes were co-cultured with HepG2 cells treated with high glucose induction, and the mitochondria of transfected cells and target cells were extracted. The ELISA results of Flag and RHOT1 are as Figure 4 shown: In transfected cells, there was no significant difference in the total content of Flag between the two groups. The Flag in the mitochondria of the C + group was slightly higher than that in the N + group, but there was no significant statistical difference (A in Figure 4 ). In exosomes, there was also no statistical difference in the content of Flag and RHOT1 (B in Figure 4 ). However, in target cells, the Flag in the mitochondria of the C + group was significantly more than that in the N + group, indicating that a large amount of the RHOT1-P15 molecule in exosomes entered the mitochondria (C in Figure 4 ). The above results suggest that connecting the P15 polypeptide at the C-terminus may promote the transport of RHOT1 to mitochondria in target cells. Therefore, theoretically, the C + group is more conducive to mitochondrial targeted therapy.

[0093] 5. In subsequent experiments, the recombinant plasmid pcDNA3.1-RHOT1-P15-C with the P15 connected at the C-terminus will be used. Under the transmission electron microscope, exosomes showed a vesicular structure, and a double-membrane structure was visible in some fields of view, as shown in Figure 5 A. The level of exosomes secreted by cells was detected by the BCA method. The results are as shown in Figure 5 B. In a T25 culture flask with a cell density of 80%, 38.46 ± 4.13 μg of Exo could be isolated from every 1 mL of culture medium, and the yield of RHOT1-Exo was 36.35 ± 6.89 μg / mL. There was no significant statistical difference between the two. The results of nanoparticle size tracking detection are as Figure 5As shown in C, the particle sizes of both Exo and RHOT1-Exo are in the range of 60 - 200 nm, and there is no significant difference in their particle size concentrations. The markers contained in exosomes were detected by Western blot, and the results are as shown in Figure 5 D. In HepG2 and HepG2-RHOT1 cells, compared with Exo and RHOT1-Exo, the expression levels of the related markers CD9 and ALIX in cells are lower, while the expression level of the housekeeping protein (GAPDH) is higher. This is because at the same unit concentration, exosomes contain more related markers (CD9 and ALIX), while exosomes basically do not contain the housekeeping protein (GAPDH). The RHOT1 protein is overexpressed by the plasmid in HepG2-RHOT1 cells and is 39.25% higher than that in HepG2 cells. In exosomes, the content of RHOT1 in RHOT1-Exo exosomes is 12.5 times that of Exo ( Figure 5 as shown in E). This result indicates that the engineered exosomes enriched with RHOT1 were successfully constructed based on the polypeptide P15 strategy.

[0094] Example 2 In vitro study on the improvement of high-glucose-induced HepG2 insulin resistance model by RHOT1-Exo

[0095] I. Experimental methods

[0096] 1. Establishment of cell model

[0097] HepG2 cells were seeded in a 96-well culture plate at a density of 5×10³ cells / mL. After adding DMEM complete medium supplemented with 10% fetal bovine serum, they were transferred to a constant temperature incubator containing 5% CO2 for routine culture. After the cells were fully adherent, they were gently rinsed three times with pre-cooled PBS buffer to remove the residual culture medium. Subsequently, DMEM basal medium without serum and antibiotics was used to prepare hypertonic glucose treatment solutions with concentrations of 0, 5, 20, 35, and 50 mmol / L (the specific concentrations were adjusted according to the experimental design). The treatment solutions of each concentration were respectively pipetted into the corresponding wells. After continuous incubation for 24 hours, the CCK-8 kit was used to measure the relative cell viability, and the optimal treatment concentration induced by high glucose was screened accordingly. Finally, the model was verified by quantitatively analyzing the cell glucose uptake. When the uptake rate of the experimental group was significantly higher than that of the blank control group (p<0.05), it was determined that the insulin resistance cell model was successfully constructed. The successfully constructed cells were seeded in a culture dish at a density of 2.0×10 6 cells / 100 mm 2 and cultured with RHOT1-Exo.

[0098] The cell experiments were divided into 3 groups, namely: HepG2 group (Control), high glucose-induced HepG2 group (high glucose-HepG2), and high glucose-induced HepG2 group with RHOT1-Exo added (high glucose-RHOT1-Exo).

[0099] 2. Determination of cell viability

[0100] First, aspirate the high glucose solution that induced HepG2 cells, wash thoroughly with PBS, then add 10 μL of CCK-8 solution to each well and incubate for 2 hours. Aspirate the CCK-8 solution with a pipette. Measure the absorbance at 490 nm using a microplate reader.

[0101] 3. Verification of successful construction of the model by measuring glucose uptake with 2-NBDG

[0102] Centrifuge to collect the cells of each group, culture them in sugar-free DMEM medium for 5 h, then add 100 nM insulin and culture for 20 min. Finally, add 50 nM 2-NBDG and co-incubate for 30 min. Wash the cells with PBS to terminate the reaction, and measure the fluorescence values at 475 and 550 nm using a fluorescence microplate reader.

[0103] 4. Detection of antioxidant enzymes, ROS, and mtDNA

[0104] Add RHOT1-Exo exosomes with a final concentration of 1 mg / mL to high glucose-induced HepG2 cells for culture. The activities of SOD1, SOD2, and CAT in each group of cells were measured according to the kit instructions (Dojindo Molecular Technology Inc.); the intracellular production of ROS was quantified using the cell-permeable oxidation-sensitive fluorescent probe CM-H2DCFDA (Molecular Probes). Seed the cells of each group into a six-well plate in complete medium at a density of 2.5×10 5 cells per well and pretreat them with DMEM containing 1 μM CM-H2DCFDA at 37°C for 30 minutes. Harvest the cells, wash them twice with DMEM, resuspend them in DMEM, and analyze them on a FACSCalibur flow cytometer (BD Biosciences). Culture the cells in a normal medium in an 11 cm 2 culture dish (BD Biosciences) and treat them with 1 μM CM-H2DCFDA for 30 minutes. Wash the cells 3 times in normal medium, and then analyze them at 37°C using a Leica laser scanning confocal microscope with an excitation wavelength of 488 nm and an emission wavelength of 500–540 nm.

[0105] Extract the total cellular DNA according to the kit instructions. Amplify mtDNA based on the ND1 gene encoding the ND1 subunit of NADH dehydrogenase, and amplify nDNA with β-actin. Perform qPCR using the LightCycler 480 II real-time PCR system. The primers used are shown in Table 4, the reaction system is shown in Table 5, and the reaction conditions are shown in Table 6. According to 2 -△△CT Calculate the relative content of the gene. Set 3 replicates for each group and calculate the average value.

[0106] Table 4 qPCR primers for ND1 gene

[0107] Target Forward primer (5'-3') Reverse primer (5'-3') ND1 TCAGGGGAGAGTGCGTCATA CCCTAAAACCGCCACATCT β-actin TCGGGAGCGTTTAGCCTTAC ATGTCTGCCAACTTCCTGGG

[0108] Table 5 PCR reaction system

[0109] Component Volume / μL SYBR® Premix Ex Taq™ II 10 μM Forward primer 100.8 10 μM Reverse primer 0.8 Template DNA 1.0 ddH2O Up to 20

[0110] Table 6 PCR reaction conditions

[0111] Pre-denaturation Denaturation Annealing / extension Number of cycles ND1 95 ℃, 1 min 95 ℃,5 s 60 ℃,25 s 40 β-actin 95 ℃, 1 min 95 ℃,5 s 60 ℃,25 s 40

[0112] 5. ATP level detection

[0113] Operate according to the instructions of the ATP kit. First, aspirate the culture medium, add 200 μL of lysis solution to each well of the 6-well plate, repeatedly pipette and lyse, then centrifuge at 12000 g for 5 minutes at 4 °C, and take the supernatant for subsequent determination. Then thaw the reagent on ice bath, and dilute the ATP standard solution with ATP detection lysis solution to 0.01, 0.03, 0.1, 0.3, 1, 3, and 10 μM. Add 100 μL of ATP detection working solution to the light-shielded 96-well plate, and let it stand at room temperature for 3 - 5 min to consume all the background ATP, thus reducing the background. Add 20 μL of the test solution or standard solution to the well, quickly mix, select the luminometer function of the full-wavelength multifunctional microplate reader to detect the chemiluminescence value, draw the standard curve, and calculate the ATP content of each group of cells according to the luminescence value.

[0114] 6. Fluorescence detection of mitochondrial network structure (Mito-Tracker Green fluorescent probe)

[0115] Prepare a 1 mM stock working solution of Mito-Tracker Green solution using anhydrous DMSO and store it in the dark at -20 °C for later use; Seed cells in good growth state at a density of 1×10 5Transfer the density to the culture dish, and culture the cells in each group routinely. After 24 h of culture, remove the culture medium, add the Mito-Tracker Green staining working solution preheated to 37 °C, and incubate for 2 h. After the incubation, replace the staining solution with fresh culture medium and observe the mitochondrial network structure under a laser confocal microscope.

[0116] 7. Detection of the expression of proteins related to the insulin signaling pathway

[0117] Detect the expression levels of PI3K and GLUT4 proteins in the cells of each group according to the ELISA kit instructions.

[0118] 8. Statistical analysis

[0119] Continuous variables in statistical analysis are expressed as "mean ± standard deviation". Statistical analysis was performed using GraphPad Prism 10.0. Independent sample t-tests or one-way ANOVA were used to analyze the statistics between groups. A p value less than 0.05 was considered statistically significant.

[0120] II. Experimental results

[0121] 1. Selection of glucose concentration

[0122] To determine the optimal concentration of glucose solution to induce IR in HepG2 cells, glucose solutions of 0, 5, 10, 20, 35, and 50 mmol / L were selected in this experiment to co-incubate with HepG2 cells for 24 h, and the cell viability was measured ( Figure 6 ). In the range of 0 - 50 mmol / L, as the glucose concentration increased continuously, the viability of HepG2 cells decreased continuously. When the glucose concentration was higher than 35 mmol / L, the cell viability was significantly reduced. Therefore, a glucose solution of 35 mmol / L was selected to treat the cells for 24 h as the construction plan for the insulin resistance model.

[0123] 2. Glucose uptake by model cells

[0124] Cells with insulin resistance will directly show abnormal glucose uptake. Therefore, we used the 2-NBDG method to detect the glucose uptake of HepG2 cells. Compared with the normal HepG2 cell group, the glucose uptake of HepG2 cells induced by high glucose was significantly reduced ( Figure 7 ), indicating that the insulin resistance model of HepG2 cells was successfully established. After transferring RHOT1-Exo, this change was reversed, and the glucose absorption of cells in the high glucose - RHOT1-Exo group increased significantly. This shows that the RHOT1 protein in RHOT1-Exo exosomes can improve the insulin sensitivity of insulin-resistant cells.

[0125] 3. RHOT1-Exo activates antioxidant enzymes, reduces ROS levels and increases mtDNA content

[0126] To investigate the effect of RHOT1-Exo on the mitochondrial antioxidant activity in mammalian cells, HepG2 cells were first treated with high glucose to establish an insulin-resistant cell model, and then RHOT1-Exo was added to the cultured model cells. The results were as Figure 8 shown. It was found that after RHOT1-Exo treatment, the activities of antioxidant enzymes SOD1, SOD2 and CAT in the high glucose-RHOT1-Exo group were significantly increased compared with those in the high glucose-HepG2 group ( Figure 8 A in); Staining with CM-H2DCFDA probe to detect cellular ROS, and the quantitative analysis graphs all showed that the ROS in the high glucose-RHOT1-Exo group was significantly reduced ( Figure 8 B-C in). Therefore, our data indicate that RHOT1-Exo can clear ROS in insulin-resistant cells by upregulating the expression of antioxidant enzymes.

[0127] Intracellular mtDNA is also vulnerable to ROS attack and damage. Therefore, we detected the mtDNA content in cells of each group by qPCR. Compared with the insulin-resistant model cells, after treatment with DRP1-Exo, the mtDNA content increased significantly ( Figure 8 D in). It shows that exosomes rich in RHOT1 can increase the mtDNA content in insulin-resistant model cells, which helps to restore mitochondrial dysfunction.

[0128] 4. RHOT1-Exo promotes oxidative phosphorylation and increases ATP content

[0129] Due to the impairment of the oxidative phosphorylation pathway in mitochondrial dysfunction cells and the enhancement of the cell glycolysis pathway, the ATP content decreases accordingly. Therefore, we investigated whether RHOT1-Exo increases oxidative phosphorylation to increase ATP content. For this purpose, RHOT1-Exo was transfected into insulin-resistant cells. An ATP assay kit was used to measure the ATP level in cells. The results were as Figure 9 shown. After co-culture with RHOT1-Exo, the ATP level in insulin-resistant cells increased significantly, indicating that RHOT1-Exo enhances cellular oxidative phosphorylation, increases the ATP content in insulin-resistant cells, and helps to improve insulin resistance.

[0130] 5. RHOT1-Exo improves the mitochondrial network structure

[0131] Mitochondrial dysfunction can lead to the disruption of the mitochondrial network structure, and the mitochondrial morphology usually changes from slender tubular structures to fragmented spherical structures. After Mito-Tracker Green fluorescence staining of cells in each group, as shown in Figure 10 A of, the mitochondria of HepG2 cells induced by high glucose were fragmented and had an incomplete structure; while when RHOT1-Exo was transfected into high glucose-HepG2 cells, it was found that the mitochondria were interconnected and presented a network shape, as shown in Figure 10 B of, indicating that RHOT1-Exo can significantly improve the mitochondrial network of insulin-resistant cells and restore mitochondrial dysfunction. The present invention has successfully achieved the use of RHOT1 protein in the form of exosomes to improve the mitochondrial network structure of insulin-resistant cells.

[0132] 6. Expression of proteins related to the insulin signaling pathway

[0133] Damage to the insulin signaling pathway can trigger IR, which can be manifested as a decrease in the expression of proteins related to insulin signal transduction. To further explore whether exosomes rich in RHOT1 protein can improve the IR state of HepG2 cells, we detected the expression of proteins related to insulin signal transduction in HepG2 cells in each group. The results showed that compared with HepG2 insulin-resistant cells in a high glucose environment, after treatment with RHOT1-Exo, the protein level of PI3K and the content of GLUT4 protein on the plasma membrane both increased significantly ( Figure 11 ). It can be seen that in insulin-resistant cells, the expression of related proteins that were originally decreased due to impaired insulin signal transduction increased with the help of exosomes rich in RHOT1 protein. This fully indicates that exosomes containing abundant RHOT1 protein have the effect of enhancing the activity of proteins related to the insulin signaling pathway, can improve the sensitivity of IR model cells to insulin, and have application value in drugs for treating insulin resistance.

Claims

1. Use of engineered exosomes rich in RHOT1 in the preparation of a drug for improving insulin resistance, characterized in that: The method for preparing the engineered exosomes rich in RHOT1 is as follows: the coding gene of the polypeptide P15 whose amino acid sequence is shown in any one of SEQ ID No. 1 to 4 is connected to the 3' end or 5' end of the RHOT1 protein coding gene to obtain a chimeric gene, and then a recombinant plasmid expressing the chimeric gene is constructed, and then the recombinant plasmid is transfected into cells for expression, and exosomes are extracted to obtain the exosomes.

2. Use of engineered exosomes rich in RHOT1 in the preparation of a drug for treating insulin resistance, characterized in that: The method for preparing the engineered exosomes rich in RHOT1 is as follows: the coding gene of the polypeptide P15 whose amino acid sequence is shown in any one of SEQ ID No. 1 to 4 is connected to the 3' end or 5' end of the RHOT1 protein coding gene to obtain a chimeric gene, and then a recombinant plasmid expressing the chimeric gene is constructed, and then transfected into cells for expression, and exosomes are extracted to obtain the obtained exosomes.

3. The use according to claim 1 or 2, characterized in that: The coding gene of the polypeptide P15 is connected to the 3' end of the coding gene of the RHOT1 protein.

4. The use according to claim 1 or 2, characterized in that: The coding gene of the polypeptide P15 is connected to the coding gene of the RHOT1 protein via a Flag tag.

5. The use according to claim 1 or 2, characterized in that: The amino acid sequence of the polypeptide P15 is shown in SEQ ID No.

1.

6. The use according to claim 1 or 2, characterized in that: The template plasmid used in the recombinant plasmid is pcDNA3.

1.

7. The use according to claim 1 or 2, characterized in that: The drug promotes mitochondrial oxidative phosphorylation in the subject's cells, regulates the activity of mitochondrial antioxidant enzymes, and removes ROS, thereby increasing ATP and mtDNA content, enhancing mitochondrial network generation and restoring mitochondrial function, increasing the expression of proteins related to the insulin signaling pathway, and improving insulin resistance, thereby achieving application in drugs for treating insulin resistance.

Citation Information

Patent Citations

  • Construction of engineered fat exosome for targeted central delivery of siRNA to improve insulin resistance of diabetes

    CN113082042A

  • Engineered exosome for pancreatic cancer immunotherapy and preparation method thereof

    CN116370647A

  • Low-immunogenicity targeted vesicle delivery system as well as preparation method and application thereof

    CN117919197A

  • Exosome, method of forming same, and composition containing same

    US20250057776A1

Cited By

  • IMMT-binding PMTS peptide engineered targeting of mitochondrial vesicles and their use in the treatment of colon cancer

    CN122521781A