Chemically modified adenosine triphosphate as well as preparation method and application thereof

By chemically synthesizing adenine triphosphate and replacing or tailings to modify mRNA, the problems of poor stability and high immunogenicity of natural mRNA are solved, and the higher translation efficiency and stability of mRNA are achieved.

CN120157727APending Publication Date: 2025-06-17SHENZHEN INST OF ADVANCED TECH CHINESE ACAD OF SCI
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202311722227.2
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2023-12-14
Publication Date
2025-06-17

AI Technical Summary

Technical Problem

In the existing mRNA technology, natural mRNAs have poor stability and are prone to immunogenicity, which limits their application potential. Naturally occurring modified nucleoside species are rare and cannot meet the needs of improving mRNA properties.

Method used

The natural adenine is chemically modified by chemical synthesis to prepare chemically modified adenine triphosphate, and the mRNA that modifies adenine globally replaces natural adenine by in vitro transcription, or polyadenylation of mRNA using tailing enzymes.

Benefits of technology

These modified mRNAs exhibit enhanced translation efficiency and higher stability in vitro and intracellularly, reducing immunogenicity.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120157727A_ABST
    Figure CN120157727A_ABST
Patent Text Reader

Abstract

The invention provides chemically-modified adenosine triphosphate and a preparation method and application thereof.The chemically-modified adenosine and the chemically-modified adenosine triphosphate are synthesized by means of chemical synthesis, natural adenosine in mRNA is globally replaced with the chemically-modified adenosine, and the chemically-modified adenosine triphosphate is obtained. Or the mRNA is subjected to polyadenylation tailing modification, so that the translation efficiency and the stability of the target mRNA are enhanced, the immunogenicity is reduced, and a supplement and a new choice are provided for an mRNA modification technology.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the technical field of nucleic acid modification, and particularly relates to a chemically modified adenosine triphosphate, a preparation method thereof, and an application thereof. Background Art

[0002] mRNA, also known as messenger RNA, is transcribed from DNA as a template and is responsible for guiding the synthesis of intracellular proteins. mRNA technology utilizes this rule to introduce in vitro synthesized mRNA into specific cells, enabling the cells to become small factories for protein drug production, and the proteins produced by these cells exert therapeutic effects. mRNA technology has great application potential in the prevention and control of infectious diseases, tumor vaccines, tumor immunotherapy, protein replacement therapy, etc. However, natural mRNA has poor stability and is prone to inducing immunogenicity, which severely hinders the application of mRNA. In the mainstream mRNA technology, natural modified nucleosides are used to replace natural nucleosides. For example, pseudouridine and methylpseudouridine are used to replace uridine to solve the problems of stability and immunogenicity of mRNA drugs. However, the types of naturally occurring modified nucleosides are scarce, unable to meet the requirements for improving the properties of mRNA, and not conducive to establishing structure-activity relationships to reveal its mechanism of action at the molecular level. Therefore, preparing more chemically modified nucleosides by organic synthesis methods to improve the drug-likeness of mRNA from different aspects has great research and application significance.

[0003] Research has found that modifying different regions of the eukaryotic mRNA structure has very different effects on the translation activity / immunogenicity, etc. of mRNA. Therefore, in addition to the overall mRNA modification strategy, it is very necessary to study the chemical modification of specific regions of mRNA. For example, modifying the 3'-tail structure can achieve single modification of mRNA without affecting other regions of mRNA. Currently, the research on mRNA tailing mainly focuses on regulating the length of the poly A tail of mRNA using natural adenosine. However, the research on introducing chemically modified unnatural adenosine into the poly A tail structure while controlling its length is relatively scarce. Since the poly A tail structure is also an important control factor for translation initiation, and it can also regulate the stability and turnover rate of mRNA, thereby affecting the translation efficiency of mRNA, developing a method that uses novel chemically modified nucleotides to modify the poly A tail of mRNA has very important significance and broad application prospects in the related applications of mRNA. Summary of the Invention

[0004] Aiming at the deficiencies of the existing technology, the purpose of the present invention is to provide a chemically modified adenosine triphosphate, its preparation method and application. By means of chemical synthesis, the present invention chemically modifies natural adenine, phosphorylates the chemically modified adenine, and then uses in vitro transcription to synthesize mRNA with the modified adenine globally replacing natural adenine, or uses a poly(A) polymerase to polyadenylate mRNA with the chemically modified adenosine. These modified mRNAs show enhanced translation efficiency and higher stability both in vitro and in cells.

[0005] To achieve the purpose of this invention, the following technical solutions are adopted:

[0006] In the first aspect, the present invention provides a chemically modified adenosine nucleoside, and the chemically modified adenosine nucleoside is selected from compounds having the structure shown in Formula VIII, their salts or their isomers:

[0007]

[0008] Among them, R1 is selected from methyl, acetyl, propionyl, butyryl, valeryl, hexanoyl or benzoyl;

[0009] R2 is selected from hydrogen or amino;

[0010] R3 is selected from hydrogen, hydroxyl, fluorine or methoxy;

[0011] X is selected from nitrogen or carbon.

[0012] In the present invention, the use of chemical means to synthesize non-naturally modified nucleosides can greatly enrich the types and scope of non-natural nucleosides, is also conducive to establishing structure-activity relationships, and can also perform regional modification of mRNA, which are not available when using naturally occurring modified bases to improve mRNA currently.

[0013] In the second aspect, the present invention provides a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is selected from compounds having the structure shown in Formula I, their salts or their isomers:

[0014]

[0015] Among them, R1 is selected from methyl, acetyl, propionyl, butyryl, valeryl, hexanoyl or benzoyl;

[0016] R2 is selected from hydrogen or amino;

[0017] R3 is selected from hydrogen, hydroxyl, fluorine or methoxy;

[0018] X is selected from nitrogen or carbon.

[0019] The present invention provides a new chemically modified adenosine and a chemically modified adenosine triphosphate, providing more optional raw materials for mRNA technology. By replacing the natural adenosine in mRNA with the entirely new chemically modified adenosine of the present invention, or performing polyadenylation modification on the mRNA prepared by in vitro transcription with the chemically modified adenosine, the stability and translation efficiency of the target mRNA can be enhanced.

[0020] In a third aspect, the present invention provides a method for preparing the chemically modified adenosine triphosphate described in the second aspect, and the preparation method includes:

[0021] (1) Performing a hydroxyl protection reaction on the hydroxyl group of the compound of formula II to obtain the compound of formula III;

[0022] (2) Reacting the compound of formula III with an acid anhydride or an acyl chloride to obtain the compound of formula IV;

[0023] (3) Performing a complete deprotection reaction on the protecting group of the compound of formula IV to obtain the compound of formula V;

[0024] (4) Reacting the compound of formula V with a chlorinating reagent to obtain the compound of formula VI;

[0025] (5) Reacting the compound of formula VI with tetrabutylammonium pyrophosphate to obtain the compound of formula VII;

[0026] (6) Performing a quenching reaction on the compound of formula VII to obtain the compound of formula I;

[0027]

[0028] Preferably, in step (1), tert-butyldimethylchlorosilane is used for the hydroxyl protection reaction.

[0029] Preferably, in step (2), the acid anhydride is selected from acetic anhydride, propionic anhydride, butyric anhydride, valeric anhydride, hexanoic anhydride or benzoic anhydride.

[0030] Preferably, in step (2), the acyl chloride is selected from acetyl chloride, propionyl chloride, butyryl chloride, valeryl chloride, hexanoyl chloride or benzoyl chloride.

[0031] In the present invention, compared with the acid anhydride, the acyl chloride has a better reaction effect.

[0032] Preferably, in step (3), tetrabutylammonium fluoride is used for the complete deprotection reaction.

[0033] Preferably, in step (4), the chlorinating reagent is selected from phosphorus oxychloride.

[0034] Fourthly, the present invention provides a chemically modified nucleic acid, which contains the chemically modified adenosine described in the first aspect.

[0035] Preferably, in the preparation of the chemically modified nucleic acid, all the natural adenosine in the mRNA is replaced with the chemically modified adenosine described in the first aspect; or the mRNA prepared by in vitro transcription is polyadenylated with the chemically modified adenosine triphosphate described in the first aspect.

[0036] In the present invention, by means of chemical synthesis, natural adenine is chemically modified, these modified adenines are triphosphorylated, and then the mRNA with modified adenine globally replacing natural adenine is synthesized by in vitro transcription, or the mRNA is polyadenylated with modified adenosine by using a tailing enzyme. These modified mRNAs show enhanced translation efficiency and higher stability both in vitro and in cells.

[0037] Preferably, the chemically modified nucleic acid at least includes:

[0038] A) A promoter sequence;

[0039] B) A 5' UTR containing at least one Kozak sequence;

[0040] C) A 3' UTR;

[0041] D) A coding sequence composed of linked nucleosides;

[0042] E) A poly-A tail.

[0043] Fifthly, the present invention provides a preparation method of the chemically modified nucleic acid described in the fourth aspect, and the preparation method includes:

[0044] Using four ribonucleotides of cytosine nucleoside triphosphate, uracil nucleoside triphosphate, guanine nucleoside triphosphate and chemically modified adenosine triphosphate as raw materials, under the catalysis of RNA polymerase, PCR reaction is carried out with DNA as a template to synthesize the chemically modified nucleic acid;

[0045] Or, using the mRNA obtained by in vitro transcription as a template and the chemically modified adenosine triphosphate as a substrate, the mRNA is tailed with E.Coli poly(A) polymerase or Yeast poly(A) polymerase to obtain the chemically modified nucleic acid.

[0046] Preferably, the RNA polymerase is T7 RNA polymerase.

[0047] Preferably, the PCR reaction system comprises: a DNA template, an RNase inhibitor, T7 RNA polymerase, an RNA polymerase buffer, chemically modified adenosine triphosphate, guanosine triphosphate, uridine triphosphate and cytosine triphosphate and a 5' cap structure.

[0048] In a sixth aspect, the present invention provides the use of any one or a combination of at least two of the chemically modified adenine nucleoside described in the first aspect, the chemically modified adenine nucleoside triphosphate described in the second aspect, the method for preparing the chemically modified adenine nucleoside triphosphate described in the third aspect, the chemically modified nucleic acid described in the fourth aspect, or the method for preparing the chemically modified nucleic acid described in the fifth aspect in the preparation of mRNA drugs.

[0049] Compared with the prior art, the present invention has the following beneficial effects:

[0050] The mRNA replaced with the chemically modified adenine nucleoside provided by the present invention has good translation effects at the in vitro and cellular levels, which is better than the modification method using pseudouridine to replace uridine. The mRNA replaced with the chemically modified adenine nucleoside provided by the present invention in combination with pseudouridine has a better translation effect at the in vitro and cellular levels than the modification method using pseudouridine to replace uridine. The mRNA polyadenylated and tailed with chemically modified adenosine has a better translation effect at the cellular level than the mRNA with a poly-natural adenosine tail, and at the same time has higher stability at the single nucleoside level. BRIEF DESCRIPTION OF THE DRAWINGS

[0051] Figure 1 It is N6-propionyl adenosine 1 H NMR characterization chart.

[0052] Figure 2 It is N6-propionyl adenosine 13 C NMR characterization chart.

[0053] Figure 3 It is the HRMS characterization chart of N6-propionyl adenosine.

[0054] Figure 4 It is N6-propionyl adenosine triphosphate 1 H NMR characterization chart.

[0055] Figure 5 It is N6-propionyl adenosine triphosphate 13 C NMR characterization chart.

[0056] Figure 6 It is the HRMS characterization chart of N6-propionyl adenosine triphosphate.

[0057] Figure 7 It is N6-butyryladenosine1 1H NMR characterization diagram.

[0058] Figure 8 It is of N6-butyryl adenosine 13 13C NMR characterization diagram.

[0059] Figure 9 It is the HRMS characterization of N6-butyryl adenosine.

[0060] Figure 10 It is of N6-butyryl adenosine triphosphate 1 1H NMR characterization diagram.

[0061] Figure 11 It is of N6-butyryl adenosine triphosphate 13 13C NMR characterization diagram.

[0062] Figure 12 It is the HRMS characterization of N6-butyryl adenosine triphosphate.

[0063] Figure 13 It is of N6-valeryl adenosine 1 1H NMR characterization diagram.

[0064] Figure 14 It is of N6-valeryl adenosine 13 13C NMR characterization diagram.

[0065] Figure 15 It is the HRMS characterization diagram of N6-valeryl adenosine.

[0066] Figure 16 It is of N6-valeryl adenosine triphosphate 1 1H NMR characterization diagram.

[0067] Figure 17 It is of N6-valeryl adenosine triphosphate 13 13C NMR characterization diagram.

[0068] Figure 18 It is the HRMS characterization diagram of N6-valeryl adenosine triphosphate.

[0069] Figure 19 It is of N6-hexanoyl adenosine 1 1H NMR characterization diagram.

[0070] Figure 20 It is of N6-hexanoyl adenosine 13 13C NMR characterization diagram.

[0071] Figure 21 It is the HRMS characterization diagram of N6-hexanoyl adenosine.

[0072] Figure 22of N6-hexanoyl adenosine triphosphate 1 1H NMR characterization diagram.

[0073] Figure 23 of N6-hexanoyl adenosine triphosphate 13 13C NMR characterization diagram.

[0074] Figure 24 is the HRMS characterization diagram of N6-hexanoyl adenosine triphosphate.

[0075] Figure 25 is the HRMS characterization diagram of N6-benzoyl adenosine triphosphate.

[0076] Figure 26 is the HRMS characterization diagram of N6-methyl adenosine triphosphate.

[0077] Figure 27 is the HRMS characterization diagram of N6-acetyl adenosine triphosphate.

[0078] Figure 28 is the HRMS characterization diagram of 2-amino adenosine triphosphate.

[0079] Figure 29 is the HRMS characterization diagram of 7-deaza adenosine triphosphate.

[0080] Figure 30 is the effect diagram of polyadenylation modification of eGFP mRNA by E.Coli polyA polymerase.

[0081] Figure 31 is the effect diagram of polyadenylation modification of eGFP mRNA by Yeast polyA polymerase.

[0082] Figure 32 is the effect diagram of the expression of luciferase mRNA combined with chemically modified adenosine and pseudouridine after incubation in rabbit reticulocyte lysate for 90 min.

[0083] Figure 33 is the effect diagram of the expression of luciferase mRNA with globally replaced natural adenosine by chemically modified adenosine after incubation in rabbit reticulocyte lysate for 90 min.

[0084] Figure 34 is the effect diagram of the expression of luciferase mRNA with globally replaced natural adenosine by chemically modified adenosine after transfection into HEK 293T cells for 24 h.

[0085] Figure 35 is the effect diagram of the expression of luciferase mRNA combined with chemically modified adenosine and pseudouridine after transfection into HeLa cells for 24 h.

[0086] Figure 36 It is a fluorescence imaging diagram of the expression effect of chemically modified adenosine polyadenylated eGFP mRNA in HEK 293T cells.

[0087] Figure 37 It is a schematic diagram of the chemically modified adenosine triphosphate of the present invention and its application. Specific Embodiments

[0088] The technical solutions of the present invention will be further described below through specific embodiments. Those skilled in the art should understand that the embodiments are only for helping to understand the present invention and should not be regarded as specific limitations to the present invention.

[0089] For those not specifying specific techniques or conditions in the embodiments, they shall be in accordance with the techniques or conditions described in the literature in the art or in accordance with the product specifications. For those reagents or instruments not indicating the manufacturer, they are all conventional products that can be commercially purchased through regular channels.

[0090] Example 1 Synthesis of Chemically Modified Adenosine Triphosphate

[0091] This example provides a preparation method of a chemically modified adenosine triphosphate. The preparation technical route of the chemically modified adenosine triphosphate is as follows. Among them, the reaction conditions for each step are as follows, and the structure of the compound is characterized by nuclear magnetic resonance and liquid chromatography-mass spectrometry.

[0092]

[0093] a. Take 3 mmol (1 eq) of adenosine and dissolve it in 15 mL of N,N-dimethylformamide. Then, add 12 mmol (4 eq) of tert-butyldimethylchlorosilane and 15 mmol (5 eq) of imidazole in sequence, and stir overnight at 25 °C. After the reaction is completed, extract the reaction solution with 10 mL of ethyl acetate for 3 times, wash the organic phase with water for 3 times, collect the organic phase, dry it with anhydrous sodium sulfate, filter, concentrate, and purify it by silica gel column chromatography (dichloromethane / methanol = 100 / 1) to obtain a white solid compound 1 (i.e., compound III). The structure of compound 1 is confirmed by 1 1H NMR, 13 13C NMR and HRMS.

[0094] b. Dissolve 12 mmol (1 eq) of Compound 1 in 15 mL of anhydrous pyridine, then dropwise add 1.2 eq of the corresponding acyl chloride. After that, add 10 mg of 4-dimethylaminopyridine and stir the reaction overnight at 25 °C. After the reaction is completed, extract the reaction solution with 10 mL of ethyl acetate three times. Wash the organic phase with water three times, collect the organic phase, dry it over anhydrous sodium sulfate, filter, concentrate, and purify it by silica gel column chromatography (dichloromethane / methanol = 200 / 1) to obtain Compound 2 as a white foamy solid (i.e., the compound of Formula IV). The structure of Compound 2 was confirmed by 1 HNMR, 13 C NMR and HRMS.

[0095] c. Dissolve 1.5 mmol (1 eq) of Compound 2 in 15 mL of anhydrous tetrahydrofuran, then dropwise add 4.5 mL (3 eq) of tetrabutylammonium fluoride solution (1 M in tetrahydrofuran). Stir the reaction at room temperature for 0.5 h, then concentrate under reduced pressure and purify it by silica gel column chromatography (dichloromethane / methanol = 20 / 1 to 10 / 1) to obtain Compound 3 as a white solid (i.e., the compound of Formula V). The structure of Compound 3 was confirmed by 1 HNMR, 13 C NMR and HRMS.

[0096] d. Dissolve 0.1 mmol of Compound 3 in 2 mL of anhydrous pyridine and co-evaporate water three times under reduced pressure. Under nitrogen protection, inject 1 mL of dry trimethyl phosphate. After the solid is completely dissolved, cool the test tube in an ice bath for 2 min, and dropwise add 1.5 eq of phosphorus oxychloride with a syringe. Stir the reaction in the ice bath for 2.5 h. Then, under ice bath conditions, inject 1.5 eq of dry tributylamine and 1.5 mL (8 eq) of tributylammonium pyrophosphate solution (0.5 M in N,N-dimethylformamide) in sequence, and transfer it to room temperature to react for 0.5 h. After the reaction is completed, quench the reaction with 5 mL of 2.0 M saturated triethylamine-carbonic acid aqueous solution in an ice bath, then extract the reaction solution with 10 mL of dichloromethane, collect the aqueous phase four times; separate and purify the collected aqueous phase with a C18 column of a rapid preparative liquid chromatograph, and use 50 mM saturated triethylamine-carbonic acid aqueous solution and chromatographic grade acetonitrile as the mobile phase; finally, lyophilize the collected and purified solution to obtain Compound 4 as a white solid (i.e., the compound of Formula I). The structure of Compound 4 has been confirmed by 1 H NMR, 31 P NMR and HRMS.

[0097] In the preparation method of the chemically modified adenosine triphosphate in this example, only performing Step a, Step b, and Step c is the preparation method of the chemically modified adenosine, which will not be elaborated here one by one.

[0098] Example 2 Synthesis of N6-Propionyladenosine and N6-Propionyladenosine Triphosphate

[0099] This embodiment provides a method for preparing a chemically modified adenosine and a chemically modified adenosine triphosphate. The chemically modified adenosine is N6-propionyl adenosine, and the chemically modified adenosine triphosphate is N6-propionyl adenosine triphosphate, with the structures shown below.

[0100]

[0101] The reaction conditions for each step of the preparation are shown below, and the structures of the compounds are characterized by nuclear magnetic resonance and mass spectrometry:

[0102] a. Dissolve 3 mmol (1 eq) of adenosine in 15 mL of N,N-dimethylformamide, then sequentially add 12 mmol (4 eq) of tert-butyldimethylchlorosilane and 15 mmol (5 eq) of imidazole, and stir overnight at 25 °C; after the reaction is completed, extract the reaction solution with 10 mL of ethyl acetate 3 times, wash the organic phase with water 3 times, collect the organic phase, dry over anhydrous sodium sulfate, filter, concentrate, and purify by silica gel column chromatography (dichloromethane / methanol = 100 / 1) to obtain white solid compound 1 with a yield of 95%; the structure of compound 1 has been confirmed by 1 1H NMR, 13 13C NMR and HRMS.

[0103] b. Dissolve 12 mmol (1 eq) of compound 1 in 15 mL of anhydrous pyridine, then add 1.2 eq of propionyl chloride dropwise, and then add 10 mg of 4-dimethylaminopyridine, and stir overnight at 25 °C; after the reaction is completed, extract the reaction solution with 10 mL of ethyl acetate 3 times, wash the organic phase with water 3 times, collect the organic phase, dry over anhydrous sodium sulfate, filter, concentrate, and purify by silica gel column chromatography (dichloromethane / methanol = 200 / 1) to obtain white foam solid compound 2 with a yield of 92%; the structure of compound 2 has been confirmed by 1 1H NMR, 13 13C NMR and HRMS.

[0104] c. Dissolve 1.5 mmol (1 eq) of compound 2 in 15 mL of anhydrous tetrahydrofuran, then add 4.5 mL (3 eq) of tetrabutylammonium fluoride solution (1 M in tetrahydrofuran) dropwise, stir at room temperature for 0.5 h, then concentrate under reduced pressure, and purify by silica gel column chromatography (dichloromethane / methanol = 20 / 1 to 10 / 1) to obtain white solid compound 3 (N6-propionyl adenosine). The structure of compound 3 has been confirmed by 1 1H NMR, 13 13C NMR and HRMS. The 1 1H NMR characterization diagram of N6-propionyl adenosine is as shown in Figure 1 shown, and the 13 13C NMR characterization diagram of N6-propionyl adenosine is as shown in Figure 2As shown, the HRMS characterization diagram of N6-propionyl adenosine is as Figure 3 shown.

[0105] d. Dissolve 0.1 mmol of compound 3 in 2 mL of anhydrous pyridine, and co-evaporate water 3 times under reduced pressure; under nitrogen protection, inject 1 mL of dry trimethyl phosphate, cool the test tube in an ice bath for 2 min after the solid is completely dissolved, and add 1.5 eq of phosphorus oxychloride dropwise with a syringe; stir and react for 2.5 h in an ice bath; then inject 1.5 eq of dry tributylamine and 1.5 mL (8 eq) of tributylammonium pyrophosphate solution (0.5 M N,N-dimethylformamide solution) successively under ice bath conditions, and transfer to room temperature to react for 0.5 h. After the reaction is completed, quench the reaction with 5 mL of 2.0 M saturated triethylamine-carbonic acid aqueous solution under ice bath, then extract the reaction solution with 10 mL of dichloromethane, collect the aqueous phase, and repeat 4 times; separate and purify the collected aqueous phase with a C18 column of a rapid preparative liquid chromatograph, and use 50 mM saturated triethylamine-carbonic acid aqueous solution and chromatographic grade acetonitrile as the mobile phase; finally, lyophilize the collected and purified solution to obtain a white solid 4 (N6-propionyl adenosine triphosphate). The structure of compound 4 has been confirmed by 1 1H NMR, 31 31P NMR and HRMS. The 1 1H NMR characterization diagram of N6-propionyl adenosine triphosphate is as Figure 4 shown, the 13 13C NMR characterization diagram of N6-propionyl adenosine triphosphate is as Figure 5 shown, and the HRMS characterization diagram of N6-propionyl adenosine triphosphate is as Figure 6 shown.

[0106] Example 3 Synthesis of N6-butyryl adenosine and N6-butyryl adenosine triphosphate

[0107] This example provides a preparation method of a chemically modified adenosine and a chemically modified adenosine triphosphate. The chemically modified adenosine is N6-butyryl adenosine, and the chemically modified adenosine triphosphate is N6-butyryl adenosine triphosphate, and the structures are as shown below.

[0108]

[0109] The difference between the preparation method and Example 2 is that butyryl chloride is used for the reaction in step b, the reaction conditions of each step of the preparation refer to Example 2, and the compound structure is characterized by nuclear magnetic resonance and mass spectrometry.

[0110] The 1H NMR characterization diagram of N6-butyryl adenosine is as Figure 7 shown, the 13C NMR characterization diagram of N6-butyryl adenosine is as Figure 8 shown, and the HRMS characterization of N6-butyryl adenosine is as Figure 9As shown, the 1H NMR characterization diagram of N6-butyryl adenosine triphosphate is as follows Figure 10 As shown, the 13C NMR characterization diagram of N6-butyryl adenosine triphosphate is as follows Figure 11 As shown, the HRMS characterization of N6-butyryl adenosine triphosphate is as follows Figure 12 As shown.

[0111] Example 4 Synthesis of N6-valeryl adenosine and N6-valeryl adenosine triphosphate

[0112] This example provides a preparation method of chemically modified adenosine and chemically modified adenosine triphosphate. The chemically modified adenosine is N6-valeryl adenosine, and the chemically modified adenosine triphosphate is N6-valeryl adenosine triphosphate, and the structures are as follows.

[0113]

[0114]

[0115] The difference in the preparation method from Example 2 is that in step b, valeryl chloride is used for the reaction. The reaction conditions for each step of the preparation refer to Example 2, and the structures of the compounds are characterized by nuclear magnetic resonance and mass spectrometry.

[0116] The 1H NMR characterization diagram of N6-valeryl adenosine is as follows Figure 13 As shown, the 13C NMR characterization diagram of N6-valeryl adenosine is as follows Figure 14 As shown, the HRMS characterization diagram of N6-valeryl adenosine is as follows Figure 15 As shown. The 1H NMR characterization diagram of N6-valeryl adenosine triphosphate is as follows Figure 16 As shown, the 13C NMR characterization diagram of N6-valeryl adenosine triphosphate is as follows Figure 17 As shown, the HRMS characterization diagram of N6-valeryl adenosine triphosphate is as follows Figure 18 As shown.

[0117] Example 5 Synthesis of N6-hexanoyl adenosine and N6-hexanoyl adenosine triphosphate

[0118] This example provides a preparation method of chemically modified adenosine and chemically modified adenosine triphosphate. The chemically modified adenosine is N6-hexanoyl adenosine, and the chemically modified adenosine triphosphate is N6-hexanoyl adenosine triphosphate, and the structures are as follows.

[0119]

[0120] The difference in the preparation method from Example 2 is that in step b, hexanoyl chloride is used for the reaction. The reaction conditions for each step of the preparation refer to Example 2, and the structures of the compounds are characterized by nuclear magnetic resonance and mass spectrometry.

[0121] The 1H NMR characterization diagram of N6-hexanoyl adenosine is as follows Figure 19 shown, and the 13C NMR characterization diagram of N6-hexanoyl adenosine is as follows Figure 20 shown, and the HRMS characterization diagram of N6-hexanoyl adenosine is as follows Figure 21 shown. The 1H NMR characterization diagram of N6-hexanoyl adenosine triphosphate is as follows Figure 22 shown, and the 13C NMR characterization diagram of N6-hexanoyl adenosine triphosphate is as follows Figure 23 shown, and the HRMS characterization diagram of N6-hexanoyl adenosine triphosphate is as follows Figure 24 shown.

[0122] Example 6 N6-benzoyl adenosine triphosphate

[0123] This example provides a preparation method of a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is N6-benzoyl adenosine triphosphate, and the structure is as follows

[0124]

[0125] The difference between the preparation method and Example 2 is that in step b, benzoic anhydride is used for the reaction, and the reaction conditions of each step of the preparation refer to Example 2, and the structure of the compound is characterized by nuclear magnetic resonance and mass spectrometry. The HRMS characterization diagram of N6-benzoyl adenosine triphosphate is as follows Figure 25 shown.

[0126] Example 7 N6-methyl adenosine triphosphate

[0127] This example provides a preparation method of a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is N6-methyl adenosine triphosphate, and the structure is as follows

[0128]

[0129] The difference between the preparation method and Example 2 is that commercially available N6-methyl adenosine (CAS No.: 1867-73-8) is directly used as the raw material for the phosphorylation reaction, and the reaction conditions of each step of the preparation refer to Example 2, and the structure of the compound is characterized by nuclear magnetic resonance and mass spectrometry. The HRMS characterization diagram of N6-methyl adenosine triphosphate is as follows Figure 26 shown.

[0130] Example 8 N6-acetyl adenosine triphosphate

[0131] This example provides a preparation method of a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is N6-acetyl adenosine triphosphate, and the structure is as follows

[0132]

[0133] The difference between the preparation method and Example 2 is that acetyl chloride is used for the reaction in step b. The reaction conditions for each step of the preparation refer to Example 2, and the structure of the compound is characterized by nuclear magnetic resonance and mass spectrometry. The HRMS characterization diagram of N6-acetyl adenosine triphosphate is as Figure 27 shown.

[0134] Example 9 2-Amino adenosine triphosphate

[0135] This example provides a preparation method of a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is 2-amino adenosine triphosphate, and the structure is as shown below.

[0136]

[0137] The difference between the preparation method and Example 2 is that commercially available 2-amino adenosine (CAS No.: 2096-10-8) is directly used as the raw material for the reaction. The reaction conditions for each step of the preparation refer to Example 2, and the structure of the compound is characterized by nuclear magnetic resonance and mass spectrometry. The HRMS characterization diagram of 2-amino adenosine triphosphate is as Figure 28 shown.

[0138] Example 10 7-Deaza adenosine triphosphate

[0139] This example provides a preparation method of a chemically modified adenosine triphosphate, and the chemically modified adenosine triphosphate is 7-deaza adenosine triphosphate, and the structure is as shown below.

[0140]

[0141] The difference between the preparation method and Example 2 is that commercially available 7-deaza adenosine (CAS No.: 69-33-0) is directly used as the raw material for the reaction. The reaction conditions for each step of the preparation refer to Example 2, and the structure of the compound is characterized by nuclear magnetic resonance and mass spectrometry. The HRMS characterization diagram of 7-deaza adenosine triphosphate is as Figure 29 shown.

[0142] Example 11 Preparation of DNA Template for Compiling Enhanced Green Fluorescent Protein

[0143] The DNA template for compiling enhanced green fluorescent protein is prepared by linearizing the plasmid containing the target gene with restriction enzymes.

[0144] 1) Preparation of enhanced green fluorescent protein linear DNA template by enzymatic digestion method, which is carried out in a 96-well PCR instrument. The products after linearization at least include:

[0145] A) A promoter sequence (T7 promoter);

[0146] B) a 5’ UTR containing at least one Kozak sequence;

[0147] C) a 3’ UTR;

[0148] D) an eGFP coding sequence.

[0149] The specific sequences involved in this example are shown in Table 1

[0150] Table 1

[0151]

[0152]

[0153] SEQ ID No.2:

[0154] acatttgcttctgacacaactgtgttcactagcaacctcaaacagacaccccatggtggcggatcc.

[0155] SEQ ID No.3:

[0156] gctcgctttcttgctgtccaatttctattaaaggttcctttgttccctaagtccaactactaaactgggggatattatgaagggccttgagcatctggattctgcctaataaaaaacatttattttcattgcaa.

[0157] SEQ ID No.4:

[0158] atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa。

[0159] Prepare the following reaction system for linearization of the DNA template: The reaction volume is 20 μL (for the reaction volume of a single tube, multiple tubes can be reacted simultaneously at one time). The specific reaction system is shown in Table 2.

[0160] Table 2

[0161] Component Volume pET-eGFP-Kan vector (400 ng / μL) 2.5 μL EcoRV-HF (20000 units / mL) 1 μL rCutSmart buffer (10×) 2 μL Nuclease-free water 14.5 μL

[0162] Start the heated lid of the thermostat and set it to 60 °C.

[0163] Click on the thermostat reaction system at 37 °C for 15 min.

[0164] The digested product was purified using the HiPure Gel Pure DNA Mini Kit (Guangzhou Meiji Biotechnology Co., Ltd., catalog number: D2111). The purification process is as follows:

[0165] (1) Briefly centrifuge the digested reaction product.

[0166] (2) Add an equal volume of buffer GDP and mix by inverting.

[0167] (3) Place the HiPure DNA column in the collection tube, transfer the mixture to the DNA column, and centrifuge at 12,000 g for 30 - 60 s. Discard the filtrate and place the column back into a 2 mL centrifuge tube. Add 600 μL of buffer DW2 (diluted with absolute ethanol) to the column and centrifuge at 12,000 g for 30 - 60 s.

[0168] (4) Discard the filtrate and place the column back into a 2 mL centrifuge tube. Add 600 μL of buffer DW2 (diluted with absolute ethanol) to the column and centrifuge at 12,000 g for 30 - 60 s. Discard the filtrate, place the column back into a 2 mL centrifuge tube, and centrifuge at 12,000 g for 2 minutes.

[0169] (5) Place the column back into a 1.5 mL centrifuge tube, add 15 - 30 μL of elution buffer to the center of the column membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12,000 g for 1 minute. Discard the column, detect the concentration of the template DNA, as well as the ratios of 260 / 280 and 260 / 230 using a NanoDrop spectrophotometer, and then store the DNA at -20°C.

[0170] Preparation of the DNA template for the luciferase in Example 12

[0171] Using the plasmid encoding luciferase as a template, DNA amplification was carried out in a PCR tube using DNA polymerase. The specific steps are as follows:

[0172] 1) Preparation of the luciferase DNA template by PCR, carried out in a 96-well PCR instrument.

[0173] The PCR product includes at least:

[0174] A) A promoter sequence (T7 promoter);

[0175] B) A 5’UTR containing at least one Kozak sequence;

[0176] C) 3’UTR;

[0177] D) The luciferase coding sequence;

[0178] E) A polyA tail.

[0179] The specific sequences involved in this embodiment are shown in Table 3

[0180] Table 3

[0181] Name Sequence T7 promoter taatacgactcactatag (SEQ ID No.1) 5’UTR SEQ ID No.5 3’UTR SEQ ID No.6 Luciferase Luc SEQ ID No.7 PolyA tail aaaaaaaaaaaaaaaaaaaaaaaaaaaaaa (SEQ ID No.8) Primer F taatacgactacctagggggctggccggtacctgagctc (SEQ ID No.9) Primer R ctccccctgaacctgaaacata (SEQ ID No.10)

[0182] SEQ ID No:5:

[0183] ggcctaactggccggtacctgagctcgctagcctcgaggatatcaagatctggcctcggcggccaagctt。

[0184] SEQ ID No:6:

[0185] taattctagagtcgggcggccggccgcttcgagc。

[0186] SEQ ID No:7:

[0187]

[0188] Prepare the following reaction system for the amplification of the DNA template: The reaction volume is 50 μL (the reaction volume for a single tube, and multiple tubes can be reacted simultaneously at one time). The specific reaction system is shown in Table 4 below.

[0189] Table 4

[0190] Component Volume Phanta Max Super-Fidelity DNA Polymerase (1 U / μL) 1 μL 2×Phanta Max buffer 25 μL pGL4.10 (luc2) vector (400 ng / μL) 0.05 μL Primer F 1 μL Primer R 1 μL dNTPs (10 mM) 1 μL Water 20.95 μL

[0191] The reaction procedure is as follows: Pre-denaturation at 95 °C for 1 minute, denaturation at 95 °C for 15 s, annealing at 52 °C for 5 s, extension at 72 °C for 2 minutes, for a total of 32 cycles; finally, extension at 72 °C for 5 minutes.

[0192] After the reaction is completed, combine the reaction solutions in a 1.5 mL tube. Take 2 μL for DNA agarose gel electrophoresis detection to determine the success of the reaction (agarose gel electrophoresis detection conditions: 2% agarose, 5 V / minute, electrophoresis for 30 minutes).

[0193] Purify the reaction product using the HiPure Gel Pure DNAMini Kit. The purification process is as follows:

[0194] (1) Briefly centrifuge the PCR product.

[0195] (2) Add an equal volume of buffer GDP and invert to mix well.

[0196] (3) Place the HiPure DNA column in the collection tube, transfer the mixture to the DNA column, and centrifuge at 12000 g for 30 - 60 s. Discard the filtrate, and place the column back into a 2 mL centrifuge tube. Add 600 μL of buffer DW2 (diluted with absolute ethanol) to the column and centrifuge at 12000 g for 30 - 60 s.

[0197] (4) Discard the filtrate, and place the column back into a 2 mL centrifuge tube. Add 600 μL of buffer DW2 (diluted with absolute ethanol) to the column and centrifuge at 12000 g for 30 - 60 s. Discard the filtrate, place the column back into a 2 mL centrifuge tube, and centrifuge at 12000 g for 2 minutes.

[0198] (5) Place the column back into a 1.5 mL centrifuge tube, add 15 - 30 μL of elution buffer to the center of the column membrane, let it stand at room temperature for 2 minutes, and centrifuge at 12000 g for 1 minute. Discard the column, detect the concentration of the template DNA, as well as the ratios of 260 / 280 and 260 / 230 using a NanoDrop spectrophotometer, and then store the DNA at -20 °C.

[0199] Example 13 In vitro transcription synthesis of mRNA with chemically modified adenosine globally replacing natural adenosine

[0200] The synthesis of mRNA with chemically modified adenosine globally replacing natural adenosine is achieved by in vitro transcription using T7 RNA polymerase. Taking a 50 μL reaction system as an example, the components shown in Table 5 are added successively in a 0.2 mL PCR reaction tube.

[0201] Table 5

[0202]

[0203]

[0204] *When preparing eGFP mRNA by in vitro transcription, the template is the enhanced green fluorescent protein DNA template.

[0205] ** is adenosine triphosphate or chemically modified cytidine adenosine triphosphate.

[0206] Cap Analogue# is a commercially available cap structure analogue; in this example, 3’-O-Me-m7-G(5’)ppp(5’)G RNA Cap Structure Analog provided by New England Biolabs, with the product number S1411S, is used.

[0207] Start the thermal cover of the thermostat and set it to 60 °C.

[0208] Click on the thermostat reaction system at 37 °C for 2 - 4 h.

[0209] After incubation, the mRNA purification method is as follows:

[0210] 1. Add 1 μL of DNase I (RNase-free) to each 50 μL reaction system and incubate at 37 °C for 15 minutes to digest the DNA template in the system.

[0211] 2. Add 2.5 μL of disodium ethylenediaminetetraacetate solution (500 mM) to each 50 μL reaction system and incubate at 65 °C for 10 minutes.

[0212] 3. Suspend the cellulose solution in the elution solution to prepare a suspension of 0.2 g cellulose / mL (for the preparation method, refer to the literature: A Facile Method for the Removal of dsRNA Contaminants from In Vitro Transcribed mRNA, Molecular Therapy Nucleic Acids, 2019, 15, 26 - 35). Fit the DNA adsorption column into a 2 mL receiving tube (Guangzhou Meiji Biotechnology, DNA / RNA Mini Adsorption Column, product number M021), then take 630 μL of the suspension and add it to the DNA column, and vortex for 2 h for activation.

[0213] 4. Centrifuge the activated cellulose suspension at 13000 g for 1 minute, discard the filtrate, then re - add 500 μL of the elution solution to make a suspension. Then add the in vitro transcription reaction mixture solution to the DNA column and vortex for 30 minutes.

[0214] 5. Centrifuge the DNA column at 13000 g for 1 minute, collect the filtrate, add it to a new activated DNA column (the activation step is as described in step 3), and vortex for 30 minutes.

[0215] 6. Centrifuge the DNA column at 13000 g for 1 minute, collect the filtrate, and then transfer the filtrate to a new nuclease - free 1.5 mL centrifuge tube pre - cooled on ice.

[0216] 7. Pre - cool absolute isopropyl alcohol and 3M sodium acetate solution on ice in advance, then add 500 μL of absolute isopropyl alcohol and 50 μL of sodium acetate solution to the centrifuge tube in (6), gently invert and mix evenly, and then centrifuge at 14000 g at 4℃ for 10 minutes.

[0217] 8. Remove the supernatant solution, then add 300 μL of absolute ethanol pre - cooled at 4℃ to the centrifuge tube, and then centrifuge at 14000 g at 4℃ for 10 minutes.

[0218] 9. Remove the supernatant solution, and then air - dry the precipitate at room temperature for 30 minutes.

[0219] 10. Dissolve the obtained mRNA product in 20 - 50 μL of nuclease - free water, measure the concentration of the purified mRNA using a NanoDrop spectrophotometer, and simultaneously measure the ratios of 260 / 230 and 260 / 280.

[0220] 11. Take 500 ng of the purified mRNA and perform agarose gel electrophoresis to detect the fragment integrity.

[0221] 12. Store the mRNA solution at - 80℃.

[0222] Among them, the chemically modified adenosine nucleosides include the following: N6-methyladenosine, N6-acetyladenosine, N6-propionyladenosine, N6-butyryladenosine, N6-valeryladenosine, N6-hexanoyladenosine, N6-benzoyladenosine, 2-aminoadenosine, 7-deazaadenosine, etc.

[0223] Example 14 In vitro transcription synthesis of mRNA with global replacement of natural adenosine and natural uridine by the combination of chemically modified adenosine and pseudouridine

[0224] This example is exactly the same as the conditions and operation methods in Example 13, except that in the substrate for in vitro transcription, natural uridine is completely replaced by pseudouridine. The remaining purification and characterization methods are exactly the same.

[0225] Table 6

[0226] Component Volume Luciferase DNA template (~400 ng / μL) 5 μL Ribonuclease inhibitor (40 U / μL) 1.5 μL T7 RNA Polymerase (50 U / μL) 5 μL 10×RNA Pol. buffer 5 μL Nuclease-free water 13.5 μL ATP** (10 mM) 5 μL CTP (10 mM) 5 μL GTP (10 mM) 1 μL PseudoUTP (10 mM) 5 μL Cap Analogue# (10 mM) 4 μL

[0227] ** is adenosine triphosphate or chemically modified cytidine triphosphate.

[0228] Cap Analogue# is a commercially available cap structure analogue; in this example, 3’-O-Me-m7-G(5’)ppp(5’)G RNA Cap Structure Analog provided by New England Biolabs is used, with the product number S1411S.

[0229] Example 15 Polyadenylation modification of in vitro transcribed eGFP mRNA

[0230] The polyadenylation modification of in vitro transcribed eGFP mRNA with chemically modified adenosine is achieved by E.Coli polyA polymerase or Yeast polyA polymerase. Taking a 20 μL reaction system as an example, in a 0.2 mL PCR tube, the components shown in Table 7 and Table 8 are added in sequence.

[0231] Table 7

[0232] Component Volume Ribonuclease inhibitor (40 U / μL) 0.5 μL E.Coli polyA polymerase (5000 U / mL) 1 μL eGFP mRNA 1 μg Buffer A (5×) 4 μL ATPs* 1 μL Nuclease-free water To 20 μL

[0233] * is adenosine triphosphate or chemically modified adenosine triphosphate.

[0234] The components of Buffer A (5×) are as follows: 500 mM potassium acetate, 100 mM Tris-HCl (pH 8.0), 10 mM magnesium acetate, 0.25% NP-40.

[0235] Table 8

[0236] Component Volume Ribonuclease inhibitor (40 U / μL) 0.5 μL Yeast polyA polymerase (5000 U / mL) 1 μL eGFP mRNA 1 μg Buffer B (5×) 4 μL ATPs* 1 μL Nuclease-free water To 20 μL

[0237] * is adenosine triphosphate or chemically modified adenosine triphosphate.

[0238] The components of Buffer B (5×) are as follows: 50% glycerol, 125 mM Tris-HCl (pH 7.0), 0.5 mg / mL BSA, 3.5 mM manganese chloride, 250 mM potassium chloride, 0.05 mM EDTA, 2.5 mM dithiothreitol.

[0239] Start the thermal cover of the thermostat and set it to 60 °C.

[0240] Click on the thermostat reaction system at 37 °C for 30 min.

[0241] After incubation, the method for purifying the polyadenylated mRNA is as described in Example 13.

[0242] Take 500 ng of the purified mRNA and perform agarose gel electrophoresis to determine the success of the reaction (agarose gel electrophoresis detection conditions: 2% agarose, 5 V / cm, electrophoresis for 30 minutes).

[0243] Figure 30 It is the effect diagram of polyadenylation modification of eGFP mRNA by E.Coli polyA polymerase. In the figure, lanes 1-13 are respectively: Lane 1: eGFP mRNA template; Lane 2: Native adenosine-tailed product of eGFP mRNA; Lane 3: 2'-methoxyadenosine-tailed product of eGFP mRNA; Lane 4: 2'-fluoroadenosine-tailed product of eGFP mRNA; Lane 5: N6-methyladenosine-tailed product of eGFP mRNA; Lane 6: N6-acetyladenosine-tailed product of eGFP mRNA; Lane 7: N6-propionyladenosine-tailed product of eGFP mRNA; Lane 8: N6-butyryladenosine-tailed product of eGFP mRNA; Lane 9: N6-valeryladenosine-tailed product of eGFP mRNA; Lane 10: N6-hexanoyladenosine-tailed product of eGFP mRNA; Lane 11: N6-benzoyladenosine-tailed product of eGFP mRNA; Lane 12: 2-aminoadenosine-tailed product of eGFP mRNA; Lane 13: 7-deazaadenosine-tailed product of eGFP mRNA.

[0244] Figure 31The figure shows the effect of polyadenylation modification of eGFP mRNA by Yeast polyA polymerase. In the figure, lanes 1-13 are as follows: Lane 1: eGFP mRNA template; Lane 2: Native adenosine-tailed product of eGFP mRNA; Lane 3: 2'-methoxyadenosine-tailed product of eGFP mRNA; Lane 4: 2'-fluoroadenosine-tailed product of eGFP mRNA; Lane 5: N6-methyladenosine-tailed product of eGFP mRNA; Lane 6: N6-acetyladenosine-tailed product of eGFP mRNA; Lane 7: N6-propionyladenosine-tailed product of eGFP mRNA; Lane 8: N6-butyryladenosine-tailed product of eGFP mRNA; Lane 9: N6-valeryladenosine-tailed product of eGFP mRNA; Lane 10: N6-hexanoyladenosine-tailed product of eGFP mRNA; Lane 11: N6-benzoyladenosine-tailed product of eGFP mRNA; Lane 12: 2-aminoadenosine-tailed product of eGFP mRNA; Lane 13: 7-deazaadenosine-tailed product of eGFP mRNA.

[0245] Example 16 Translation of luciferase mRNA with chemically modified adenosine globally replacing native adenosine or luciferase mRNA with combined use of chemically modified adenosine and pseudouridine in rabbit reticulocyte lysate system

[0246] The rabbit reticulocyte lysate system is shown in Table 9.

[0247] Table 9

[0248] Component Volume Rabbit reticulocyte lysate, nuclease-treated 35 μL Luciferase mRNA 2 μg Ribonuclease inhibitor (40 U / μL) 1 μL Leucine-free amino acid mixture, 1 mM 0.5 μL Methionine-free amino acid mixture, 1 mM 0.5 μL Nuclease-free water To 50 μL

[0249] Start the thermal lid of the thermostat and set it to 60°C.

[0250] Click on the thermostat reaction system at 30°C for 90 min.

[0251] The incubated product is directly used for the luminescence experiment of luciferin.

[0252] Example 17 Luminescence experiment of luciferase oxidized luciferin prepared by in vitro translation

[0253] The experimental steps for detecting luminescence with a microplate reader are as follows:

[0254] Add 2.5 μL of the incubated product in Example 16 to a 96-well plate, then incubate at room temperature for 10 minutes. After that, add 50 μL of luciferase detection reagent (Promega, E1483), pipette gently to mix evenly, remove the bubbles in the system, and complete the luminescence intensity detection on the microplate reader within 5 minutes. Set two replicates for each sample.

[0255] Figure 32 This is the expression effect diagram of luciferase mRNA combined with chemically modified adenosine and pseudouridine after incubation in rabbit reticulocyte lysate for 90 min. In the figure, 1-6 respectively represent: 1: the expression effect diagram of unmodified luciferase mRNA; 2: the expression effect diagram of luciferase mRNA replaced with pseudouridine; 3: the expression effect diagram of luciferase mRNA replaced with the combination of N6-acetyl adenosine and pseudouridine; 4: the expression effect diagram of luciferase mRNA replaced with the combination of N6-propionyl adenosine and pseudouridine; 5: the expression effect diagram of luciferase mRNA replaced with the combination of N6-butyryl adenosine and pseudouridine; 6: the expression effect diagram of luciferase mRNA replaced with the combination of 2-amino adenosine and pseudouridine. The results show that when chemically modified adenosine and pseudouridine are combined, the modified mRNA has a higher expression efficiency in rabbit reticulocyte lysate, exceeding that of mRNA modified with pseudouridine alone. Therefore, chemically modified adenosine can be combined with pseudouridine to further enhance the expression efficiency of modified mRNA, as a supplementary option for pseudouridine modification.

[0256] Figure 33 This is the expression effect diagram of luciferase mRNA with chemically modified adenosine globally replacing natural adenosine after incubation in rabbit reticulocyte lysate for 90 min. In the figure, 1-10 respectively represent: 1: the expression effect diagram of unmodified luciferase mRNA; 2: the expression effect diagram of luciferase mRNA replaced with N6-methyl adenosine; 3: the expression effect diagram of luciferase mRNA replaced with N6-acetyl adenosine; 4: the expression effect diagram of luciferase mRNA replaced with N6-propionyl adenosine; 5: the expression effect diagram of luciferase mRNA replaced with N6-butyryl adenosine; 6: the expression effect diagram of luciferase mRNA replaced with N6-valeryl adenosine; 7: the expression effect diagram of luciferase mRNA replaced with N6-hexanoyl adenosine; 8: the expression effect diagram of luciferase mRNA replaced with N6-benzoyl adenosine; 9: the expression effect diagram of luciferase mRNA replaced with 2-amino adenosine; 10: the expression effect diagram of luciferase mRNA replaced with 7-deaza adenosine. The results show that luciferase mRNA with chemically modified adenosine globally replacing natural adenosine has a higher expression efficiency in rabbit reticulocyte lysate compared to unmodified mRNA, and the modification types include N6-acetyl modification, N6-propionyl modification, N6-butyryl modification, and N6-benzoyl modification.

[0257] Example 18 Luminescence Experiment of Luciferase Oxyluciferin Prepared by Intracellular Translation

[0258] The experimental steps for extracting the target protein luciferase from cells are as follows:

[0259] Cell culture and mRNA transfection were carried out in 24-well plates. 24 hours after the transfection of luciferase mRNA into cells, the 24-well plates were placed on ice, the culture medium was removed, and the cells were washed twice with cold PBS solution. Then, 200 μL of RIPA lysis buffer (Yeasen, catalog number 20115ES60, 1 mM PMSF was added before use) was added, and the cells were pipetted for 5 minutes to fully lyse the cells. The cell lysate was collected and transferred to a 1.5 mL EP tube, and centrifuged at 15,000 rpm for 10 minutes at 4 °C. 150 μL of the supernatant was taken for subsequent detection.

[0260] The experimental steps for detecting luminescence with a microplate reader are as follows:

[0261] The experimental steps for detecting luminescence with a microplate reader were the same as in Example 17, except that 50 μL of the protein solution extracted in this example was added to a 96-well plate, and then 50 μL of luciferase assay reagent (Promega, E1483) was added for detection. Two replicates were set for each sample.

[0262] Figure 34 This is the effect diagram of the expression of luciferase mRNA with chemically modified adenosine globally replacing natural adenosine 24 hours after transfection into HEK 293T cells. In the figure, 1-9 respectively represent: 1: the effect diagram of the expression of unmodified luciferase mRNA; 2: the effect diagram of the expression of luciferase mRNA replaced by N6-methyladenosine; 3: the effect diagram of the expression of luciferase mRNA replaced by N6-acetyladenosine; 4: the effect diagram of the expression of luciferase mRNA replaced by N6-propionyladenosine; 5: the effect diagram of the expression of luciferase mRNA replaced by N6-butyryladenosine; 6: the effect diagram of the expression of luciferase mRNA replaced by N6-valeryladenosine; 7: the effect diagram of the expression of luciferase mRNA replaced by N6-hexanoyladenosine; 8: the effect diagram of the expression of luciferase mRNA replaced by 2-aminoadenosine; 9: the effect diagram of the expression of luciferase mRNA replaced by 7-deazaadenosine. From Figure 34 It can be seen that the translation efficiency of luciferase mRNA modified by replacing natural adenosine with N6-acetyladenosine is nearly 3-fold enhanced compared to unmodified mRNA in HEK 293T cells.

[0263] Figure 35It is the effect diagram of the expression of luciferase mRNA with chemically modified adenosine and pseudouridine after transfection into HeLa cells for 24 h. In the figure, 1-6 respectively represent: 1: the effect diagram of the expression of unmodified luciferase mRNA; 2: the effect diagram of the expression of luciferase mRNA replaced with pseudouridine; 3: the effect diagram of the expression of luciferase mRNA replaced with the combination of N6-acetyladenosine and pseudouridine; 4: the effect diagram of the expression of luciferase mRNA replaced with the combination of N6-propionyladenosine and pseudouridine; 5: the effect diagram of the expression of luciferase mRNA replaced with the combination of N6-butyryladenosine and pseudouridine; 6: the effect diagram of the expression of luciferase mRNA replaced with the combination of 2-aminoadenosine and pseudouridine. The results show that when chemically modified adenosine and pseudouridine are combined, the modified mRNA has a higher expression efficiency in the cell system, exceeding that of the mRNA modified with pseudouridine alone. Therefore, chemically modified adenosine can be combined with pseudouridine to further enhance the expression efficiency of the modified mRNA, as a supplementary option for pseudouridine modification.

[0264] Example 19 Expression Efficiency of eGFP mRNA with Chemically Modified Polyadenosine Tail in Cells

[0265] Synthesize eGFP mRNA with chemically modified polyadenosine tail and detect its expression efficiency in cells; after transfection into cells, translate it into the target protein enhanced green fluorescent protein, and use a laser confocal fluorescence microscope to detect its fluorescence intensity to determine the translation efficiency of eGFP mRNA with natural and chemically modified polyadenosine tails.

[0266] The specific steps for transfecting chemically modified mRNA into HEK 293T cells are as follows:

[0267] (1) Cell transfection

[0268] Approximately 24 h after inoculating human embryonic kidney 293T cells (purchased from the Cell Bank of the Chinese Academy of Sciences), observe the cell state in a 35 mm well plate, and the confluence is 70%. In the biosafety cabinet, prepare a medium of 90% (volume percentage) DMEM + 10% (volume percentage) FBS. Discard the medium in the well plate 30 minutes before transfection, and add 3 mL of fresh medium to each well, that is, 90% (volume percentage) DMEM + 10% (volume percentage) FBS medium.

[0269] (2) Prepare the transfection system

[0270] Take 50 μL of Opti-MEM, add 800 ng of mRNA, and mix well. Additionally, prepare a mixed solution of 2 μL of Lipofectamine 2000 and 50 μL of Opti-MEM, and incubate at room temperature for 10 minutes. Then add the Lipofectamine 2000 mixed solution to the mRNA mixed solution and mix well, and incubate for 20 minutes. Add the mixed solution to the well plate. Replace the medium 6 h after transfection, aspirate the old medium, and replace it with 3 mL of fresh medium per well, namely 90% (volume percentage) DMEM + 10% (volume percentage) FBS medium. Replace the fresh medium 24 h / 48 h after transfection, and detect the fluorescence intensity of the cells with a laser confocal fluorescence microscope.

[0271] Figure 36 It is a fluorescence imaging diagram of the expression effect of chemically modified adenosine polyadenylation-modified eGFP mRNA in HEK 293T cells. In the figure, 1 represents the fluorescence imaging diagram of the expression effect of eGFP mRNA without a poly(A) tail; 2 represents the fluorescence imaging diagram of the expression effect of eGFP mRNA with a poly natural adenosine tail; 3 represents the fluorescence imaging diagram of the expression effect of eGFP mRNA with a poly N6-acetyl adenosine tail; 4 represents the fluorescence imaging diagram of the expression effect of eGFP mRNA with a poly N6-propionyl adenosine tail. The scale bar in the figure is 50 μm.

[0272] As can be seen from Table 36, eGFP mRNA with a poly N6-acetyl adenosine tail has a higher fluorescence intensity after transfection into HEK 293T cells, and the protein expression efficiency exceeds that of mRNA with a poly natural adenosine tail.

[0273] In summary, the present invention provides a chemically modified adenosine triphosphate, its preparation method and application. The schematic diagram of the chemically modified adenosine triphosphate and its application in the present invention is as Figure 37 shown. The natural adenosine in mRNA is globally replaced with the chemically modified adenosine, or polyadenylation tailing modification is performed on mRNA to enhance the translation efficiency and stability of the target mRNA and reduce immunogenicity, providing a supplement and new option for mRNA modification technology.

[0274] The applicant declares that the above description is only the specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Those skilled in the art should understand that any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present invention fall within the protection scope and disclosure scope of the present invention.

Claims

1. A chemically modified adenosine, characterized in that, The chemically modified adenosine nucleoside is selected from compounds having the structure shown in Formula VIII, salts thereof or isomers thereof: wherein, R1 is selected from methyl, acetyl, propionyl, butyryl, valeryl, hexanoyl or benzoyl; R2 is selected from hydrogen or amino; R3 is selected from hydrogen, hydroxyl, fluorine or methoxy; X is selected from nitrogen or carbon.

2. A chemically modified adenosine triphosphate, characterized in that, The chemically modified adenosine triphosphate is selected from compounds having the structure shown in Formula I, salts thereof or isomers thereof: wherein, R1 is selected from methyl, acetyl, propionyl, butyryl, valeryl, hexanoyl or benzoyl; R2 is selected from hydrogen or amino; R3 is selected from hydrogen, hydroxyl, fluorine or methoxy; X is selected from nitrogen or carbon.

3. A method for preparing the chemically modified adenosine triphosphate according to claim 2, characterized in that, The preparation method includes: (1) Performing a hydroxyl protection reaction on the hydroxyl group of the compound of Formula II to obtain the compound of Formula III; (2) Reacting the compound of Formula III with an acid anhydride or an acyl chloride to obtain the compound of Formula IV; (3) Performing a complete deprotection reaction on the protecting group of the compound of Formula IV to obtain the compound of Formula V; (4) Reacting the compound of Formula V with a chlorinating reagent to obtain the compound of Formula VI; (5) Reacting the compound of Formula VI with ammonium tributyl pyrophosphate to obtain the compound of Formula VII; (6) Performing a quenching reaction on the compound of Formula VII to obtain the compound of Formula I; 4. The method for preparing the chemically modified adenosine triphosphate according to claim 3, characterized in that, In step (1), tert-butyldimethylchlorosilane is used for the hydroxyl protection reaction; Preferably, in step (2), the acid anhydride is selected from acetic anhydride, propionic anhydride, butyric anhydride, valeric anhydride, hexanoic anhydride or benzoic anhydride; Preferably, in step (2), the acyl chloride is selected from acetyl chloride, propionyl chloride, butyryl chloride, valeryl chloride, hexanoyl chloride or benzoyl chloride.

5. The method for preparing the chemically modified adenosine triphosphate according to claim 3 or 4, characterized in that, In step (3), tetrabutylammonium fluoride is used for the complete deprotection reaction; Preferably, in step (4), the chlorinating reagent is selected from phosphorus oxychloride.

6. A chemically modified nucleic acid, characterized in that, The chemically modified nucleic acid contains the chemically modified adenosine nucleoside described in claim 1.

7. The chemically modified nucleic acid according to claim 6, characterized in that, In the preparation of the chemically modified nucleic acid, all the natural adenosine nucleosides in mRNA are replaced with the chemically modified adenosine nucleoside described in claim 1; or the mRNA prepared by in vitro transcription is polyadenylated with the chemically modified adenosine triphosphate described in claim 1; Preferably, the chemically modified nucleic acid at least includes: A) a promoter sequence; B) a 5'UTR containing at least one Kozak sequence; C) a 3'UTR; D) a coding sequence composed of linked nucleosides; E) a polyA tail.

8. A method for preparing the chemically modified nucleic acid according to claim 6 or 7, characterized in that, The preparation method includes: Using four ribonucleotides, namely cytosine triphosphate, uracil triphosphate, guanine triphosphate and chemically modified adenosine triphosphate, as raw materials, and performing a PCR reaction with DNA as a template under the catalysis of RNA polymerase to synthesize the chemically modified nucleic acid; or, using the mRNA obtained by in vitro transcription as a template and using the chemically modified adenosine triphosphate as a substrate, performing a tailing reaction on the mRNA with E. coli poly(A) polymerase or Yeast poly(A) polymerase to obtain the chemically modified nucleic acid.

9. The method for preparing the chemically modified nucleic acid according to claim 8, characterized in that, The RNA polymerase is T7 RNA polymerase; The system of the PCR reaction includes: DNA template, RNase inhibitor, T7 RNA polymerase, RNA polymerase buffer, chemically modified adenosine triphosphate, guanosine triphosphate, uridine triphosphate, cytosine triphosphate and 5' cap structure.

10. Use of any one or a combination of at least two of the method for preparing the chemically modified adenosine according to claim 1, the chemically modified adenosine triphosphate according to claim 2, the method for preparing the chemically modified adenosine triphosphate according to any one of claims 3-5, the chemically modified nucleic acid according to claim 6 or 7, or the method for preparing the chemically modified nucleic acid according to claim 8 or 9 in the preparation of mRNA drugs.