Application of alternaria tuberosa nucleoside diphosphate sugar isomerase gene in prevention and treatment of allium tuberosa leukoderma

Abstract

The invention belongs to the technical field of plant disease prevention and treatment, and relates to application of an alternaria alternate nucleoside diphosphate sugar isomerase gene in prevention and treatment of allium tuberosum leukoderma. The invention provides a dsRNA (double-stranded ribonucleic acid) preparation taking an alternaria alternate nucleoside diphosphate glycoisomerase gene as a target and application of the dsRNA preparation in prevention and control of allium tuberosum leukoplakia. Normal transcription expression of the alternaria alternate nucleoside diphosphate glycoisomerase gene is interfered by dsRNA, so that influence on mycelial growth, spore production rate and the like of alternaria alternate can be realized; and the alternaria alternata can be used for green prevention and control of the white spot disease of the Chinese chives, and is high in pertinence and good in prevention and control effect. Meanwhile, pollution of chemical agents to the environment can be reduced by using the dsRNA preparation, the safety is high, and the application range is wide.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant disease control, and relates to the application of the nucleoside-diphosphate-sugar epimerase gene of Alternaria porri in the control of Alternaria leaf blight of Chinese chives. Background Art

[0002] Chinese chive (Allium tuberosum Rottl. ex Spr) is one of the evergreen leafy vegetables. It not only contains rich nutrients but also has certain medicinal values. It is known as a vegetable with good health care effects and is deeply loved by consumers. Alternaria leaf blight of Chinese chives is mainly caused by the infection of Alternaria alternata. After infection, many gray and white small spots will appear on the leaves, affecting the quality of Chinese chives. Alternaria leaf blight seriously damages the Chinese chive fields in protected areas. The damage time is as long as 5-6 months, which can lead to a reduction in production of 10%-30%, and even cause the destruction of the crop and absolute yield loss. At present, the control of Alternaria leaf blight of Chinese chives mainly uses chemical pesticides.

[0003] RNA interference (RNAi) is a conserved regulatory mechanism mediated by RNA in eukaryotes. It is a technology that can target a target gene in the form of homologous sequence pairing and effectively silence or inhibit the expression of the target gene at the transcriptional level or post-transcriptional level. In recent years, RNAi has become an important research direction in the fields of plant insect resistance and antifungal diseases. By exogenous spraying of fungal-specific dsRNA bacteriostatic agents, the silencing of pathogen target genes can be induced, and ultimately the normal growth and development of harmful organisms can be inhibited, providing a guarantee for the safe production of crops. At present, there are few studies on the RNAi control of Alternaria diseases in plant disease control, especially no reports on the dsRNA inhibitors for the control of Alternaria leaf blight of Chinese chives. Summary of the Invention

[0004] The present invention first cloned the nucleoside-diphosphate-sugar epimerase gene (NDEE) of Alternaria porri, and then used this gene as the RNAi target to design and prepare a dsRNA bacteriostatic agent, and achieved effective prevention of Alternaria leaf blight of Chinese chives by spraying. The present invention found that the application of the dsRNA bacteriostatic agent of NDEE can significantly inhibit the spore germination, mycelial growth of Alternaria alternata and the infectivity of Alternaria alternata to Chinese chives, and can be used for the control of Alternaria leaf blight of Chinese chives.

[0005] The present invention specifically adopts the following technical solutions:

[0006] In a first aspect, the present invention provides the application of the Alternaria porri nucleoside diphosphate sugar isomerase gene in the prevention and treatment of Alternaria leaf blight of Chinese chives. The prevention and treatment of Alternaria leaf blight of Chinese chives is achieved by inhibiting the expression of the nucleoside diphosphate sugar isomerase gene of Alternaria, and the sequence of the nucleoside diphosphate sugar isomerase gene is as shown in SEQ ID NO: 1.

[0007] As an embodiment, the RNAi method is used to inhibit the expression of the nucleoside diphosphate sugar isomerase gene of Alternaria. The single-stranded RNA sequence of the dsRNA for RNAi is as shown in SEQ ID NO: 5.

[0008] In a second aspect, the present invention provides an Alternaria inhibitor, which contains dsRNA, and the single-stranded RNA sequence of the dsRNA is as shown in SEQ ID NO: 5.

[0009] In a third aspect, the present invention provides the application of the above inhibitor in the preparation of an antibacterial agent for Alternaria leaf blight of Chinese chives.

[0010] As an embodiment, the antibacterial agent is prepared by compounding dsRNA with nano-clay. The nano-clay is nano-kaolin, and the particle size of the nano-kaolin is within 100 nm. The antibacterial agent is a spraying preparation. Among them, the mass ratio of dsRNA to nano-clay is 1:1, and the final concentration of dsRNA is 100 ng / μL. The Alternaria leaf blight of Chinese chives caused by Alternaria is prevented and treated by spraying Chinese chives.

[0011] The beneficial effects of the present invention are as follows:

[0012] The present invention provides a dsRNA preparation targeting the Alternaria porri nucleoside diphosphate sugar isomerase gene and its application in the prevention and control of Alternaria leaf blight of Chinese chives. By interfering with the normal transcriptional expression of the NDEE gene of Alternaria by dsRNA, the mycelial growth and spore production rate of Alternaria can be affected, reducing the infectivity of Alternaria to Chinese chives. It can be used for the green prevention and control of Alternaria leaf blight of Chinese chives, reducing the environmental pollution of chemical agents; at the same time, using the dsRNA preparation to silence the key genes of pathogenic bacteria inhibits the growth of pathogenic bacteria, playing a role in preventing and treating diseases, with strong pertinence and good prevention and treatment effects.

[0013] The dsRNA compounded with nano-clay particles designed for the target of the nucleoside diphosphate sugar isomerase gene of Alternaria in the present invention is prepared into a spraying antibacterial agent, which can effectively inhibit the colony growth rate, spore production and spore germination rate of Alternaria, reducing the pathogenicity of Alternaria infecting Chinese chives, and achieving the effect of preventing and treating Alternaria leaf blight of Chinese chives. The target is accurate, the target pertinence is strong, the application operation is simple, and the prevention and treatment effect is good. The biological antibacterial agent is safe and effective and friendly to the environment. Description of the Drawings

[0014] Figure 1Effect of dsRNA treatment on the growth rate of Alternaria alternata

[0015] Figure 2 Bar chart of the effect of dsRNA treatment on the growth rate of Alternaria alternata

[0016] Figure 3 Effect of dsRNA on the sporulation amount and spore germination rate of Alternaria alternata

[0017] Figure 4 Degradation of dsRNA and nano-clay with different compounding ratios by RNase A. dsRNA preparation (1:1), dsRNA preparation (1:2), and dsRNA preparation (1:3) represent the mass ratios of dsRNA to nano-clay of 1:1, 1:2, and 1:3, respectively

[0018] Figure 5 Effect of spraying dsRNA preparation treatment on the pathogenicity of Alternaria alternata Detailed implementation manners

[0019] To make the objectives, technical solutions, and advantages of the present invention clearer, the technical solutions in the embodiments of the present invention will be clearly described below in conjunction with the accompanying drawings in the embodiments of the present invention. Obviously, the described embodiments are part of the embodiments of the present invention, rather than all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of the present invention

[0020] 1. Cloning of the nucleoside diphosphate sugar isomerase (NDEE) gene of Alternaria alternata on Chinese chives

[0021] First, according to the NDEE gene sequence (Genebank accession number: XM_018532966.1, the specific sequence is shown in SEQ ID NO: 1), with a full length of 1338 bp, primers for amplifying its CDS region were designed according to the coding region of the sequence (NDEE-F1: ATGCGTATTCTTATCACAGGGGCCG, NDEE-R1: TTACGCTGCTACTTCAACAGCATTC). Then, the RNA of Alternaria alternata was extracted using a fungal RNA extraction kit and reverse transcribed into cDNA. The specific method was referred to the instruction manual of the kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.)

[0022] Using the reverse-transcribed cDNA as a template, the CDS region of the NDEE gene was amplified with primers NDEE-F1 / R1. Among them, the PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 56°C for 60 s, 72°C for 45 s; 30 cycles; 72°C for 10 min. The target gene was detected by 1% agarose gel electrophoresis. According to the instructions of the gel extraction kit (purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.), the amplified target gene was gel-extracted to collect the DNA solution. According to the instructions of the Taraka pMD18-T kit (TaKaRa Biotechnology Co., Ltd., Dalian), the recovered DNA was ligated to the cloning vector pMD18-T. Then, the ligation system containing the pMD18-T-NDEE plasmid was transformed into Escherichia coli DH5α competent cells. Five positive clones were picked for plasmid recovery and then sequenced for verification. The sequence of the amplified CDS region of NDEE is shown in SEQ ID NO:2. The obtained CDS region sequence is 1035 bp, encoding a protein of 344 amino acids, and its protein sequence is shown in SEQ ID NO:3.

[0023] 2. Preparation of dsRNA template

[0024] Based on the conserved region characteristics of the NDEE gene sequence of Alternaria alternata, fully considering factors such as siRNA binding sites, fragment length, and off-target effects, a 400-bp sequence (shown in SEQ ID NO:4) was selected, and upstream and downstream primers were designed. T7 promoter sequences were added to both ends of the primers to obtain the primer pair T7_F 1 / T7_R 1. The sequences of the primer pair T7_F 1 / T7_R 1 are as follows:

[0025] T7_F 1: 5’-TAATACGACTCACTATAGGGACTTGTAGCGAAAAAGCTTCTCGAT-3’;

[0026] T7_R 1: 5’-TAATACGACTCACTATAGGGCATCTTCTCTGCACCATAACTCGTC-3’.

[0027] Using the pMD18-T-NDEE plasmid as a template, PCR amplification was carried out with the primer pair T7_F 1 / T7_R 1. The PCR reaction conditions were: 94°C for 3 min; 94°C for 30 s, 56°C for 30 s, 72°C for 45 s; 30 cycles; 72°C for 10 min. Then, the amplification product was purified to obtain the template for synthesizing dsRNA, and the sequence of the template for synthesizing dsRNA is shown in SEQ ID NO:4.

[0028] 3. In vitro transcription synthesis of dsRNA

[0029] The DNA template of the dsRNA obtained in the above "Preparation of dsRNA Template" was reverse transcribed using the T7RiboMAXTM Express RNAi System of Promega (USA). The specific operation was referred to the instruction manual. The single-stranded sequence of the dsRNA obtained by reverse transcription is shown in SEQ ID NO: 5. 1-2 μL of the reverse transcription product was taken for concentration measurement and agarose gel electrophoresis detection. The concentration of dsRNA was measured at 260 nm using a Nanodrop 2000 ultra-micro UV spectrophotometer (Thermo Fisher). The qualified samples were stored in a -80°C refrigerator for later use.

[0030] 4. Effects of dsRNA on the growth of Alternaria alternata colonies

[0031] The pathogenic fungus Alternaria alternata, which was isolated and identified from leeks with white spot disease in the laboratory earlier, was inoculated into PDB medium for activation culture and set aside for use.

[0032] Add the dsRNA solution to the PDA medium to prepare a PDA solid plate (calculate the specific amount of addition based on the initial concentration of the transcribed dsRNA, so that the final concentration of dsRNA in the medium is 1ng / μL, 10ng / μL and 100ng / μL respectively). Use the punching method to take a bacterial cake from the edge of the pre-cultured pathogen colony and transplant it to the center of the dsRNA culture dish for culture. The control group was treated with sterile water instead.

[0033] The colonies were incubated upside down in a 28°C incubator for 10 days, and the diameter of the colonies was measured by the cross method. Each experiment was repeated 3 times. The growth rate of the fungus was calculated using the following formula:

[0034] GR = TGLH / GD;

[0035] Where: GR is the fungal growth rate (mm·d -1 ), TGLH is the total length of mycelial growth (mm), and GD is the growth days (d).

[0036] like Figure 1 , Figure 2 As shown in the figure, the colony of the control group without dsRNA grew fastest, the hyphae grew densely, appeared grayish white, and the growth rate could reach 8.23±0.03mm·d -1 The colonies of Alternaria alternata treated with dsRNA were smaller than those of the control group, and their hyphae were shorter. Different concentrations of dsRNA had different inhibition rates on the growth of Alternaria alternata. When the dsRNA concentration changed from low to high (1 ng / μL, 10 ng / μL and 100 ng / μL), the colony growth rates were 7.52±0.05 mm·d -1 , 5.38±0.04mm·d-1 and 2.97±0.02mm·d -1 The results show that the dsRNA treatment of the present invention can significantly inhibit the colony and growth of Alternaria alternata. Among them, the dsRNA with a concentration of 100 ng / μL has the best inhibitory effect on Alternaria alternata.

[0037] 5. Determination of spore production and spore germination rate of Alternaria alternata

[0038] Under sterile conditions, 2 mL of sterile water was added to the surface of the Alternaria colonies in the control group and the experimental group cultured for 10 days in the above "Effect of dsRNA on Alternaria colony growth", and the mycelium on the surface of the colonies was repeatedly and gently scrubbed with a sterile cotton swab to make the spores fall off into the sterile water, and the collected suspension was filtered with a double layer of sterile gauze to filter the mycelium, and then the filtered spore wash was collected and readjusted to 2 mL with sterile water, and the spore suspension was obtained after sufficient vortex mixing. The number of spores was recorded using a hemocytometer to calculate the spore production, and each sample was counted effectively for no less than 3 times.

[0039] The dsRNA solution was added to a spore suspension containing 500 μL of normal culture and separation. The amount of addition was calculated based on the initial concentration of dsRNA obtained by transcription, so that the final concentration of dsRNA reached 1 ng / μL, 10 ng / μL and 100 ng / μL. The culture was carried out in the dark at 28°C for 24 hours, and the number of spores was counted using the concave slide method. Specifically, 10 μL of pathogen spore suspension was injected into a sterile concave slide, and the number of spores germinated in 100 spores was counted for each concave slide, with 3 replicates per group. Germination was recorded as a germ tube larger than the spore, and the spore germination rate was calculated as follows:

[0040] Spore germination rate = number of germinated spores / total number of spores × 100%.

[0041] like Figure 3 As shown, the spore production and spore germination rate of Alternaria alternata after dsRNA treatment were lower than those of the control group, and the spore production and spore germination rate of Alternaria alternata after high concentration 100ng / μL dsRNA treatment were most significantly reduced, indicating that the 100ng / μL dsRNA of the present invention can inhibit the spore production and germination of Alternaria alternata.

[0042] 6. Preparation of dsRNA

[0043] The commercially available nano-clay particles (kaolin, M / s EICL Pvt.Ltd, Thiruvananthapuram, Kerala, India, with a particle size within 100 nm) were used as carriers to compound the dsRNA preparation to improve the product stability and prevent degradation. DEPC H2O was used to prepare nano-clay particle mixtures with different concentrations (200 ng / μL, 400 ng / μL, and 600 ng / μL). After being treated with a magnetic stirrer overnight, they were respectively mixed with an equal volume of dsRNA solution with a concentration of 200 ng / μL to make the final concentration of the compounded dsRNA preparation 100 ng / μL, and the mass ratios of dsRNA to nano-clay were 1:1, 1:2, and 1:3 respectively. 10 μL of the dsRNA-nano-clay compound preparation was taken respectively, 1 μL of RNase A was added, and it was incubated at 37 °C for 20 minutes. The dsRNA was detected by agarose gel electrophoresis, and the brightness of the bands was measured using ImageJ. The dsRNA bands treated with RNase A were used as the control group. To calculate the normalized value, the gray value of the treatment group was divided by the gray value of the control group. Each treatment was repeated three times.

[0044] Figure 4 As shown, the control dsRNA (not bound to nano-clay) was rapidly degraded by RNase A. When dsRNA was bound to nano-clay, it protected dsRNA from degradation by RNase A, and there was no significant change in the band density of different nano-clay ratios. Therefore, the lowest compounding concentration could be selected. That is, the optimal compounding ratio was configured as dsRNA to nano-clay 1:1 (mass ratio), and the final concentration of dsRNA in the preparation was 100 ng / μL.

[0045] 7. Pathogenicity determination

[0046] Leeks with uniform growth were selected. After spraying the compound preparation of the above dsRNA and nano-clay material (the compounding ratio was dsRNA to nano-clay mass ratio 1:1, and the dsRNA concentration was 100 ng / μL) on the whole plant, it was cultured at room temperature of 25 °C for 3 d, with spraying sterile water as the control. The leaves at the same leaf position and of the same size were cut, the leek leaves were cut into 5 cm segments, several wounds were made on the leeks with a blade, and they were placed on the medium containing moist filter paper, inoculated with Alternaria solani cakes, and cultured at 26 °C and 85% relative humidity for 3 d, and then photographed and observed.

[0047] As Figure 5 shown, obvious lesions appeared on the leeks in the control group; the incidence on the surface of the leeks in the treatment group sprayed with the compound preparation of dsRNA and nano-clay material was weaker, indicating that the dsRNA of the present invention could inhibit the pathogenicity of Alternaria solani to leeks.

[0048] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions described in the foregoing embodiments, or perform equivalent replacements for some of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the spirit and scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of the nucleoside diphosphate sugar isomerase gene of Alternaria vulgaris in preventing and treating leek white spot disease, characterized in that: The control of leek white spot disease is achieved by inhibiting the expression of the nucleoside diphosphate sugar isomerase gene of Alternaria alternata, and the sequence of the nucleoside diphosphate sugar isomerase gene is shown in SEQ ID NO:

1.

2. The use according to claim 1, characterized in that: The RNAi method was used to inhibit the expression of the nucleoside diphosphate isomerase gene of Alternaria alternata.

3. The use according to claim 2, characterized in that: The single-stranded RNA sequence of dsRNA used for RNAi is shown as SEQ ID NO:

5.

4. An inhibitor of Alternaria alternata, characterized in that The inhibitor contains dsRNA, and the single-stranded RNA sequence of the dsRNA is shown in SEQ ID NO:

5.

5. Use of the inhibitor according to claim 4 in the preparation of an antibacterial agent for leek white spot disease.

6. The use according to claim 5, characterized in that: The antibacterial agent is prepared by compounding dsRNA and nano clay, and the nano clay is nano kaolin.

7. The use according to claim 6, characterized in that: The particle size of the nano kaolin is within 100 nm.

8. The use according to claim 6, characterized in that: The antibacterial agent is a sprayable preparation.

9. The use according to claim 6, characterized in that: The mass ratio of dsRNA to nanoclay was 1:

1.

10. The use according to claim 6, characterized in that: In the sprayable preparation, the final concentration of dsRNA is 100 ng / μL.

Images