Molecular marker for diagnosis, screening and risk prediction of early lung cancer
By using the missing SPATA18 gene as a molecular marker, the problem that the prior art cannot accurately judge the pathological type and transformation risk of early lung cancer is solved, and the accurate diagnosis and risk prediction of early lung adenocarcinoma is achieved, and the treatment success rate is improved.
Patent Information
- Application Number
- CN202311719495.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2023-12-14
- Publication Date
- 2025-06-17
AI Technical Summary
The prior art cannot accurately determine the pathological type and its transformation risk of early lung cancer lesions, especially in imaging examinations.
Provides a molecular marker for diagnosis, screening and risk prediction of early stage lung cancer, specifically the missing SPATA18 gene. Products for lung cancer diagnosis, including genetic testing kits and protein testing kits, are prepared by specifically binding to the substance of SPATA18.
The diagnosis, screening and risk prediction of early lung adenocarcinoma has been achieved, filling the gap in the risk and prognosis prediction of early non-invasive adenocarcinoma in clinical practice. It reduces the detection cost and is simple to operate, and can detect abnormalities at the molecular level in the early stages of cancer, improving the success rate of treatment.
Smart Images

Figure HDA0004607000010000011 
Figure HDA0004607000010000012 
Figure HDA0004607000010000021
Abstract
Description
Technical Field
[0001] The present invention relates to the field of gene detection, and particularly to a molecular marker for the diagnosis, screening and risk prediction of early lung cancer. Background Art
[0002] Lung cancer is the leading cause of cancer death globally (Bray, F., et al., Global cancer statistics 2018: GLOBOCAN estimates of incidence and mortality worldwide for 36 cancers in 185 countries. CA Cancer J Clin, 2018. 68(6): p. 394-424.). With the widespread application of low-dose computed tomography (LDCT) screening, the detection rate of early-stage lung adenocarcinoma has gradually increased (Aberle, D.R., et al., Reduced lung-cancer mortality with low-dose computed tomographic screening. N Engl J Med, 2011. 365(5): p. 395-409.; Church, T.R., et al., Results of initial low-dose computed tomographic screening for lung cancer. N Engl J Med, 2013. 368(21): p. 1980-91.; Zhang, Y., et al., Results of low-dose computed tomography as a regular health examination among Chinese hospital employees. J Thorac Cardiovasc Surg, 2020. 160(3): p. 824-831.e4.), and the number of cases of adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) has increased significantly. AIS is defined as a small, locally located adenocarcinoma (<= 3 cm) in which the growth of neoplastic cells is confined to the normal alveolar structure without invasion of the surrounding tissues.MIA is a small adenocarcinoma in a lepidic pattern (<= 3 cm) with a maximum invasive size of no more than 5 mm at any point (Travis, W.D., et al., International association for the study of lung cancer / american thoracic society / european respiratory society international multidisciplinary classification of lung adenocarcinoma. J Thorac Oncol, 2011. 6(2): p. 244-85.; Travis, W.D., et al., The 2015 World Health Organization Classification of Lung Tumors: Impact of Genetic, Clinical and Radiologic Advances Since the 2004 Classification. J Thorac Oncol, 2015. 10(9): p. 1243-1260.). Pathologically, lung adenocarcinoma is generally considered to progress gradually from AIS / MIA to invasive lesions (Noguchi, M., Stepwise progression of pulmonary adenocarcinoma--clinical and molecular implications. Cancer Metastasis Rev, 2010. 29(1): p. 15-21.). Both AIS and MIA are considered early non-invasive stages of lung adenocarcinoma, while invasive adenocarcinoma (IAC) represents the invasive stage.Accordingly, the five-year recurrence-free survival rate of AIS / MIA patients after surgical resection may be as high as 100% (Yotsukura, M., et al., Long-Term Prognosis of Patients With Resected Adenocarcinoma In Situ and Minimally Invasive Adenocarcinoma of the Lung. J Thorac Oncol, 2021. 16(8): p. 1312-1320.), while the survival rate of IAC patients will decrease significantly (Goldstraw, P., et al., The IASLC Lung Cancer Staging Project: Proposals for Revision of the TNM Stage Groupings in the Forthcoming (Eighth) Edition of the TNM Classification for Lung Cancer. J Thorac Oncol, 2016. 11(1): p. 39-51.).
[0003] Existing early diagnosis, prognosis, and prediction technologies for lung cancer mainly include miRNA, genomics, metabolomics, proteomics, etc. Among them, the reliability of the clinical application of miRNA is in doubt, and the detection has high requirements for operating procedures, sample collection, storage, and the selection of detection platforms (Raczkowska, J., et al., Extracellular circulating miRNAs as potential non-invasive biomarkers in non-small cell lung cancer patients. Front Oncol, 2023. 13: p. 1209299.). In terms of genomics, there is currently no prognostic model for early non-invasive adenocarcinoma of the lung. Due to the small diameter and limited tissue of early non-invasive lesions, there are still few studies on the exploration of related markers such as metabolome and proteome. Clinically, it is impossible to accurately judge the pathological type and its transformation risk of early lesions through imaging and other information. Therefore, marker screening is of great significance for the diagnosis and screening of early lung adenocarcinoma. Summary of the Invention
[0004] In view of the above-mentioned disadvantages of the prior art, the object of the present invention is to provide a molecular marker for the diagnosis, screening and risk prediction of early lung cancer, so as to solve the problem that existing imaging examinations such as computed tomography (CT scan) cannot accurately judge the pathological type of early lesions and their transformation risks.
[0005] To achieve the above object and other related objects,
[0006] The present invention provides a molecular marker for the diagnosis, screening and risk prediction of early lung cancer, and the molecular marker is the deleted SPATA18 gene.
[0007] Preferably, the nucleotide sequence of the SPATA18 gene is as shown in SEQ ID No.1.
[0008] The present invention also provides the use of a substance specifically binding to SPATA18 in the preparation of a lung cancer diagnostic product, and the nucleotide sequence of the SPATA18 is as shown in SEQ ID No.1.
[0009] Preferably, the substance specifically binding to SPATA18 is selected from one or more of antibodies, primers or probes.
[0010] The present invention also provides a lung cancer diagnostic product, and the lung cancer diagnostic product contains the substance specifically binding to SPATA18 as described above.
[0011] Preferably, the lung cancer diagnostic product is selected from any of the following products:
[0012] I) A product for predicting or assisting in predicting the prognosis and survival of lung cancer patients;
[0013] II) A product for predicting or assisting in predicting the risk of death of lung cancer patients;
[0014] III) A product for predicting or assisting in predicting the recurrence risk of lung cancer in lung cancer patients;
[0015] IV) A product for evaluating or assisting in evaluating the overall survival rate of lung cancer patients;
[0016] V) A product for screening or assisting in screening lung cancer patients with poor prognosis or lung cancer patients with good prognosis;
[0017] VI) A product for differentiating or assisting in differentiating lung cancer patients with poor prognosis or lung cancer patients with good prognosis.
[0018] As described above, a molecular marker for the diagnosis, screening and risk prediction of early lung cancer of the present invention has the following beneficial effects:
[0019] 1) The substance specifically binding to SPATA18 provided by the present invention can achieve the diagnosis, screening, and risk prediction of early-stage lung adenocarcinoma, filling the gap in the clinical risk and prognosis prediction of early-stage non-invasive adenocarcinoma;
[0020] 2) The scenarios applicable to the present invention are diverse. The samples that can be used include lung pathological tissues, bronchoalveolar lavage fluid, etc. The operation is simple and does not require any extra operations on the patients. The technology is simple and easy to operate, greatly reducing the detection cost and being easy to promote and apply;
[0021] 3) The substance specifically binding to SPATA18 provided by the present invention can detect molecular-level abnormalities at the early stage of cancer development, which may not be easily detected by imaging. Early detection and prediction help to provide earlier intervention and treatment opportunities, thus improving the treatment success rate;
[0022] 4) The number of targets in the present invention is relatively small. Theoretically, the stability after expanding the sample volume is higher than that of other multi-target detections, which can provide a more accurate cancer risk assessment. By analyzing specific gene mutations and protein expressions, the cancer progression probability of patients can be better predicted, which helps to formulate a more precise treatment plan. BRIEF DESCRIPTION OF THE DRAWINGS
[0023] Figure 1 It shows the result diagram of the influence of SPATA18 deletion mutation on the prognosis of lung cancer in the present invention.
[0024] Figure 2 It shows the staining result diagram of detecting the protein expression level of SPATA18 in pre-invasive and invasive lung cancers by the immunohistochemical method in the present invention.
[0025] Figure 3 It shows the statistical result diagram of immunohistochemical staining in the present invention.
[0026] Figure 4 It shows the result diagram of the association between the protein expression level of SPATA18 and the prediction of the overall death risk of early-stage lung adenocarcinoma in the present invention.
[0027] Figure 5 It shows the result diagram of the association between the protein expression level of SPATA18 and the prediction of the lung cancer recurrence risk of early-stage lung adenocarcinoma in the present invention.
[0028] Figure 6 It shows the receiver operating characteristic curve (ROC) of the protein expression level of SPATA18 predicting whether lung cancer patients will relapse after surgery in the present invention.
[0029] Figure 7 It shows the receiver operating characteristic curve (ROC) of the protein expression level of SPATA18 predicting whether lung cancer patients will die after surgery in the present invention. Detailed implementation manners
[0030] The present invention provides a molecular marker for the diagnosis, screening and risk prediction of early lung cancer, and the molecular marker is the deleted SPATA18 gene. Specifically, the molecular marker is the SPATA18 gene with a deletion mutation, a base substitution mutation, or an insertion mutation.
[0031] In the present invention, the "SPATA18" gene encodes a p53-induced protein and is located at NC_000004.12(52051304..52097299) on chromosome 4, and has 14 exons.
[0032] In some specific implementation manners, the nucleotide sequence of the SPATA18 gene is as shown in SEQ ID No.1.
[0033] The present invention provides the use of a substance that specifically binds to SPATA18 in the preparation of a lung cancer diagnostic product, and the nucleotide sequence of the SPATA18 is as shown in SEQ ID No.1.
[0034] In some specific implementation manners, the substance that specifically binds to SPATA18 can be a substance for detecting the deletion of the SPATA18 gene or a substance for detecting the concentration of the SPATA18 protein.
[0035] In some specific implementation manners, the substance that specifically binds to SPATA18 is selected from one or more of antibodies, primers or probes. Preferably, the substance that specifically binds to SPATA18 is a primer or an antibody.
[0036] In some specific implementation manners, the substance that specifically binds to SPATA18 contains a detectable label. Specifically, the detectable label is selected from one or more of radioactive isotopes, nucleotide chromophores, enzymes, substrates, fluorescent molecules, chemiluminescent molecules, magnetic particles or bioluminescent molecules. More specifically, the radioactive isotope can be selected from 3 H, 14 C, 35 S, 125 I or 131 I; or, the enzyme can be selected from horseradish peroxidase, β-galactosidase, luciferase, alkaline phosphatase, acetylcholinesterase; or, the fluorescent molecule can be selected from one or more of FITC, rhodamine, lanthanide phosphors.
[0037] In some specific implementation manners, the lung cancer is non-small cell lung cancer.
[0038] Furthermore, the non-small cell lung cancer is selected from lung adenocarcinoma or pneumonic type lung cancer.
[0039] Furthermore, the lung adenocarcinoma is selected from adenocarcinoma in situ (AIS), minimally invasive adenocarcinoma (MIA), invasive adenocarcinoma (IAC), lepidic predominant adenocarcinoma (LPA), mucinous adenocarcinoma in situ or invasive mucinous adenocarcinoma.
[0040] In some specific embodiments, the lung cancer diagnosis product can also be a lung cancer lesion stage diagnosis product. The diagnosis of the lung cancer lesion stage is for determining whether the lung cancer is in the early non-invasive stage or the late invasive stage.
[0041] In some specific embodiments, the lung cancer diagnosis product can also be a lung cancer prognosis diagnosis product.
[0042] Furthermore, the lung cancer prognosis product can be a product having any of the following functions:
[0043] 1) Predicting or assisting in predicting the survival of lung cancer patients;
[0044] 2) Predicting or assisting in predicting the death risk of lung cancer patients;
[0045] 3) Predicting or assisting in predicting the recurrence risk of lung cancer in lung cancer patients;
[0046] 4) Evaluating or assisting in evaluating the overall survival rate of lung cancer patients;
[0047] 5) Screening or assisting in screening lung cancer patients with poor prognosis or good prognosis;
[0048] 6) Distinguishing or assisting in distinguishing lung cancer patients with poor prognosis or good prognosis.
[0049] In some specific embodiments, poor prognosis means poor survival within 5 years, specifically recurrence or death of the lung cancer after prognosis; or, good prognosis means good survival within 5 years, specifically survival after prognosis.
[0050] The present invention also provides a lung cancer diagnosis product, which contains the substance specifically binding to SPATA18 as described above.
[0051] In some specific embodiments, the lung cancer diagnosis product is selected from any of the following products:
[0052] I) A product for predicting or assisting in predicting the survival of lung cancer patients;
[0053] II) A product for predicting or assisting in predicting the death risk of lung cancer patients;
[0054] III) A product for predicting or assisting in predicting the risk of lung cancer recurrence in lung cancer patients;
[0055] IV) A product for evaluating or assisting in evaluating the overall survival rate of the prognosis of lung cancer patients;
[0056] V) A product for screening or assisting in screening lung cancer patients with poor prognosis or good prognosis;
[0057] VI) A product for distinguishing or assisting in distinguishing lung cancer patients with poor prognosis or good prognosis.
[0058] In some specific embodiments, the lung cancer diagnostic product further comprises a pharmaceutically acceptable carrier, diluent or excipient.
[0059] In some specific embodiments, the lung cancer diagnostic product can be selected from one or more of a chip, a kit, a test strip or a nucleic acid membrane strip.
[0060] In some specific embodiments, the kit includes a gene detection kit and a protein detection kit. More specifically, the gene detection kit includes a reagent or a chip for detecting the transcription level of the SPATA181 gene; or, the protein detection kit includes a reagent or a chip for detecting the expression level of the SPATA18 protein.
[0061] The present invention also provides a diagnostic method or a prognostic diagnostic method for lung adenocarcinoma, and the diagnostic method or the prognostic diagnostic method comprises the following steps:
[0062] 1) Preparing a DNA sample or a pathological section sample;
[0063] 2) Using the substance specifically binding to SPATA18 to detect the nucleotide sequence, RNA expression level or protein expression level of SPATA18 in the DNA sample or the pathological section sample in step 1);
[0064] 3) Judging whether the patient has early-stage lung adenocarcinoma or late-stage lung adenocarcinoma, microinvasive lung adenocarcinoma or invasive lung adenocarcinoma, lung adenocarcinoma with good prognosis or poor prognosis according to the nucleotide sequence or protein expression level of SPATA18 in step 2).
[0065] In some specific embodiments, the DNA sample or the pathological section sample is derived from one or more of blood, bronchoalveolar lavage fluid or lung pathological tissue.
[0066] In the present invention, a "kit" refers to a set of components provided in the case of a system for sequencing nucleotides and / or isolating nucleotide sequences and / or diagnosing a subject suffering from a disease or infection based on the presence, absence and / or amount of expressed nucleotide sequences from a sample or cells.
[0067] In the present invention, the term "lung adenocarcinoma" generally refers to a common malignant tumor that originates from glandular epithelial cells in lung tissue. The early symptoms of this cancer may not be obvious, but as the tumor grows, patients may experience symptoms such as coughing, difficulty breathing, and chest pain. Advanced symptoms may include weight loss, anemia, and general fatigue. With the widespread application of low-dose computed tomography (LDCT) screening, the detection rate of early lung adenocarcinoma has gradually increased. Among them, the number of cases of adenocarcinoma in situ (AIS) and minimally invasive adenocarcinoma (MIA) has increased significantly. Among them, the term "adenocarcinoma in situ" is usually defined as a small adenocarcinoma located locally (<= 3 cm), in which the growth of newly formed tumor cells only follows the normal alveolar structure and does not invade surrounding tissues; the term "minimally invasive adenocarcinoma" is usually defined as a small adenocarcinoma in the form of flakes (<= 3 cm), in which the maximum invasion size at any point does not exceed 5 mm. Pathologically, lung adenocarcinoma is generally considered to gradually develop from AIS / MIA to an invasive lesion. Both AIS and MIA are defined as the early non-invasive stages of lung adenocarcinoma, while invasive adenocarcinoma (IAC) represents the invasive stage. Correspondingly, the five-year recurrence-free survival rate of patients with AIS / MIA after surgical resection may be as high as 100%, while the survival rate of IAC patients will decrease significantly.
[0068] In the present invention, the "SPATA18" gene encodes a p53-induced protein and is located at NC_000004.12(52051304..52097299) on chromosome 4. It has 14 exons.
[0069] In the present invention, the "SPATA18 protein" is usually a p53-induced protein. The SPATA18 protein can regulate the opening of the mitochondrial double membrane pore to mediate the translocation of lysosomal proteins from the cytoplasm to the mitochondrial matrix.
[0070] In the present invention, the term "gene deletion" refers to the phenomenon in which a part or all of the sequence of a certain gene is deleted in the genome. This deletion may be caused by various reasons, including genetic mutations, chromosomal abnormalities, or chromosomal damage. Gene deletion may involve the entire gene or a part of the gene, and its scale and location determine the impact on gene expression and function. The types of gene deletion include large fragment deletion, partial deletion, and point mutation deletion, depending on the scale and location of the deletion. In the present invention, "gene deletion", "gene DNA deletion", "nucleotide fragment deletion", "SPATA18 gene deletion", and "deletion in the SPATA18 gene" can be used interchangeably, all referring to the site deletion in the SPATA18 gene.
[0071] In the present invention, the term "probe" generally refers to a molecule that can bind to a specific sequence, subsequence, or other portion of another molecule. Unless otherwise indicated, a probe generally refers to a polynucleotide probe that can bind to another polynucleotide (often referred to as a target polynucleotide) through complementary base pairing. Depending on the stringency of the hybridization conditions, a probe can bind to a target polynucleotide that lacks complete sequence complementarity with the probe. Probes can be labeled directly or indirectly, and the scope includes primers. Hybridization methods include, but are not limited to: solution phase, solid phase, mixed phase, or in situ hybridization assays.
[0072] In the present invention, the term "primer" generally refers to a short nucleic acid sequence that, as a nucleic acid sequence with a short free 3'-terminal hydroxyl group (free 3'-hydroxyl group), can form base pairs with a complementary template and serve as a starting point for replicating the template.
[0073] In the present invention, the term "prognosis" generally refers to the expectation regarding the development of a disease (e.g., the likelihood of long-term survival, disease-free survival rate, etc.), including a positive prognosis or a negative prognosis. The negative prognosis includes disease progression such as recurrence, lung cancer growth, metastasis, and drug-resistant mortality, and the positive prognosis includes disease remission such as a disease-free state, disease improvement such as regression or stabilization of lung cancer.
[0074] The following specific examples illustrate the embodiments of the present invention. Those skilled in the art can easily understand other advantages and effects of the present invention from the content disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and various details in this specification can also be modified or changed based on different viewpoints and applications without departing from the spirit of the present invention.
[0075] Before further describing the specific embodiments of the present invention, it should be understood that the protection scope of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the embodiments of the present invention are used to describe specific embodiments, rather than to limit the protection scope of the present invention; in the specification and claims of the present invention, unless otherwise clearly indicated in the text, the singular forms "a", "an", and "the" include the plural forms.
[0076] When an embodiment gives a numerical range, it should be understood that unless otherwise specified in the present invention, any value at both ends of each numerical range and any value between the two ends can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the art of this technology. In addition to the specific methods, devices, and materials used in the embodiments, according to the knowledge of those skilled in the art of this technology and the description of the present invention, any methods, devices, and materials of the prior art similar to or equivalent to those described in the embodiments of the present invention can also be used to implement the present invention.
[0077] The nucleotide sequence information used in the present invention is as follows:
[0078] SEQ ID No.1:
[0079] agtccacccc tggggcgcgc ggctgtcacc cagggcgggg cggcgcgggcgttgccacgacgcgggccgc gcgcgtccct ggcagccaac ccgtccacgt caaggtttgtttaataatcgccagggtatc tatggccggg ctcaggcggc tgctggggag ccaggagaccgcgcgggacggcggatgagg cgcggcggct gcggcccagg gcacctcccc tctggcttcccgaacccggccaggtccgac ccgaggggga ggatggaaac acctgccgcg ctctgagccccccagaagagaacacccttc ccgccatatc accccacggt cctgcggagg ccaccgcctggtccccccaagtctccatcg cgcagcgtgg ggccgagagg aatagtgagc gatggcggaaaacctgaaaagactggtctc aaacgaaact ttacgaacgt tgcaggaaaa gctagacttctggctgaaggagtacaacac aaacacgtgt gatcaaaatc taaaccattg ccttgaactcattgagcaagttgccaaggt gcagggacaa ctctttggga tcctcacagc agcagcccaagaaggaggacgtaatgatgg tgtggaaaca atcaagtcac gccttttgcc ttggctggaggcttcctttactgctgcttc cctgggaaaa tctgttgaca gcaaggtccc ctctctgcaggacacgtttgatagggagag acataaagat cccagtcctc gggatcggga tatgcaacagttagactctaatttgaactc aacccggagt caatgcaacc aggttcaaga cgagcttaaatctcttcaagctcaggagga tgcccgccac agaaacacag atcagaggag ctcagagaataggcggtcagagccttggag cttggaggag cggaagcgtgagcagtggaa ctcactcaagcagaatgcagaccagcagga cacagaagcc atgtccgatt ataagaaaca gctccgaaacctgaaggaggagatagctgt tctgtctgct gagaaaagtg cactccaagg aaggtcctccaggagccggtctcccagccc tgcccctcgc agccgtagct gcagccgcag cagatctgccagcccctccaccgctgtcaa ggtcaggaga ccgtccccaa accgctccaa gctgtccaatgtggcgcgcaaggctgccct cttgtcccgg ttcagcgatt cctattccca ggcccgcctggacgcgcagtgcctgctgcg gcgctgcatc gacaaggctg agaccgttca gcggatcatctacatcgccacagtggaggc attccatgta gcaaaaatgg cattcagaca cttcaagatccatgtgagaaaatcgttgac accatcttat gtggggtcga atgactttga gaatgctgtcttggattatgtcatttgtca tcttgatcta tatgattctc aaagcagtgt caatgatgtgatccgagccatgaatgtcaa tcccaagatt tcattccctc ctgtcgttga cttttgccttctcagtgacttcatccagga gatatgttgc attgcctttg caatgcaggc cttagaaccacccctagatattgcatatgg agcagatgga gaagttttta atgattgcaa ataccgccgcagctacgactcggatttcac tgctccctta gtcctctatc acgtgtggcc tgctctcatggagaatgactgtgtcattat gaagggagaa gctgtcacca ggagaggggc tttttggaattcggtgcgatctgtaagtcg ttgtcgaagc aggagtttaa gtcccatttgcccccgtagccaaattggtttaaacacgat gtctcgaagt cggagtcctt ctccaataag atgtggattgccaagattttaaaagcacca gacctgctcc tttgacccag tgcgtggaaa cagctgctttctccagtgccgccatctgtc ttctgtgtct gcctcagacc tcacttaaga taatgtcaaaaggcaattctgtgtatcacc ccacacagag agttaaatgt tttggcttgg cgcatttgtaactttagatatattgcattc tattttattt tatagatact aattccatta atttcataaaaatgattgtataggcattta ggatcatatt cattcgaagc aaagtccgtt acaaaggttcaagatttccatctcaaaaca ctacgctctt ttatgggaac tgtgtgaact gaagtggaaagcatctaccatgctgaggct aaaagaaaag atgaatcatt ttagtttgca gatggatcgtaaatataattgttggtatca gctttagctc aaaaccaata ttaggtgttt taatttccttttaaggtttggaagacagcc ctaatctcag gttggggagc tcatgttagt agcagtgacttaaggctaagtgtagaagat aatttaagat acattttctt tatatattag ccaacaaattatatttattggttggcttgc ttttccgttc tgattttgag agtgcccagt ttggtttagttgaccaatgaatgtcaaagc tacttagttg agagaatttc cttgttcata aatgtagagcagtgatttgattagaagcca gctttgagat aaatgttaat tacctcatgc atatctcctgggaatatttcaaactgtttt aatgcatgtg ttatatataa aagtttcttg ggacatgctcttcacctgttctacctagttatttgcaaat tcagacctcc tattgaactc tgtctgaccaaaactacttaaactcaaggc ccaaaactag gggcaccatt tactgatttt aaattgagtatatatcccttgacttcttca ctgtcaaata cttttgaaac ttcacgttca agataagaatggaatgttgctttcttgcaa taagtaatgt tctttctgcc tttttttcac ttttaagtcagccttaaacacatgcctcac aaacatctac tttctccaca tacctttgag agagacactgaattggcctcagctcagttt tgcataagct tagtgccaga accagcacct gatgcttttcaggtgaaaataaaacaaaca gcttctctaa agcatcttac ccctgtgctg gaggtttgagggacctcttcagtgcctgcc ccttgagtct aatggtcacc acctcattct gaagtatgagttgaattttttgccctcttt gcatatttac attagtcatc actttgaagc aatgcagtgtgctggaaggagcactatctg cctaggtaac tgctagtcat gacttggtca tcagcttgctttgtggcactgagcaagtta cttcacttct ctgagccttg gttttatcat agggtgaggaggttggatacaattagtgcc cctcttaacc ctgcagactc aatgttccct tttataacaagtattttattctgaatatga aatgaaaatt aaagttaata taatcatcta tgtgcatgtataattttaagcagtgaacat agtaccctaa ctataatata aagcagaaaa aaaggcaacttttaataaaataaaatgtat ttcaataaaa aagcttgggt ataaccaccc tagaagataaaattaagtcattagatggct gaacctgcat gtagagccac cagctacaaatgaaaatcaatgtgtgtattggcaacagaa aatcacggtg ttgtcattgg atgtgacttt ctgaagtggtgggcaattcttgttaatgtt ttaaacaaaa aaaaaaaaac cttacagtct tgccctgatttacacagcagtcacattcct ggaaaattca agtgtttatt aaaactatgc aacagttactgtgtgttatacgttgaaagg tcttcactaa tatctcacta agtaatgaga atgcctacatatcagaattttttttttcag gagccaagca catatactga tttggaaaaa ggcacaggtagctcagtttatttgctttct accctgcctg gccacttgct gtttcttcag tttctaatttgagctgtaactacacaagga aagctaaata gtctggaaaa tttttggaaa gaatccacaaagccaaaggagactggccta tactcatttt atctggggat gtaccttacc cttagagactttgaaaaatgtgaagctctt attttgtaac ctgggtaaat gttagtttct agattttcggcttaacatctaataataaca tttaaaaagt gcttttgtaa ctattagtta tttgcaataaaatgctttccttctacagtc ccaa
[0080] Example 1: Influence of SPATA18 Gene Deletion at DNA Level on Prognosis
[0081] 1. DNA Extraction and Purification
[0082] 1.1 Tissue Processing
[0083] 1.1.1 Take a tissue block of 0.3 - 0.5 cm 3 Cut it into small pieces, add 0.5 mL of TE, and transfer it to a homogenizer for homogenization.
[0084] 1.1.2 Transfer the homogenate to a 1.5 mL centrifuge tube.
[0085] 1.1.3 Add 25 μL of 20% SDS and 25 μL of proteinase K (2 mg / mL), and mix well.
[0086] 1.1.4 Incubate in a 60 °C water bath for 1 - 3 hours.
[0087] 1.2 DNA extraction
[0088] 1.2.1 Add an equal volume of saturated phenol to the above sample treatment solution, mix gently and thoroughly for 3 minutes.
[0089] 1.2.2 Centrifuge at 5000 g for 10 minutes, transfer the upper aqueous phase to another 1.5 mL centrifuge tube.
[0090] 1.2.3 Add an equal volume of saturated phenol, mix well, centrifuge at 5000 g for 10 minutes, transfer the upper aqueous phase to another tube.
[0091] 1.2.4 Add an equal volume of phenol / chloroform, mix gently, centrifuge at 5000 g for 10 minutes, transfer the upper aqueous phase to another tube. If the aqueous phase is still not clear, this step can be repeated several times.
[0092] 1.2.5 Add an equal volume of chloroform, mix gently, centrifuge at 5000 g for 10 minutes, transfer the upper aqueous phase to another tube.
[0093] 1.2.6 Add 1 / 10 volume of 3M sodium acetate (pH 5.2) and 2.5 volumes of absolute ethanol, invert gently to mix.
[0094] 1.2.7 After floccules appear, centrifuge at 5000 g for 5 minutes, discard the supernatant.
[0095] 1.2.8 Wash the precipitate with 75% ethanol, centrifuge at 5000 g for 3 minutes, discard the supernatant.
[0096] 1.2.9 Volatilize the ethanol at room temperature, add 50 - 100 μL of TE to dissolve overnight after the precipitate is nearly transparent.
[0097] 2. Use next-generation sequencing to detect the deletion of the SPATA18 gene in the tumor cells of lung adenocarcinoma patients and track the subsequent survival status of lung adenocarcinoma patients:
[0098] According to the results obtained from the above experimental procedures, as Figure 1 shown, the deletion of the SPATA18 gene is associated with a worse prognosis, and the deletion of the SPATA18 gene implies a poor prognosis.
[0099] Example 2 Detection of the expression level of SPATA18 protein in pre-invasive and invasive lung cancers and the effect of SPATA18 protein level on prognosis
[0100] The detection method of the SPATA18 protein molecule includes the following steps:
[0101] 1. Fixation, dehydration, and embedding
[0102] 1.1 Take the tissue and place it in 4% paraformaldehyde for fixation for 3 - 4 hours, and adjust the time appropriately according to the size of the specimen.
[0103] 1.1.1 Take an appropriate size of tissue and place it in an embedding cassette for dehydration. Add successively:
[0104] 75% alcohol for 1.5 hours, 95% alcohol for 1.5 hours, 95% alcohol for 1 hour, absolute ethanol for 1.5 hours, absolute ethanol for 1 hour, xylene No.1 for 0.5 hour, xylene No.2 for 0.5 hour.
[0105] 1.2 Turn on the embedding machine, and start the cold stage, cold point, paraffin tank, and tissue tank respectively to work. Then use an iron lunch box to hold the paraffin block and put it into the tissue tank of the embedding machine to heat and dissolve. Put the dehydrated tissue together with the embedding cassette into the machine tissue tank in turn, and then put it into paraffin lunch box No.1 for the second infiltration with paraffin, and then paraffin lunch box No.2 for three times of infiltration with paraffin.
[0106] 1.3 Select a mold with a suitable size, first adjust the dripping speed of the paraffin of the machine, and it should not be too fast to prevent air bubbles. Then drip liquid paraffin into the mold, then take out the infiltrated embedding cassette from lunch box No.2, open it and use forceps to take out the tissue and put it into the mold. Then cover the mold with the other half of the embedding cassette, drip a little paraffin and put it on the cold stage to cool. Continue to embed the next paraffin block according to the above steps.
[0107] 2. Sectioning and slide making
[0108] 2.1 Turn on the microtome, fix the paraffin block (it can be pre-cooled in a 4℃ refrigerator in advance), and adjust the distance between the blade and the paraffin block. Then adjust the section thickness, first cut roughly, switch the thickness after seeing a complete paraffin section and there is tissue, and adjust to the thickness you want to cut. Apply force evenly, shake the microtome with the right hand, and pick up the sections with a brush in the left hand. If the sections are in a curled shape, you can press the edge of the paraffin section with a brush and then cut slowly, so that relatively flat sections can be obtained.
[0109] 2.2 Use a brush and forceps to lift the sections or ribbon sections and put them into a water bath for flattening, and the water temperature is about 40℃. Then gently pick them up with an adhesive-coated glass slide, and try not to touch the bottom of the water bath with the edge of the glass slide to prevent air bubbles at the bottom from floating up and remaining on the sections. Then mark the section number and put it on a slide warmer for baking for 30 minutes.
[0110] 3. Histochemical staining
[0111] 3.1 Dewaxing and Hydration at Room Temperature: Xylene No. 1 for 10 min, Xylene No. 2 for 8 min, Xylene No. 3 for 8 min, Absolute Ethanol for 5 min, 90% Ethanol for 3 min, 80% Ethanol for 3 min, 70% Ethanol for 3 min. Distilled Water for 3 min × 3 times, PBS for 3 min × 3 times.
[0112] 3.2 Heat Antigen Retrieval. Replace the slicing rack with a new one and place the hydrated sections in it. Prepare the antigen retrieval solution (dissolve one packet of sodium citrate powder in 2 L of PBS solution), heat it to boiling in an iron lunch box or a pot. Control the temperature at 96 - 98°C. Then place the sections in the hot pot for 15 min and finally let it cool naturally to room temperature. PBS for 5 min × 2 times, Distilled Water for 3 min × 2 times.
[0113] 3.3 Immunohistochemistry Pen Circling: Take out the tissue, drain the water, and the water droplets can be blotted dry with absorbent paper. Use a histochemistry pen to circle the tissue, making the circle complete.
[0114] 3.4 Inactivate Endogenous Enzyme Activity: Place the sections in a wet box, add a small amount of distilled water to the box, add 3% hydrogen peroxide (one drop or 50 μL from Kit A of the secondary antibody, the dosage details can be found in the secondary antibody instruction manual), incubate at room temperature for 10 min. PBS for 3 min × 3 times, wash with distilled water for 3 min.
[0115] 3.5 Block Nonspecific Sites: Drain the water, blot dry the water droplets, add goat serum blocking solution (50 μL), place it in a wet box, and incubate at room temperature for 10 min.
[0116] 3.6 Discard the blocking solution, add SPATA18 primary antibody (Signalway Antibody #43147) to cover the tissue, and then place it in a wet box and incubate overnight at 4°C. (The concentration of the primary antibody can be found in the antibody instruction manual. Dilute it in advance and aliquot, and store it in a -20°C refrigerator. The dosage of the primary antibody for each section varies depending on the tissue area size. For lung cancer tissue, about 20 μL per section.)
[0117] 3.7 The next day, take out the wet box from the 4°C refrigerator, let it warm up to room temperature for 30 min, PBS for 3 min × 3 times, wash with distilled water for 3 min.
[0118] 3.8 Drain the water, blot dry the water droplets, add one drop or 50 μL of secondary antibody (Kit C of the secondary antibody), incubate at room temperature for 10 min. PBS for 3 min × 3 times, wash with distilled water for 3 min.
[0119] 3.9 Add one drop or 50 μL of streptavidin - peroxidase solution (Kit D of the secondary antibody) to each slide, incubate at room temperature for 10 min, PBS for 3 min × 3 times, wash with distilled water for 3 min.
[0120] 3.10 Add two drops or 100 μL of DAB solution to each slide, and observe under a microscope for 3 - 10 min. Stop staining when the staining is appropriate, and rinse with tap water.
[0121] 3.11 Counterstain with hematoxylin for 1 - 2 min. Stop when the cell nuclei turn blue, and rinse with tap water or PBS to blue (0.5% ammonia water can be used for bluing).
[0122] 3.12 Differentiate with 1% hydrochloric acid alcohol for 3 s, and rinse with tap water for 3 min.
[0123] 4. Dehydration
[0124] 4.1 Dehydration steps: 70% alcohol for 1 min, 80% alcohol for 1 min, 95% alcohol for 2 min, absolute ethanol for 4 min, xylene No. 1 for 3 min, xylene No. 2 for 3 min.
[0125] 4.2 After air-drying the sections, add an appropriate amount of neutral balsam to cover the cover glass, being careful of air bubbles. Air-dry for half a day.
[0126] 5. Read the obtained pathological sections to judge the protein molecular expression level of SPATA18.
[0127] According to the results obtained from the above experimental process, as Figure 2 shown, Figure 2 are representative pictures of immunohistochemical staining of SPATA18 in pre-invasive and invasive lung cancers; Figure 3 For Figure 2 the statistical results of SPATA18 protein expression, which indicate that the SPATA18 protein expression level in invasive lung cancer is significantly lower than that before invasion.
[0128] The results of the expression of SPATA18 protein in pathological sections of lung adenocarcinoma patients and the follow-up survival status of lung adenocarcinoma patients are as follows, Figure 4 indicating an association between the SPATA18 protein expression level and the prediction of the overall death risk of early lung adenocarcinoma, and a decrease in the SPATA18 protein expression level means a decrease in the survival probability and an increase in the overall death risk; Figure 5 indicating an association between the SPATA18 protein expression level and the prediction of the lung cancer recurrence risk of early lung adenocarcinoma, and a decrease in the SPATA18 protein expression level means a decrease in the survival probability and an increase in the lung adenocarcinoma recurrence risk.
[0129] The relationship between the SPATA18 protein expression level of lung adenocarcinoma patients and the recurrence and survival of patients is as follows, Figure 6 indicating that the expression level of SPATA18 can predict the recurrence of lung cancer patients after surgery, and its accuracy rate (AUC) reaches 0.709. Figure 7It is shown that the expression level of SPATA18 can predict the survival of lung cancer patients after surgery, with an accuracy rate (AUC) of 0.650.
[0130] The above embodiments are intended to illustrate the embodiments disclosed in the present invention and should not be construed as limiting the present invention. In addition, various modifications listed herein and changes in the methods of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in connection with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, all obvious modifications to those skilled in the art as described above to obtain the invention should be included within the scope of the present invention.
Claims
1. A molecular marker for the diagnosis, screening and risk prediction of early-stage lung cancer, characterized in that, The molecular marker is the SPATA18 gene.
2. The molecular marker according to claim 1, characterized in that, The nucleotide sequence of the SPATA18 gene is as shown in SEQ ID No.
1.
3. Use of a substance that specifically binds to SPATA18 in the preparation of a lung cancer diagnostic product, wherein the nucleotide sequence of SPATA18 is as shown in SEQ ID No.
1.
4. The use according to claim 3, characterized in that, The substance specifically binding to SPATA18 is selected from one or more of an antibody, a primer or a probe.
5. The use according to claim 4, characterized in that, The substance specifically binding to SPATA18 is a primer or an antibody.
6. The use according to claim 3, characterized in that, The lung cancer is non-small cell lung cancer; preferably, the non-small cell lung cancer is selected from lung adenocarcinoma or pneumonia-type lung cancer; more preferably, the lung adenocarcinoma is selected from adenocarcinoma in situ, minimally invasive adenocarcinoma, invasive adenocarcinoma, adenocarcinoma mainly with lepidic growth, mucinous adenocarcinoma in situ or invasive mucinous adenocarcinoma.
7. The use according to claim 3, characterized in that, The lung cancer diagnostic product is selected from one or more of a lung cancer lesion stage diagnostic product or a lung cancer prognosis diagnostic product.
8. The use according to claim 7, characterized in that, The lung cancer prognosis product can be a product having any of the following functions: 1) Predicting or assisting in predicting the survival of lung cancer patients; 2) Predicting or assisting in predicting the death risk of lung cancer patients; 3) Predicting or assisting in predicting the lung cancer recurrence risk of lung cancer patients; 4) Evaluating or assisting in evaluating the overall survival rate of lung cancer patients; 5) Screening or assisting in screening lung cancer patients with poor prognosis or good prognosis; 6) Distinguishing or assisting in distinguishing lung cancer patients with poor prognosis or good prognosis.
9. A lung cancer diagnostic product, characterized in that, The lung cancer diagnostic product contains the substance specifically binding to SPATA18 in any of the uses described in claims 3-8.
10. The lung cancer diagnostic product according to claim 9, characterized in that, The lung cancer diagnostic product is selected from any of the following products: I) A product for predicting or assisting in predicting the survival of lung cancer patients; II) A product for predicting or assisting in predicting the death risk of lung cancer patients; III) A product for predicting or assisting in predicting the lung cancer recurrence risk of lung cancer patients; IV) A product for evaluating or assisting in evaluating the overall survival rate of lung cancer patients; V) A product for screening or assisting in screening lung cancer patients with poor prognosis or good prognosis; VI) A product for distinguishing or assisting in distinguishing lung cancer patients with poor prognosis or good prognosis.
11. The lung cancer diagnostic product according to claim 10, characterized in that, The lung cancer diagnostic product is selected from one or more of a chip, a kit, a test strip or a nucleic acid membrane strip.