A primer combination and method for identifying coreius guichenoti and coreius heterolomus and their hybrid offspring

By using a PCR amplification method with specific primer combinations and internal reference primers, the problem of identifying *Rhizoctonia solani* and *Copperfish* and their hybrid offspring was solved, achieving rapid and accurate identification and protecting the habitat of wild *Rhizoctonia solani*.

CN120158517BActive Publication Date: 2026-02-03CHINESE STURGEON RES INST OF CTG
View PDF 2 Cites 0 Cited by

Patent Information

Application Number
CN202510403072.9
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2025-04-01
Publication Date
2026-02-03
Estimated Expiration
2045-04-01

AI Technical Summary

Technical Problem

Existing technologies make it difficult to accurately distinguish between the round-mouthed copperfish and the copperfish and their hybrid offspring, leading to the destruction of the wild round-mouthed copperfish's habitat.

Method used

Using specific primer sets (round 10-2 and copper 10-2 primer sets) and internal control primers, the round-mouthed copper fish and copper fish and their hybrid offspring were identified by PCR amplification and electrophoresis or sequencing analysis. The internal control primers were used to calibrate and standardize the PCR reaction.

Benefits of technology

This method enables rapid and accurate identification of the round-mouthed copperfish and copperfish and their hybrid offspring, thus protecting the habitat of wild round-mouthed copperfish.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120158517B_ABST
    Figure CN120158517B_ABST
Patent Text Reader

Abstract

The present application relates to the technical field of molecular marker, and particularly relates to a primer combination, a kit and a method for identifying Coreius guichenoti and Coreius heterodon and their hybrid offspring. The primer combination comprises a Coreius guichenoti 10-2 primer combination and a Coreius heterodon 10-2 primer combination. The sequence of the forward primer 10-2F in the Coreius guichenoti 10-2 primer combination is 5'-ACAAGATTATAAGCACATGT-3', and the sequence of the reverse primer 10-2R is 5'-TGATTCTCCAGACGCA-3'. The sequence of the forward primer 10-2F in the Coreius heterodon 10-2 primer combination is 5'-TGATTCTCCAGACGCA-3', and the sequence of the reverse primer 10-2R is 5'-AGATTGAGCCTCATTGTG-3'. The primer combination can be used for rapid, efficient and accurate identification of Coreius guichenoti and Coreius heterodon and their hybrid offspring.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of fish identification technology, specifically to a primer combination and method for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring. Background Technology

[0002] The round-mouthed copper fish (scientific name: *Coreius guichenoti*) is a precious fish endemic to the upper reaches of the Yangtze River in China. It typically measures 30-60 cm in length and weighs 1-5 kg. It has an elongated, laterally compressed body, a broad, rounded snout, and an inferior mouth. Its back is bronze-colored, and its belly is white. It prefers to inhabit deep pools with strong currents and rocky reefs. It is omnivorous, feeding on aquatic insects, mollusks, and plant debris. The spawning season for the round-mouthed copper fish is from late April to early July, producing drifting eggs. In recent years, research institutions have been working to restore its natural population through artificial propagation and release techniques.

[0003] The copper fish (scientific name: *Coreius heterodon*) belongs to the order Cypriniformes, family Cyprinidae, and is mainly distributed in the Yangtze and Yellow River systems of China. The copper fish has a long and stout body, cylindrical in the front and slightly laterally compressed in the rear. It has a high caudal peduncle, a relatively small, nearly conical head with a pointed snout, a small, inferior mouth, very small eyes, large nostrils, and is covered with cycloid scales. Its dorsal fin is short and spineless, its pectoral fins are broad, its pelvic fins are slightly rounded, its anal fin is positioned forward, and its caudal fin is broad with a shallow fork. The copper fish is omnivorous, primarily feeding on benthic organisms such as freshwater shellfish, clams, snails, and mollusks. It also consumes fragments of higher plants, diatoms, aquatic insects, shrimp, and juvenile fish. It reaches sexual maturity at 2-3 years of age, with a reproductive period from April to June. The peak spawning period is from late April to mid-May. It is a single-spawning species, laying floating eggs in flowing water.

[0004] The round-mouthed copperfish and the copperfish are similar in size, making it difficult to distinguish between the two species in their juvenile stage. Hybrids of the two species are even more difficult to differentiate from the two original species. Some aquaculture farms use hybrids of these two species or copperfish to impersonate round-mouthed copperfish for breeding and release, causing serious damage to the wild habitat of the round-mouthed copperfish. Therefore, there is an urgent need to develop accurate and rapid identification methods for the round-mouthed copperfish, copperfish, and their hybrid offspring. Summary of the Invention

[0005] The primer combinations, kits, and methods provided by this invention for identifying the round-mouthed copper fish and copper fish and their hybrid offspring can quickly and accurately identify the round-mouthed copper fish and copper fish and their hybrid offspring.

[0006] One objective of this invention is to protect a primer set for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring. The primer set includes a round 10-2 primer set and a copper 10-2 primer set. In the round 10-2 primer set, the sequence of the forward primer 10-2F is 5'-ACAAGATTATAAGCACATGT-3', and the sequence of the reverse primer 10-2R is 5'-TGATTCTCCAGACGCA-3'. In the copper 10-2 primer set, the sequence of the forward primer 10-2F is 5'-TGATTCTCCAGACGCA-3', and the sequence of the reverse primer 10-2R is 5'-AGATTGAGCCTCATTGTG-3'.

[0007] The primer combinations described above for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring also include internal reference primers.

[0008] Based on the primer combination described above for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, the sequence of the forward primer in the internal reference primer is 5'-GACCCATCACAAGAGTTCA-3', and the sequence of the reverse primer is 5'-GCAGGCAGTCCTACAAT-3'.

[0009] The second objective of this invention is to provide a kit for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring. The kit includes reagent A and reagent B. Reagent A includes the above-mentioned round 10-2 primer set, and reagent B includes the above-mentioned copper 10-2 primer set.

[0010] The kit described above for identifying the roundmouth copperfish and the copper fish and their hybrid offspring includes reagent A, which comprises reagent A1 and reagent A2. Reagent A1 includes the forward primer 10-2F from the above-mentioned 10-2 primer set, and reagent A2 includes the reverse primer 10-2R from the above-mentioned 10-2 primer set.

[0011] The kit described above for identifying the roundmouth copper fish and the copper fish and their hybrid offspring includes reagent B, which comprises reagent B1 and reagent B2. Reagent B1 includes the forward primer 10-2F from the copper 10-2 primer set described above, and reagent B2 includes the reverse primer 10-2R from the copper 10-2 primer set described above.

[0012] The kit described above for identifying the roundmouth copperfish and copper fish and their hybrid offspring also includes reagent C, which includes the aforementioned internal reference primer.

[0013] The kit described above for identifying the roundmouth copper fish and the copper fish and their hybrid offspring includes reagent C, which comprises reagent C1 and reagent C2. Reagent C1 includes the forward primer of the aforementioned internal reference primer, and reagent C2 includes the reverse primer of the aforementioned internal reference primer.

[0014] The third objective of this invention is to provide a method for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring, comprising the following steps: (1) extracting total genomic DNA from the target fish sample; (2) using the total DNA as a template, performing PCR amplification and detection using the primer combination or the kit described above; and (3) determining the result based on the electrophoresis detection.

[0015] If the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set does not amplify any PCR product, then the target fish is *Cyprinus circinus*. If the round 10⁻² primer set does not amplify any PCR product, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is *Cyprinus circinus*. If the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is a hybrid of *Cyprinus circinus* and *Cyprinus circinus*.

[0016] Based on the method described above for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, the PCR amplification system is as follows: 10×PCR Buffer 3μL, 2.5mmol / L dNTP 2μL, MgCl2 3μL, forward primer and reaction primer 1μL each, Taq enzyme 0.5μL, DNA template 2μL, and ultrapure water 12.5μL.

[0017] Based on the method described above for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, the PCR reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min.

[0018] The method for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring provided by this invention is simple to operate and highly accurate. Attached Figure Description

[0019] Figure 1 This is an electrophoresis diagram showing the amplification results of the internal control primers and the 10-2 primer set in Example 2 in 6 round-mouthed copper fish and 6 copper fish samples;

[0020] Figure 2 The image shows the electrophoresis results of the copper 10-2 primer set amplified in 6 round-mouthed copper fish and 6 copper fish samples in Example 2. Detailed Implementation

[0021] To make the objectives, technical solutions, and advantages of this invention clearer, the technical solutions in the embodiments of this invention will be clearly and completely described below in conjunction with the embodiments of this invention. Obviously, the described embodiments are only some embodiments of this invention, not all embodiments. Based on the embodiments of this invention, all other embodiments obtained by those skilled in the art without creative effort are within the scope of protection of this invention.

[0022] This invention provides a primer combination for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring. The primers in this primer combination are nuclear gene primers. These primers are selected to recognize and amplify specific regions in nuclear genes, specifically including a round 10⁻² primer set and a copper 10⁻² primer set. Specifically, the sequence of the forward primer 10⁻²F in the round 10⁻² primer set is 5'-ACAAGATTATAAGCACATGT-3' (SEQ ID NO.1), and the sequence of the reverse primer 10⁻²R is 5'-TGATTCTCCAGACGCA-3' (SEQ ID NO.2). Similarly, the sequence of the forward primer 10⁻²F in the copper 10⁻² primer set is 5'-TGATTCTCCAGACGCA-3' (SEQ ID NO.3), and the sequence of the reverse primer 10⁻²R is 5'-AGATTGAGCCTCATTGTG-3' (SEQ ID NO.4).

[0023] Specifically, the 10-2 primer set is a primer set capable of specifically amplifying a specific region in the nucleus of the *Cyprinus circinus* genome, but this primer set cannot amplify the corresponding sequence in the *Cyprinus circinus* genome. The 10-2 primer set is a primer set capable of specifically amplifying a specific region in the nucleus of the *Cyprinus circinus* genome, but this primer set cannot amplify the corresponding sequence in the *Cyprinus circinus* genome.

[0024] Furthermore, when using the above primer combination to detect and analyze the sample to be identified, the determination method is to perform electrophoresis detection or sequencing analysis on the PCR products amplified by the above primers respectively.

[0025] When using electrophoresis for detection, the criteria are as follows: if the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set does not amplify any PCR product, then the target fish is *Cyprinus circinus*; if the round 10⁻² primer set does not amplify any PCR product, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is *Cyprinus circinus*; if the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is a hybrid of *Cyprinus circinus* and *Cyprinus circinus*.

[0026] When using sequencing analysis, the criteria for determination are as follows: if the sequence of the amplified product using the circular 10-2 primer set is as shown in SEQ ID NO.7, then the target fish is *Cyprinus circus*; if the sequence of the amplified product using the copper 10-2 primer set is as shown in SEQ ID NO.8, then the target fish is *Cyprinus circus*; if both the circular 10-2 primer set and the copper 10-2 primer set amplify products, and the sequence amplified by the circular 10-2 primer set is as shown in SEQ ID NO.7, and the sequence amplified by the copper 10-2 primer set is as shown in SEQ ID NO.8, then the target fish is a hybrid of *Cyprinus circus* and *Cyprinus circus*.

[0027] Internal control primers play a crucial role in PCR amplification, serving as calibration and standardization tools, improving experimental accuracy, monitoring reaction conditions, and aiding data analysis. Specifically, because different samples may vary in yield, quality, and reverse transcription efficiency, these differences can lead to misjudgments of target gene expression levels. Using internal control primers to amplify a gene with relatively stable expression levels (such as housekeeping genes U6 and GAPDH) can eliminate these variability, thus more accurately reflecting non-specific expression differences of the target gene. Furthermore, since the expression level of internal control genes is relatively stable in cells and unaffected by cell state, it can also serve as a reliable reference for assessing PCR amplification efficiency. If the amplification result of the internal control gene is normal, then the PCR amplification process can be considered to have not been significantly interfered with or inhibited, and the experimental results are reliable. Internal control primers can also be used to monitor changes in PCR reaction conditions. During PCR amplification, even small changes in reaction conditions (such as temperature, pH, and ion concentration) can affect amplification efficiency. By using internal control primers, the impact of these changes on amplification efficiency can be observed, allowing for timely adjustments to reaction conditions to ensure successful PCR amplification. Therefore, during PCR amplification, primers for an internal reference gene, i.e., internal reference primers, are usually added to the PCR amplification system.

[0028] In some specific embodiments of the present invention, the sequence of the forward primer in the internal reference primer is 5'-GACCCATCACAAGAGTTCA-3' (SEQ ID NO.5), and the sequence of the reverse primer is 5'-GCAGGCAGTCCTACAAT-3' (SEQ ID NO.6).

[0029] In this invention, the specific information of the 120bp band amplified by the round 10-2 primer set on purebred roundmouth copper fish is as follows: ACAAGATTATAAGCACATGTGTCTCATTGGCCTCTCTAATGTTTTGTTTCTCTTTACTTAGGCGGGAGAACGGCAACAAGAGCTGCAGAATCAGGTTGAGACATTGCGTCTGGAGAATCA (SEQ ID NO.7).

[0030] The specific information of the 117bp band amplified by the copper 10-2 primer set on purebred copper fish is as follows: AGATTGAGCCTCATTGTGTCTCATTGGCCTCTCTAAAGTTTTGTTTCTCTTTACTTAGGCGGGAGAACAGCAACAAGAGCTGCAGAATCAGGTTGAGACATTGCGTCTGGAGAATCA (SEQ ID NO.8).

[0031] The present invention also provides a kit for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring. The kit includes reagent A and reagent B. Reagent A includes the above-mentioned round 10-2 primer set, and reagent B includes the above-mentioned copper 10-2 primer set.

[0032] When preparing the product, the forward and reverse primers from the circular 10⁻² primer set can be mixed as reagent A, and the forward and reverse primers from the copper 10⁻² primer set can be mixed as reagent B. Alternatively, reagent A can be in the following form: Reagent A includes reagent A1 and reagent A2, where reagent A1 includes the forward primer 10⁻²F from the circular 10⁻² primer set, and reagent A2 includes the reverse primer 10⁻²R from the circular 10⁻² primer set; Reagent B includes reagent B1 and reagent B2, where reagent B1 includes the forward primer 10⁻²F from the copper 10⁻² primer set, and reagent B2 includes the reverse primer 10⁻²R from the copper 10⁻² primer set.

[0033] In some embodiments, the kit further includes reagent C, which comprises the internal reference primers described above.

[0034] Similarly, the forward and reverse primers of the internal reference primer can be mixed as reagent C, or they can be in the following form: reagent C includes reagent C1 and reagent C2, where reagent C1 includes the forward primer of the internal reference primer and reagent C2 includes the reverse primer of the internal reference primer.

[0035] In some implementations, the internal reference primer can also be directly added to reagent A and reagent B, or both reagent A and reagent B can contain the forward and reverse primers of the internal reference primer, respectively.

[0036] The present invention also provides a method for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring, comprising the following steps: (1) extracting total genomic DNA from the target fish sample; (2) using the total DNA as a template, performing PCR amplification and detection using the above-mentioned primer combination or kit; (3) making a judgment based on the electrophoresis detection results, the judgment criteria being as follows.

[0037] If the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set does not amplify any PCR product, then the target fish is *Cyprinus circinus*. If the round 10⁻² primer set does not amplify any PCR product, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is *Cyprinus circinus*. If the round 10⁻² primer set amplifies a PCR product of 120 bp, and the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is a hybrid of *Cyprinus circinus* and *Cyprinus circinus*.

[0038] The method for extracting total genomic DNA from target fish samples in this invention can employ non-destructive extraction methods, such as collecting fin tissue for testing. The total DNA extraction method can refer to existing technologies, such as using the DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd.

[0039] A PCR (Polymerase Chain Reaction) reaction system refers to the ratio and concentration of all reaction components required for a PCR reaction. A standard PCR reaction system mainly includes the following key components: template, i.e., the DNA or RNA used for amplification, which is the target gene or specific fragment to be amplified; primers, a pair of artificially synthesized oligonucleotide sequences that can bind complementary to two template DNAs, one called the upstream primer and the other the downstream primer; deoxyribonucleoside triphosphates (dNTPs), which are materials for synthesizing new DNA chains, including dATP, dGTP, dTTP, dCTP, etc.; DNA polymerase, which catalyzes DNA synthesis; and PCR reaction buffer, which provides a suitable pH and ionic strength environment for the PCR reaction to ensure the activity and stability of the DNA polymerase. The PCR amplification reaction system used in this invention has no special limitations and the above-mentioned conventional system can be used.

[0040] For example, the PCR amplification system is as follows: 3 μL of 10×PCR buffer, 2 μL of 2.5 mmol / L dNTP, 3 μL of MgCl2, 1 μL each of forward primer and reaction primer, 0.5 μL of Taq enzyme, 2 μL of DNA template, and 12.5 μL of ultrapure water.

[0041] The PCR (Polymerase Chain Reaction) procedure mainly includes the following steps. Pre-denaturation: Complete denaturation of the template DNA and complete activation of the PCR enzyme are crucial for the success of PCR. Generally, the reaction system is heated to 94~98°C and maintained for a few minutes (e.g., 4 minutes) to denature the DNA double strands at high temperature, breaking the hydrogen bonds between the double strands to form two single strands.

[0042] Cyclic reaction

[0043] Denaturation: During cycling, 95°C for 30 seconds is generally sufficient to completely denature various target DNA sequences.

[0044] Annealing (renaturation): The solution temperature is lowered to 50-65°C, and the template DNA and primers bind complementaryly according to the base pairing principle to form a local double strand.

[0045] Further: When the solution reaction temperature is raised to 70-75°C (the commonly used temperature is 72°C), the thermostable DNA polymerase (such as Taq polymerase) uses single-stranded DNA as a template and, guided by primers, replicates complementary DNA in the 5′→3′ direction using the four deoxyribonucleoside triphosphates (dNTPs) in the reaction mixture.

[0046] The denaturation, annealing, and extension steps described above constitute one cycle. After each cycle, the amount of DNA in the sample should double, and the newly formed strands can then serve as templates for the next cycle. Most PCR experiments involve 25-40 cycles; the number of cycles determines the yield of the PCR amplification.

[0047] For extension, after the last cycle, the reaction is maintained at 72°C for 5–15 minutes to allow the primers to extend completely and to anneal the single-stranded product into a double-stranded product.

[0048] For example, the PCR reaction program is as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min.

[0049] After PCR amplification, detection can be performed by either sequencing or electrophoresis.

[0050] Example 1

[0051] This embodiment provides a method for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, including the following steps:

[0052] Extraction of total genomic DNA: Total genomic DNA was extracted using the DNA extraction kit from Tiangen Biotech (Beijing) Co., Ltd. The specific procedure was as follows: 0.5g of fin tissue was placed in a mortar and then into a sterile centrifuge tube. 1×TE sterile buffer was added and the tissue was soaked at 4℃ for 12h. Then, the fin tissue was extracted according to the kit instructions.

[0053] PCR amplification: Using the extracted total DNA as a template, PCR amplification and detection were performed using the primers shown in Table 1 below. The PCR amplification system is shown in Table 2 below, and the amplification program is shown in Table 3 below.

[0054] Table 1

[0055]

[0056] Table 2

[0057]

[0058] Table 3

[0059]

[0060] Electrophoresis detection and interpretation: PCR products were detected by electrophoresis on a 2wt% agarose gel. The interpretation criteria were as follows:

[0061] If the 10⁻² primer set amplifies a PCR product of 120 bp, and the 10⁻² primer set of copper does not amplify any PCR product, then the target fish is the round-mouthed copper fish.

[0062] If the circular 10⁻² primer set fails to amplify any PCR product, but the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is the copper fish.

[0063] If the round 10-2 primer set amplifies a PCR product of 120 bp and the copper 10-2 primer set amplifies a PCR product of 117 bp, then the target fish is a hybrid of the round-mouthed copper fish and the copper fish.

[0064] Example 2

[0065] Six purebred roundmouth copper fish (labeled S1-S6) and six purebred copper fish (labeled S7-S12) were selected, and their total DNA was extracted according to the method described in Example 1. The total DNA extracted from these 12 individuals was amplified by conventional PCR using the three pairs of nuclear gene primers (internal reference primer, round 10⁻² primer, and copper 10⁻² primer) described in Example 1. The PCR products were then electrophoresed on a 2% agarose gel. The electrophoresis results are shown in Figures 1 and 2.

[0066] As shown in Figure 1, the internal control primers amplified a 142 bp band in all 12 samples. The round 10-2 primer set amplified a 120 bp band in all 6 purebred *Rhizoctonia solani* samples, but no band was amplified in the 6 purebred *Copper smelt* samples. As shown in Figure 2, the copper 10-2 primers did not amplify any band in the 6 purebred *Rhizoctonia solani* samples, but amplified a 117 bp band in all 6 purebred *Copper smelt* samples. This indicates that this method can accurately and quickly identify *Rhizoctonia solani* and *Copper smelt*.

[0067] Further sequencing of the amplified PCR products revealed that the 120bp band amplified by the round 10-2 primers on the purebred roundmouth copper fish is as follows: ACAAGATTATAAGCACATGTGTCTCATTGGCCTCTCTAATGTTTTGTTTCTCTTTACTTAGGCGGGAGAACGGCAACAAGAGCTGCAGAATCAGGTTGAGACATTGCGTCTGGAGAATCA (SEQ ID NO. 7).

[0068] The specific information of the 117bp band amplified by the copper 10-2 primer set on purebred copper fish is as follows: AGATTGAGCCTCATTGTGTCTCATTGGCCTCTCTAAAGTTTTGTTTCTCTTTACTTAGGCGGGAGAACAGCAACAAGAGCTGCAGAATCAGGTTGAGACATTGCGTCTGGAGAATCA (SEQ ID NO.8).

[0069] Example 3

[0070] In November 2024, 20 purebred round-mouthed copper fish, 20 copper fish, 20 copper fish, and a hybrid of round-mouthed copper fish were collected from Yichang Sanjiang Fishery Co., Ltd. DNA was extracted from all 60 fish. The order of these 60 samples was randomly shuffled by one person, and only this person knew the true information of each sample. Another researcher conducted the tests according to the method provided in Example 1 and provided preliminary identification results, as shown in Table 1 below:

[0071] Table 1

[0072]

[0073] The preliminary identification results, verified by experimenters with the sequence shuffled, are entirely correct. This experiment demonstrates that the primer set provided by this invention is stable and reliable for the rapid identification of *Cyprinus circinus* and *Cyprinus circinus* and their hybrid offspring.

[0074] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, and not to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those skilled in the art should understand that modifications can still be made to the technical solutions described in the foregoing embodiments, or equivalent substitutions can be made to some or all of the technical features; and these modifications or substitutions do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A primer combination for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, characterized in that, The primer set includes a circular 10⁻² primer set and a copper 10⁻² primer set. The sequence of the forward primer 10⁻²F in the circular 10⁻² primer set is 5'-ACAAGATTATAAGCACATGT-3', and the sequence of the reverse primer 10⁻²R is 5'-TGATTCTCCAGACGCA-3'. The sequence of the forward primer 10⁻²F in the copper 10⁻² primer set is 5'-TGATTCTCCAGACGCA-3', and the sequence of the reverse primer 10⁻²R is 5'-AGATTGAGCCTCATTGTG-3'.

2. The primer combination for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring as described in claim 1, characterized in that, It also includes internal reference primers.

3. The primer combination for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring as described in claim 2, characterized in that, The sequence of the forward primer of the internal reference primer is 5'-GACCCATCACAAGAGTTCA-3', and the sequence of the reverse primer is 5'-GCAGGCAGTCCTACAAT-3'.

4. A kit for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, characterized in that, The kit includes reagent A and reagent B, wherein reagent A includes the circular 10⁻² primer set as described in claim 1, and reagent B includes the copper 10⁻² primer set as described in claim 1.

5. The kit for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring according to claim 4, characterized in that, Reagent A comprises reagent A1 and reagent A2, wherein reagent A1 comprises the forward primer 10-2F from the circular 10-2 primer set of claim 1, and reagent A2 comprises the reverse primer 10-2R from the circular 10-2 primer set of claim 1; and / or The reagent B includes reagent B1 and reagent B2. Reagent B1 includes the forward primer 10-2F from the copper 10-2 primer set in claim 1, and reagent B2 includes the reverse primer 10-2R from the copper 10-2 primer set in claim 1.

6. The kit for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring according to claim 4 or 5, characterized in that, It also includes reagent C, which comprises the internal reference primer as described in claim 2 or 3.

7. The kit for identifying the round-mouthed copper fish and the copper fish and their hybrid offspring according to claim 6, characterized in that, The reagent C includes reagent C1 and reagent C2, wherein reagent C1 includes the forward primer of the internal reference primer in claim 3, and reagent C2 includes the reverse primer of the internal reference primer in claim 3.

8. A method for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring, characterized in that, Includes the following steps: (1) Extract total genomic DNA from the target fish sample; (2) Using total DNA as a template, perform PCR amplification and detection using the primer combination described in any one of claims 1-3 or the kit described in any one of claims 4-7; (3) Judgment based on electrophoresis test results: If the round 10-2 primer set amplifies a PCR product of 120bp, and the copper 10-2 primer set does not amplify any PCR product, then the target fish is the round-mouthed copper fish. If the round 10⁻² primer set does not amplify any PCR product, but the copper 10⁻² primer set amplifies a PCR product of 117 bp, then the target fish is copper fish. If the 10-2 primer set amplifies a PCR product of 120 bp and the 10-2 primer set amplifies a PCR product of 117 bp, then the target fish is a hybrid of the round-mouthed copper fish and the copper fish.

9. The method for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring according to claim 8, characterized in that, The PCR amplification system consisted of: 3 μL of 10×PCR Buffer, 2 μL of 2.5 mmol / L dNTP, 3 μL of MgCl2, 1 μL each of forward and reverse primers, 0.5 μL of Taq enzyme, 2 μL of DNA template, and 12.5 μL of ultrapure water.

10. The method for distinguishing between the round-mouthed copper fish and the copper fish and their hybrid offspring according to claim 8 or 9, characterized in that, The PCR reaction program was as follows: 94℃ pre-denaturation for 3 min; 94℃ denaturation for 30 s, annealing at 58℃ for 30 s, extension at 72℃ for 30 s, 35 cycles; 72℃ extension for 10 min.

Citation Information

Patent Citations

  • Microsatellite marking method for parentage identification of coreius guichenoti

    CN108998547A

  • COI primer pair, kit and identification method for identifying coreius guichenoti and coreius guichenoti

    CN114941034A