Application of SNP (Single Nucleotide Polymorphism) marker in inbred line mouse strain identification and inbred line mouse genetic monitoring and primer sequence

Abstract

The invention relates to the technical field of mouse strain identification, and particularly discloses application of an SNP marker in inbred line mouse strain identification and inbred line mouse genetic monitoring and a primer sequence. Specifically, the SNP marker comprises four SNP loci; and the inbred line mouse strain is selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2 and CBA. The invention also discloses an application of the primer sequence for synthesizing the SNP site in inbred line mouse strain identification and inbred line mouse genetic monitoring. According to the application, five inbred line mouse strains of C57BL / 6J, C57BL / 6N, FVB, DBA / 2 and CBA can be simultaneously identified, and the accuracy of inbred line mouse strain identification results is improved.

Description

Technical Field

[0001] This application relates to the technical field of inbred mouse strain identification, and specifically relates to the application of SNP markers in the identification of inbred mouse strains and the genetic monitoring of inbred mice, as well as primer sequences. Background Art

[0002] Laboratory animals refer to animals that are artificially bred and standardized managed, with their microbial environment precisely regulated, and whose genetic information is clear or traceable, and are specifically used for scientific research, teaching, biomedical development, quality inspection, and other experimental purposes. Among them, laboratory rats and mice are the most commonly used model organisms.

[0003] Taking laboratory mice as an example, currently more than 24,000 different inbred mouse strains with different genetic backgrounds have been established globally, covering thousands of types such as closed colonies, inbred lines, recombinant congenic lines, recombinant inbred lines, and gene mutant lines. Although the in-depth development of biomedical research has promoted the generation of a large number of new artificially induced or naturally mutated mouse strains, its core R & D path still depends on the genetic framework of classical inbred and closed colony mice.

[0004] It should be noted that although there are significant genomic differences among common inbred mouse strains, their phenotypic characteristics (such as body size, coat color, etc.) are highly convergent, and it is difficult to accurately distinguish strains only through morphological observation. With the rapid development of precision medicine and gene editing technology, the demand of scientific research institutions and the biomedical industry for the genetic purity and traceability reliability of laboratory animals is becoming increasingly stringent. Establishing a standardized strain identification system and cell source tracing technology has become the core challenge to ensure the repeatability of experimental data and industrialization.

[0005] Based on the above, there is an urgent need for a new method to identify inbred mouse strains. Summary of the Invention

[0006] This application provides the application of SNP markers in the identification of inbred mouse strains and the genetic monitoring of inbred mice, as well as primer sequences.

[0007] This application is mainly used for efficiently genotyping and genetically monitoring common inbred mice and their cell-derived strains to ensure the purity and consistency of their genetic backgrounds. Through specific molecular markers or gene detection methods, different strains of mice can be accurately identified, and their genetic stability can be monitored to prevent strain degradation caused by genetic drift or contamination.

[0008] This application provides a genetic identification method based on 4 specific SNP markers. By screening and validating 4 high-resolution single nucleotide polymorphism (SNP) loci, an efficient identification system for 5 common inbred mouse strains (C57BL / 6J, C57BL / 6N, FVB, DBA / 2, CBA) is constructed. This technology can achieve three core functions: First, accurately distinguish the genetic strains of common inbred mice; Second, establish a genetic monitoring system to effectively track genetic variation events such as genetic drift, interspecies hybridization, and foreign contamination; Third, complete the traceability identification of animal cells to ensure the controllability of the genetic background of experimental materials. The selected SNP markers have multiple detection capabilities. They can not only quickly identify strains through genomic feature differences, but also reveal changes in genetic stability through long-term dynamic monitoring. At the same time, they support the verification of the genetic correlation between in vitro cultured cells and their donor animals, forming a whole-genome coverage quality control plan covering live animals to in vitro cells.

[0009] In the first aspect, this application provides an application of SNP markers in the identification of inbred mouse strains and the genetic monitoring of inbred mice, adopting the following technical solutions:

[0010] An application of SNP markers in the identification of inbred mouse strains and the genetic monitoring of inbred mice, wherein the SNP markers include 4 SNP loci, namely: SNP1, SNP2, SNP3, SNP4; the inbred mouse strains are selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, CBA;

[0011] SNP1 is located at the 138th position of the nucleotide sequence shown in SEQ ID NO: 1, and the base of the nucleotide molecule here is C or T;

[0012] SNP2 is located at the 116th position of the nucleotide sequence shown in SEQ ID NO: 2, and the base of the nucleotide molecule here is C or A;

[0013] SNP3 is located at the 207th position of the nucleotide sequence shown in SEQ ID NO: 3, and the base of the nucleotide molecule here is G or A;

[0014] SNP4 is located at the 234th position of the nucleotide sequence shown in SEQ ID NO: 4, and the base of the nucleotide molecule here is C or T.

[0015] Four SNP loci were selected in this application to form SNP loci for the identification of inbred mouse strains. By using the above four SNP loci, various inbred mouse strains can be identified, especially C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA, and the detection results are accurate. Especially when identifying inbred mouse strains for multiple mouse samples, the accuracy of the detection results can be greatly improved, while saving the time spent on identification, improving the detection efficiency of mouse strains, and expanding the application scope of using SNP loci for mouse strain identification.

[0016] In a second aspect, this application provides an application of SNP markers in the preparation of kits or detection methods, adopting the following technical solutions:

[0017] An application of SNP markers in the preparation of kits or detection methods, where the kit or detection method is used for the identification of inbred mouse strains; the SNP markers include four SNP loci, namely: SNP1, SNP2, SNP3, and SNP4; the inbred mouse strains are selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA.

[0018] By adopting the above solution, the above SNP markers can be used to prepare a kit for identifying inbred mouse strains or to identify inbred mouse strains using the above SNP markers.

[0019] In a third aspect, this application also provides a primer sequence, adopting the following technical solutions:

[0020] A primer sequence, where the primer sequence is used for the identification of inbred mouse strains; the primer sequence is selected from primer sequence SNP1, primer sequence SNP2, primer sequence SNP3, and primer sequence SNP4; the inbred mouse strains are selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA;

[0021] The primer sequence SNP1 includes:

[0022] Forward primer FI: GGGCTGCAGAGGCTGCATTTGCTGGT,

[0023] Internal reverse primer RI: GACTGTTATACATAAATTTAAATTTCCG;

[0024] External forward primer FO: AGTGTCAGGGCGATAAAGAAGCAGTACT,

[0025] External reverse primer RO: GCCGTTCATAAAAGTCAAGATCATAGCA;

[0026] And / or, the primer sequence SNP2 includes:

[0027] Internal forward primer FI: CCTGTAGCCTTTCTAGTTCAGAACCTC,

[0028] Internal reverse primer RI: ACCCTTAGAACCTGAGGTAGGAGAATAGT;

[0029] External forward primer FO: TTTCCTATTGTTTCATTTGATGTGATTG,

[0030] External reverse primer RO: ACAGTCTGACAGTGACTGTGGAATAGAG;

[0031] And / or, the primer sequence SNP3 includes:

[0032] Internal forward primer FI: AGGAGACTATATATCTACTTTATGTGTAG,

[0033] Internal reverse primer RI: ACCATATTGCTGATAAGAAAAATATCT;

[0034] External forward primer FO: TAACATCTGGCTTTATGACTTATATAC,

[0035] External reverse primer RO: CTATTATTAGGCAGAGTAACAATAACA;

[0036] And / or, the primer sequence SNP4 includes:

[0037] Internal forward primer FI: AGCTGTCCCCATCTTCAAATGAATATC,

[0038] Internal reverse primer RI: TAGATTCAGGCCTATTATGTTTCCACGA;

[0039] External forward primer FO: AATATACACATGAGGTATTCTGGACCCAAA,

[0040] External reverse primer RO: CCAAAAAAAAAAAACAAGCAAAGACAAA.

[0041] Fourthly, the present application provides the application of the above primer sequences in the preparation of a kit or a detection method for identifying inbred mouse strains.

[0042] Fifth aspect, the present application provides a DNA sequence obtained by amplification using the above primer sequences.

[0043] Sixth aspect, the present application provides the use of the above DNA sequence in the identification of inbred mouse strains and the genetic monitoring of inbred mice.

[0044] (1) Identification of multiple inbred mouse strains: Compare the base types of each SNP locus of the mouse sample with the base types of each SNP locus of the known mouse strain. If the base types of the 4 SNP loci of the mouse sample are all consistent with the base types of each SNP locus of the known mouse strain, it can be preliminarily determined that the mouse sample is derived from the corresponding mouse strain.

[0045] (2) Genetic monitoring of inbred mice: 6-10 mouse individuals within the population can be selected as mouse samples, and the genomes of each mouse sample are obtained and the base types of 4 SNP loci are detected. If the base types of the 4 SNP loci of all mouse samples are all consistent with the base types of each SNP locus of this mouse strain and are all monomorphic / homozygous, it is determined that this population is a qualified inbred mouse strain; if the base types of 1 or more SNP loci of a mouse individual are inconsistent with the base types of the corresponding SNP loci of this mouse strain, or are polymorphic / heterozygous, this population is an unqualified inbred mouse strain.

[0046] (3) When multiple mouse samples are known to be two mouse strains, it is necessary to determine the corresponding mouse strain for each mouse sample: Select 2-3 SNP loci among the 4 SNP loci where the base types of the SNP loci of the two known mouse strains are different. Amplify the above SNP loci of the mouse sample and compare them with the base types of the above SNP loci of the known mouse strain. If the base types of the above SNP loci of the mouse sample are all consistent with the base types of the above SNP loci of the known mouse strain, it can be preliminarily determined that the mouse sample is derived from the corresponding mouse strain.

[0047] In summary, the present application has the following beneficial effects:

[0048] 1. By using the above 4 SNP loci, the present application can identify multiple inbred mouse strains, especially can identify C57BL / 6J, C57BL / 6N, FVB, DBA / 2, CBA, and the detection results are accurate. At the same time, it saves the time spent on identification, improves the detection efficiency of mouse strains, and expands the application range of using SNP loci for mouse strain identification.

[0049] 2. The SNP locus combination provided by the present application is simple to operate and has low technical difficulties.

[0050] 3. The present application also provides primer sequences for amplifying the above SNP loci respectively, and the sequences amplified by each pair of primer sequences contain a specific SNP marker.

[0051] 4. The 4 SNP loci screened out by the present application and the provided primer sequences can be used not only for the identification of inbred mouse strains, but also for the genetic monitoring of inbred mice.

[0052] 5. High efficiency: The four loci of the present application can distinguish five strains, with high analysis efficiency; at the same time, sodium hydroxide crude extraction is used for extraction and agarose gel electrophoresis is used for imaging, with low cost. Description of the Drawings

[0053] Figure 1 It is the electrophoresis result of Example 1. Detailed Embodiments

[0054] Before describing the embodiments of the present application in detail, it should be understood that the terms used herein are for the purpose of describing specific embodiments only. Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which this term belongs.

[0055] It should be noted that the terms "first" and "second" are only used for descriptive purposes and cannot be understood as indicating or implying relative importance or implicitly specifying the quantity of the indicated technical features. Thus, features defined with "first" and "second" may explicitly or implicitly include one or more of such features. Further, in the description of the present application, unless otherwise stated, the meaning of "a plurality" is two or more.

[0056] In the present application, the endpoints and any values of the disclosed ranges are not limited to the exact ranges or values, and these ranges or values should be understood to include values close to these ranges or values. For numerical ranges, between the endpoint values of each range, between the endpoint values of each range and individual point values, and between individual point values, they can be combined with each other to obtain one or more new numerical ranges, and these numerical ranges should be regarded as specifically disclosed herein.

[0057] In the present application, the term "comprising" or "including" is an open expression, that is, it includes the content specified in the present application, but does not exclude other aspects.

[0058] The method for identifying inbred mouse strains specifically includes the following steps:

[0059] 1. Extraction of genomic DNA

[0060] Lyse a 2-mm mouse tail with 180 μL of NaOH solution (concentration: 50 mmol / L) and heat it at 80 - 100 °C for 5 - 15 minutes. Specifically, it can be heated at 95 °C for 10 minutes to release genomic DNA. After cooling, add 20 μL of Tris-HCl (concentration: 1 mol / L, pH 8.0), mix well, centrifuge, and take the supernatant after centrifugation, which is the genomic DNA.

[0061] 2. Polymerase Chain Reaction (PCR) Amplification

[0062] Using the genomic DNA of the mouse sample obtained in Step 1 as a template, perform PCR amplification using the primer sequences provided in Preparation Examples 1 - 4.

[0063] Each SNP locus corresponds to a 10-μL PCR reaction system, which contains 5 μL of Green Taq MI (Novoprotein, P131), 2 μL of pure water (ddH2O), primers (FI, RI, FO, and RO) with a total volume of 1 μL and a concentration of 10 μmol / L each, and 2 μL of template DNA; the PCR reaction conditions are: pre-denaturation at 95 °C for 5 minutes; denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 35 seconds, for 30 cycles; continue extension at 72 °C for 10 minutes, and store the amplification product at 4 °C.

[0064] For the primer mixture corresponding to the first SNP locus rs13478622, add the external primer and the internal primer in a volume ratio of 3:2, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 3:2, making the brightness of multiple bands in the final electrophoresis diagram as consistent as possible, avoiding the lower band in the two bands being too dark, and making the result of the electrophoresis diagram clearer;

[0065] For the PCR reaction corresponding to the second SNP locus rs3023177, select an annealing temperature of 62 °C, and add the external primer and the internal primer in a volume ratio of 1:1 in the primer mixture, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1;

[0066] For the PCR reaction corresponding to the third SNP locus rs3023481, select an annealing temperature of 54 °C, and add the external primer and the internal primer in a volume ratio of 1:1 in the primer mixture, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1;

[0067] For the PCR reaction corresponding to the fourth SNP locus rs246037535, select an annealing temperature of 63 °C, and add the external primer and the internal primer in a volume ratio of 1:1 in the primer mixture, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1.

[0068] 3. Detection of PCR amplification products

[0069] The PCR amplification products were detected by 2% agarose gel electrophoresis and an ultraviolet gel imager. The sample loading volume was 5 μL of the PCR product per well, and the electrophoresis conditions were a constant voltage of 121 V for 45 min. All the target bands in the electrophoresis results were single, bright, indicating that the amplification products of the SNP sites were obtained.

[0070] 4. Sequencing and result judgment of PCR amplification products

[0071] 5. Identification of mouse strains

[0072] The mouse strains can be identified or genetically monitored at least in the following 3 situations:

[0073] (1) Identification of multiple inbred mouse strains: The base types of each SNP site of the mouse sample were compared with those of each SNP site of the known mouse strain. If the base types of the 4 SNP sites of the mouse sample were all consistent with those of each SNP site of the known mouse strain, it could be preliminarily determined that the mouse sample originated from the corresponding mouse strain.

[0074] (2) Genetic monitoring of inbred mice: 3 - 5 mouse individuals in the population can be selected as mouse samples, and the genomes of each mouse sample are obtained and the base types of 4 SNP sites are detected. If the base types of the 4 SNP sites of all mouse samples are all consistent with those of each SNP site of this mouse strain and are all monomorphic / homozygous, it is judged that this population is a qualified inbred mouse strain; if the base types of 1 or more SNP sites of a mouse individual are inconsistent with those of the corresponding SNP site of this mouse strain, or are polymorphic / heterozygous, this population is an unqualified inbred mouse strain.

[0075] (3) When multiple mouse samples are known to be two mouse strains, it is necessary to determine the corresponding mouse strain for each mouse sample:

[0076] Select 2 - 3 SNP sites among the 4 SNP sites where the base types of the SNP sites of the two known mouse strains are different. Amplify the above SNP sites of the mouse sample and compare them with the base types of the above SNP sites of the known mouse strain. If the base types of the above SNP sites of the mouse sample are all consistent with those of the above SNP sites of the known mouse strain, it can be preliminarily determined that the mouse sample originated from the corresponding mouse strain.

[0077] The present application will be further described in detail below in combination with Preparation Examples 1 - 4 and Examples.

[0078] Preparation Examples

[0079] Preparation Examples 1 - 4

[0080] Preparation Examples 1-4 provided two pairs of primer sequences, namely internal primers and external primers. The difference between each preparation example lies in that the SNP sites used for amplification are different. Specifically, as shown in Table 1.

[0081] The method for designing primer sequences specifically includes the following steps:

[0082] (1) Search for the nucleotide sequences upstream and downstream of the SNP sites on the Ensembl website (http: / / asia.ensembl.org / index.html), and use the online primer design website Primer blast (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / index.cgi?LINK_LOC=BlastHome) to design the primer sequences for PCR amplification of each SNP site. The design results of the primer sequences are shown in Table 1. Among them, the rs (reference snp) number is a certain mutation that occurs at a certain site of a gene, and these characteristic mutation sites were encoded in the Human Genome Project, which is the rs number.

[0083] (2) After the primer design is completed, entrust a third-party company (Beijing Tianyi Huiyuan Biotechnology Co., Ltd.) to complete the synthesis of the primers.

[0084] Table 1 SNP sites corresponding to Preparation Examples 1-5 and the designed primer sequences

[0085]

[0086] Example

[0087] Example 1

[0088] This example provides a method for identifying inbred mouse strains. There are 5 types of mouse samples identified in this example, which correspond to different mouse strains respectively. The above mouse samples are all from SPF (Beijing) Biotechnology Co., Ltd. The types of 4 SNP sites of 5 mouse strains are shown in Table 2.

[0089] Table 2 Types of 4 SNP sites of 5 mouse strains

[0090]

[0091]

[0092] Among them, in combination with Figure 1Electrophoresis results: For SNP1 locus rs13478622, two bands of 221bp and 332bp appear in the gel image, corresponding to SNP locus T; two bands of 165bp and 332bp appear, corresponding to SNP locus C.

[0093] For SNP2 locus rs3023177, two bands of 192bp and 280bp appear in the gel image, corresponding to SNP locus C; two bands of 144bp and 280bp appear, corresponding to SNP locus A.

[0094] For SNP3 locus rs3023481, two bands of 182bp and 359bp appear in the gel image, corresponding to SNP locus G; two bands of 233bp and 359bp appear in the gel image, corresponding to SNP locus A.

[0095] For SNP4 locus rs246037535; two bands of 202bp and 408bp appear in the gel image, corresponding to SNP locus C; two bands of 261bp and 408bp appear in the gel image, corresponding to SNP locus T.

[0096] Identification method for inbred mouse strains, specifically including the following steps:

[0097] 1. Extraction of genomic DNA

[0098] Lyse 2mm mouse tail with 180μL of NaOH solution (concentration 50mmol / L) and heat at 80 - 100°C for 30 minutes. Specifically, it can be heated at 95°C for 10 minutes to release genomic DNA. After cooling, add 20μL of Tris-HCl (concentration 1mol / L, pH 8.0), mix well, centrifuge, and take the supernatant, which is the genomic DNA.

[0099] 2. PCR amplification

[0100] Using the genomic DNA of the mouse sample obtained in step 1 as a template, perform PCR amplification using the primer sequences provided in Preparation Examples 1 - 4.

[0101] Each SNP locus corresponds to a 10μL PCR reaction system, which contains 5μL Green Taq MI (Novoprotein, P131), 2μL pure water (ddH2O), primers with a total volume of 1μL and a concentration of 10μmol / L each (FI, RI, FO, and RO), and 2μL of template DNA; PCR reaction conditions are: pre-denaturation at 95°C for 5 minutes; denaturation at 95°C for 30 seconds, annealing at 60°C for 30 seconds, extension at 72°C for 35 seconds, for 30 cycles; continue extension at 72°C for 10 minutes, and store the amplification product at 4°C.

[0102] For the primer mixture corresponding to the first SNP locus rs13478622, the volume ratio of the external primer to the internal primer added is 3:2, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 3:2, making the brightness of multiple bands in the final electrophoresis diagram as consistent as possible, avoiding the lower band in the two bands from being too dark, and making the results of the electrophoresis diagram clearer;

[0103] For the PCR reaction corresponding to the second SNP locus rs3023177, the annealing temperature is selected as 62°C, and the volume ratio of the external primer to the internal primer added to the primer mixture is 1:1, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1;

[0104] For the PCR reaction corresponding to the third SNP locus rs3023481, the annealing temperature is selected as 54°C, and the volume ratio of the external primer to the internal primer added to the primer mixture is 1:1, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1;

[0105] For the PCR reaction corresponding to the fourth SNP locus rs246037535, the annealing temperature is selected as 63°C, and the volume ratio of the external primer to the internal primer added to the primer mixture is 1:1, so that the concentration ratio of the external primer to the internal primer in the primer mixture is 1:1.

[0106] 3. Detection of PCR amplification products

[0107] The PCR amplification products were detected by 2% agarose gel electrophoresis and an ultraviolet gel imager. The sample loading amount was 5 μL of the PCR product per well, and 100 bp marker was used. The electrophoresis conditions were a constant voltage of 150 V and a current of 400 mA for 45 min. All the target bands in the electrophoresis results were single and bright. It shows that the amplification products of the SNP loci were obtained.

[0108] 4. Sequencing and result judgment of PCR amplification products

[0109] The detection results of 4 SNP loci in 5 mouse samples are shown in Table 3. By comparing with the types of 4 SNP loci of the 5 known mouse strains in Table 2, the obtained identification results are shown in Table 4.

[0110] The analysis process is as follows:

[0111] SNP1 locus: rs13478622. Two bands of 221 bp and 332 bp appeared in the gel diagram, corresponding to the SNP locus as T; two bands of 165 bp and 332 bp appeared, corresponding to the SNP locus as C. Proceed to the result analysis of the next SNP locus;

[0112] SNP2 locus: rs3023177. In the gel image, two bands of 192 bp and 280 bp appear, corresponding to SNP locus C; two bands of 144 bp and 280 bp appear, corresponding to SNP locus A. Proceed to the result analysis of the next SNP locus.

[0113] SNP3 locus: rs3023481. In the gel image, two bands of 182 bp and 359 bp appear, corresponding to SNP locus G; two bands of 233 bp and 359 bp appear, corresponding to SNP locus A. Proceed to the result analysis of the next SNP locus.

[0114] SNP4 locus: rs246037535; in the gel image, two bands of 202 bp and 408 bp appear, corresponding to SNP locus C; two bands of 261 bp and 408 bp appear, corresponding to SNP locus T.

[0115] Table 3 Detection results of 4 SNP loci in 5 mouse samples in Example 1

[0116]

[0117]

[0118] Table 4 Identification results of 5 mouse samples in Example 1

[0119]

[0120] Compare the detection results of 4 SNP loci in 5 mouse samples in Table 3 with the corresponding types of 4 SNP loci in 5 mouse strains in Table 2. From the identification results in Table 4, it can be seen that the mouse strain of mouse sample No. 1 in this example is C57BL / 6N, the mouse strain of mouse sample No. 2 is FVB, the mouse strain of mouse sample No. 3 is C57BL / 6J, the mouse strain of mouse sample No. 4 is DBA / 2, and the mouse strain of mouse sample No. 5 is CBA.

[0121] Example 2

[0122] This example provides a method for identifying inbred mouse strains. The difference between this example and Example 1 is that there are 2 mouse samples to be identified in this example. The known mouse samples are two mouse strains of C57BL / 6N and CBA, and it is necessary to identify the specific mouse strains corresponding to the mouse samples. The above mouse samples are all from Spf (Beijing) Biotechnology Co., Ltd. Other operations are the same as in Example 1.

[0123] According to the comparison of SNP sites between the two mouse strains C57BL / 6N and CBA in Table 2, it can be seen that by identifying the types of SNP2, SNP3, and SNP4, the mouse strain of the mouse sample can be determined. Therefore, only the PCR amplification of the above 3 SNP sites is performed.

[0124] The detection results and identification results of the 3 SNP sites of the 2 mouse samples in this example are shown in Table 5.

[0125] Table 5 Detection results and identification results of 3 SNP sites of 2 mouse samples in Example 2

[0126]

[0127] By comparing the detection results of the 3 SNP sites of the 2 mouse samples in Table 5 with the types of the corresponding SNP sites in Table 2, it can be seen that the mouse strain of mouse sample No. 1 in this example is C57BL / 6N, and the mouse strain of mouse sample No. 2 is CBA.

[0128] Example 3

[0129] This example provides a method for identifying inbred mouse strains. The difference between this example and Example 2 is that it is known that the mouse samples are two mouse strains, C57BL / 6N and DBA / 2, and it is necessary to identify the specific corresponding mouse strain of the mouse samples. The above mouse samples are all from Spf (Beijing) Biotechnology Co., Ltd. Other operations are the same as in Example 2.

[0130] According to the comparison of SNP sites between the two mouse strains C57BL / 6N and DBA / 2 in Table 2, it can be seen that by identifying the types of SNP1, SNP2, and SNP4, the mouse strain of the mouse sample can be determined. Therefore, only the PCR amplification of the above 3 SNP sites is performed.

[0131] The detection results and identification results of the 3 SNP sites of the 2 mouse samples in this example are shown in Table 6.

[0132] Table 6 Detection results and identification results of 3 SNP sites of 2 mouse samples in Example 3

[0133]

[0134] By comparing the detection results of the 3 SNP sites of the 2 mouse samples in Table 6 with the types of the corresponding SNP sites in Table 2, it can be seen that the mouse strain of mouse sample No. 1 in this example is C57BL / 6N, and the mouse strain of mouse sample No. 2 is DBA / 2.

[0135] Comparative Example

[0136] This comparative example provides a method for identifying inbred mouse strains. The difference between this comparative example and Example 1 is that: three SNP loci are used as the basis for identifying mouse strains, as shown in Table 7 specifically. The remaining operations are the same as those in Example 1.

[0137] Table 7 Types of three SNP loci in five mouse strains

[0138]

[0139]

[0140] The detection results of three SNP loci of five mouse samples in this comparative example are shown in Table 8. By comparing with the types of three SNP loci of the known five mouse strains in Table 7, the obtained identification results are shown in Table 9.

[0141] Table 8 Detection results of three SNP loci of five mouse samples

[0142]

[0143] Table 9 Identification results of five mouse samples

[0144]

[0145] By comparing the detection results of three SNP loci of five mouse samples in Table 8 with the corresponding types of three SNP loci of five mouse strains in Table 7, it can be seen from the identification results in Table 9 that the mouse strain of mouse sample No. 2 in this comparative example is DBA / 2, the mouse strain of mouse sample No. 3 is C57BL / 6N, the mouse strain of mouse sample No. 4 is C57BL / 6J, and the strains of the remaining mouse samples cannot be determined.

[0146] Therefore, with the set of three SNP loci provided in this comparative example, the mouse strains of C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA cannot be completely identified.

[0147] In the description of this specification, the description with reference to terms such as "one embodiment", "some embodiments", "example", "specific example", or "some examples" means that the specific features, structures, materials, or characteristics described in connection with the embodiment or example are included in at least one embodiment or example of this application. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials, or characteristics described can be combined in a suitable manner in any one or more embodiments or examples. In addition, without contradiction, those skilled in the art can combine and combine the different embodiments or examples described in this specification and the features of different embodiments or examples.

[0148] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present application, rather than limiting them; although the present application has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some of the technical features; and these modifications or replacements do not make the essence of the corresponding technical solutions deviate from the spirit and scope of the technical solutions of the various embodiments of the present application.

Claims

1. An application of a SNP marker in inbred mouse strain identification and inbred mouse genetic monitoring, characterized in that: The SNP markers include four SNP sites, namely: SNP1, SNP2, SNP3, and SNP4; the inbred mouse strains are selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA; The SNP1 is located at position 138 of the nucleotide sequence shown in SEQ ID NO: 1, where the base of the nucleotide molecule is C or T; The SNP2 is located at position 116 of the nucleotide sequence shown in SEQ ID NO: 2, where the base of the nucleotide molecule is C or A; The SNP3 is located at position 207 of the nucleotide sequence shown in SEQ ID NO: 3, where the base of the nucleotide molecule is G or A; The SNP4 is located at position 234 of the nucleotide sequence shown in SEQ ID NO: 4, where the base of the nucleotide molecule is C or T.

2. A use of the SNP marker according to claim 1 in preparing a kit or a detection method, characterized in that: The kit or detection method is used for identifying inbred mouse strains; the SNP markers include four SNP sites, namely: SNP1, SNP2, SNP3, and SNP4; the inbred mouse strains are selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA.

3. A primer sequence for amplifying the SNP marker according to claim 1, characterized in that: The primer sequence is used for inbred mouse strain identification; the primer sequence is selected from primer sequence SNP1, primer sequence SNP2, primer sequence SNP3, and primer sequence SNP4; The inbred mouse strain is selected from C57BL / 6J, C57BL / 6N, FVB, DBA / 2, and CBA; The primer sequence SNP1 comprises: Forward primer FI: GGGCTGCAGAGGCTGCATTTGCTGGT, Internal reverse primer RI: GACTGTTATACATAAATTTAAATTTCCG; External forward primer FO: AGTGTCAGGGCGATAAAGAAGCAGTACT, External reverse primer RO: GCCGTTCATAAAAGTCAAGATCATAGCA; And / or, the primer sequence SNP2 comprises: Internal forward primer FI: CCTGTAGCCTTTCTAGTTCAGAACCTC, Internal reverse primer RI:ACCCTTAGAACCTGAGGTAGGAGAATAGT; External forward primer FO: TTTCCTATTGTTTCATTTGATGTGATTG, External reverse primer RO: ACAGTCTGACAGTGACTGTGGAATAGAG; And / or, the primer sequence SNP3 comprises: Internal forward primer FI: AGGAGACTATATATCTACTTTATGTGTAG, Internal reverse primer RI: ACCATATTGCTGATAAGAAAAAATATCT; External forward primer FO: TAACATCTGGCTTTATGACTTATATAC, External reverse primer RO: CTATTATTAGGCAGAGTAACAATAACA; And / or, the primer sequence SNP4 comprises: Internal forward primer FI: AGCTGTCCCCATCTTCAAATGAATATC, Internal reverse primer RI: TAGATTCAGGCCTATTATGTTTCCACGA; External forward primer FO: AATATACACATGAGGTATTCTGGACCCAAA, External reverse primer RO: CCAAAAAAAAAAAACAAGCAAAGACAAA.

4. Use of the primer sequence according to claim 3 in preparing a kit or a detection method, characterized in that: The kit or detection method is used for identifying inbred mouse strains.

5. A DNA sequence obtained by amplification using the primer sequence described in claim 3.

6. Use of the DNA sequence as claimed in claim 6 in the identification of inbred mouse strains and the genetic monitoring of inbred mice.

Images