Application of YAP1 gene in preparation of medicine for treating liver aging and medicine
By overexpressing the YAP1 gene in liver cells, the problem of lack of effective treatment methods for liver aging in the prior art is solved, and potential intervention and treatment of liver aging is achieved.
Patent Information
- Application Number
- CN202510333955.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-03-20
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art has not yet applied the YAP1 gene as a biomarker of liver aging to the preparation of therapeutic drugs, resulting in a lack of effective means for intervention and treatment of liver aging.
The overexpression of the YAP1 gene in liver cells was promoted by inserting the YAP1 gene into a lentiviral vector, thereby developing drugs for the treatment of liver aging.
It improves the expression level of YAP1 in hepatocytes, provides a potential target for liver aging intervention, and lays the foundation for the preparation of drugs to treat liver aging and related diseases.
Smart Images

Figure CN120168608A_ABST
Abstract
Description
Technical Field
[0001] The present invention belongs to the technical field of biomedicine. Background Art
[0002] The liver is the largest metabolic organ in the human body, mainly responsible for nutrient metabolism, synthesis and secretion of various proteins, decomposition of toxic substances, etc., and plays a central role in the metabolic homeostasis of the body. With the increase of age, liver aging will cause the weakening of the liver's ability to handle immune stress response and cope with aggression, which not only increases the incidence risks of various liver diseases such as fatty liver, liver cirrhosis and liver cancer. Therefore, liver aging not only causes the imbalance of metabolic homeostasis, but also increases the susceptibility to liver diseases. Studying biomarkers that can accurately reflect liver aging is of great significance for the evaluation, intervention and treatment of liver aging.
[0003] YAP1 (Yes-Associated Protein 1) is a transcriptional co-activator that plays a key role in cell growth, proliferation and regulation of organ size. There is no publicly available information documenting its use as a liver aging biomarker. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to provide the application of the YAP1 gene in the preparation of drugs for treating liver aging. Hepatocyte YAP1 is an important biomarker of liver aging. Increasing the expression of hepatocyte YAP1 is a potential intervention target for liver aging, and it can also be used in the preparation of drugs for treating liver aging and related diseases.
[0005] To solve the above technical problem, the technical solution adopted by the present invention is: The present invention provides the application of the YAP1 gene in the preparation of drugs for treating liver aging.
[0006] The disease manifestations of liver aging include: DNA damage of hepatocytes, activation of the cGAS-STING pathway in hepatocytes; liver oxidative stress; PLIN2-mediated lipid droplet deposition in the liver; accelerated intestinal flora dysbiosis and decreased abundance of Akkermansia; increased intestinal permeability; metabolic disorders and lipid accumulation.
[0007] The application in the preparation of drugs for treating liver aging specifically refers to the use of the drug to promote overexpression of the YAP1 gene in the body of an aging liver host.
[0008] Overexpression is to insert the YAP1 gene into a lentiviral vector, package lentivirus in 293T cells, transfect HepG2215 cells with liposomes, and screen for a stable cell line with overexpressed YAP1.
[0009] YAP1 The overexpression lentiviral vector is provided by Cyagen Biosciences Guangzhou Co., Ltd.
[0010] The present invention also provides a drug that can promote overexpression of the YAP1 gene in the body of an aging liver host, and the drug can be various pharmaceutically acceptable dosage forms.
[0011] NC sequence: CCCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCT.
[0012] YAP1 Overexpression sequence: CCCTGACTCCACAGCATGTTCGAGCTCATGACTCTCCAGCTTCTCTGCAGTTGGGAGCT.
[0013] The beneficial effects produced by adopting the above technical solutions are as follows: Hepatocyte YAP1 is an important marker of liver aging. Increasing the expression of hepatocyte YAP1 is a potential target for intervening in liver aging and can also be used to prepare drugs for treating liver aging and related diseases. Description of the Drawings
[0014] Figure 1 YAP1 deficiency leads to liver aging in mice; (A) Specific knockout of the liver of mice by AAV8 in hepatocytes Yap1 ; (B) Western blot analysis of YAP1 expression in mouse liver tissues; (C) H&E staining analysis of pathological changes in the livers of aging mice; (D) SA-β-gal staining of mouse livers; (E) IHC analysis of Ki67-positive cells in mouse livers; (F) Western blot analysis of P21 expression in mouse liver tissues; (G) IHC analysis of P21 expression in mouse livers; (H) Using CRISP / Cas9 technology to knockout the Yap1 gene in AML12 cells; (I) Western blot analysis of YAP1 expression in AML12 cells; (J) SA-β-gal staining of AML12 cells; (K) Western blot analysis of P21 expression in AML12 cells.
[0015] Figure 2 Reduced activity of hepatocyte YAP1 induces DNA damage in the livers of aging mice and activates the cGAS-STING pathway; (A) Western blot analysis of the expression of α-SMA and γ-H2AX in mouse liver tissues; (B) IHC analysis of the expression of α-SMA and γ-H2AX in mouse liver tissues; (C) Western blot analysis of the cGAS-STING pathway in mouse liver tissues; (D) IHC analysis of the expression of cGAS and STING in mouse liver tissues; (E) Western blot analysis of the expression of α-SMA and γ-H2AX in AML12 cells; (F) Western blot analysis of the cGAS-STING pathway in AML12 cells.
[0016] Figure 3 Reduced YAP1 activity in hepatocytes leads to oxidative stress in the livers of senescent mice; (A) Detection of the AST level in mouse serum; (B) Detection of the ALT level in mouse serum; (C) Detection of the SOD levels in mouse serum and liver; (D) Detection of the CAT levels in mouse serum and liver; (E) Detection of the MAD levels in mouse serum and liver.
[0017] Figure 4 Reduced YAP1 activity in hepatocytes induces PLIN2-mediated lipid droplet deposition in the livers of senescent mice; (A) Pearson correlation analysis of different samples; (B) Lipid composition analysis of mice in different groups; (C) Non-targeted lipid analysis of the TG content in mouse liver; (D) Hierarchical clustering analysis of the lipid composition of the livers of mice in each group based on significant lipid differences; (E) Analysis of the TG content in mouse serum, liver, and feces; (F) Oil Red O staining analysis of mouse liver; (G) Western blot analysis of the expression of PLIN2 in mouse liver tissues; (H) IHC analysis of the expression of PLIN2 in mouse liver tissues.
[0018] Figure 5 Reduced YAP1 activity in hepatocytes alters the intestinal flora structure of senescent mice and reduces the abundance of Akkermansia; (A) Sequencing depth map of 16S rRNA gene sequencing of mouse intestinal flora; (B) PCoA map of mice in different groups; (C) Microbial abundance composition map (top 10) of mouse intestines at the phylum level in different groups; (D) Microbial abundance composition map (top 10) of mouse intestines at the genus level in different groups; (E) Microbial abundance composition map (top 10) of mouse intestines at the species level in different groups; (F) Heat map of the top twenty microorganisms at the species level in each group of mice; (G) LefSe analysis of the intestinal flora of mice in different groups; (H) Detection of the total bacteria and A. muciniphila abundance of
[0019] Figure 6Reduced hepatocyte YAP1 activity weakens the intestinal barrier in aged mice; (A) HE staining of mouse colon; (B) PAS staining of mouse colon; (C) IHC analysis of ZO-1 expression in mouse liver tissue; (D) IHC analysis of Occulidin expression in mouse liver tissue.
[0020] Figure 7 Reduced hepatocyte YAP1 activity weakens the intestinal barrier in aged mice; (A) Lentivirus transfection to overexpress HepG2215 cells Yap1 gene; (B) Western blot analysis of YAP1 expression in HepG2215 cells; (C) SA-β-gal staining of HepG2215 cells; (D) Western blot analysis of P21 expression in HepG2215 cells. Detailed implementation mode Example 1
[0021] Use of the YAP1 gene in the preparation of a drug for treating liver aging.
[0022] Manifestations of liver aging include: DNA damage in hepatocytes, activation of the cGAS-STING pathway in hepatocytes; liver oxidative stress; PLIN2-mediated lipid droplet deposition in the liver; accelerated intestinal microbiota dysbiosis and decreased abundance of Akkermansia; increased intestinal permeability; metabolic disorders and lipid accumulation.
[0023] The use in the preparation of a drug for treating liver aging specifically refers to overexpression of the YAP1 gene in the body of an aged liver host.
[0024] Experimental verification I. Materials and methods 1. Animals The female Yap1Flox / Flox (Yap1Flox) C57BL / 6 mice used in this invention were freely raised in a SPF environment with free access to food and water. These mice were established and identified by Cyagen Biosciences (Guangzhou, China). AAV8-TBG-Cre or AAV8-TBG-Control viral vectors were injected into 12-month-old female Yap1Flox mice to construct Yap1 KO mice and Yap1 Cont mice, respectively. The mice were anesthetized and sacrificed at 13 months of age. The TBG liver-specific promoter in AAV8-TBG-Cre drives Cre expression, and these viral vectors were provided by BrainVTA Technology (Wuhan, China). The experimental protocol was approved by the Animal Experiment Ethics Committee of Shanxi University of Traditional Chinese Medicine (AWE202305321).
[0025] 2. Cell culture and transfection AML12 hepatocytes (product number FH0338) were purchased from Shanghai Fuhong Biotechnology Co., Ltd. The cells were cultured in DMEM / F-12 medium (11320-033, Gibco, USA) containing 1% insulin-transferrin-selenium and sodium pyruvate (ITS-A, 51300044, Gibco, USA), 10% fetal bovine serum (FBS), and 1% penicillin-streptomycin solution, and incubated at 37°C in a humidified environment of 95% air and 5% CO2. The cells were transfected with sgRNA targeting YAP1 using a transfection reagent (G2500, Applied Biological Materials Inc, Canada). The sequence of sgNC was: GCGTGATCTTCACCGACAAG, sg Yap1 The sequence of was: CCACCCAGGACGCCTCCCTG.
[0026] YAP1 The overexpression lentiviral vector was provided by Cyagen Biosciences Inc. (Guangzhou, China). Liposome transfection was used to package lentivirus in 293T cells, and the lentivirus was used to infect HepG2215 cells to screen for stable YAP1 overexpressing cell lines. NC sequence: CCCTGACTCCACAGCATGTTCGAGCTCATTCCTCTCCAGCTTCTCTGCAGTTGGGAGCT; YAP1 Overexpression sequence: CCCTGACTCCACAGCATGTTCGAGCTCATGACTCTCCAGCTTCTCTGCAGTTGGGAGCT.
[0027] 3. Determination of alanine aminotransferase (ALT) and aspartate aminotransferase (AST) activities The enzyme activities of ALT (C009-2-1, NJJCBIO, China) and AST (C010-2-1, NJJCBIO, China) in mouse serum were determined by the microplate method. The experiment was carried out according to the instructions. The 96-well plate was placed in a microplate reader to measure the OD value at a wavelength of 510 nm. The activities of ALT and AST in the samples were calculated according to the standard curve.
[0028] 4. Determination of catalase (CAT), superoxide dismutase (SOD) and malondialdehyde (MDA) contents Kits for CAT (A007-1-1), SOD (A001-3) and MDA (A003-1) were purchased from Nanjing Jiancheng Bioengineering Institute (Nanjing, China). According to the instructions of the corresponding kits, the absorbances of CAT, SOD and MDA were measured at wavelengths of 405 nm and 532 nm respectively. The contents of CAT, SOD and MDA in the samples were calculated according to the formula.
[0029] 5. Hematoxylin-Eosin (H&E) staining Liver and intestinal tissues were cut into sections of 5 μm and 3 μm respectively, using an automatic rotary microtome (S710, RWD, China). Staining was performed according to the kit instructions (BA4025, Baso, Guangzhou, China), and images were taken using a microscope (DM4B, Leica, Germany).
[0030] 6. Senescence-associated β-galactosidase (SA-β-gal) staining The SA-β-gal staining experiment was performed using an SA-β-gal staining kit (APEK2185, APExBIO, USA) according to the manufacturer's instructions. At the end of the experiment, freshly collected liver tissue was immediately frozen, embedded in OCT and sectioned at a thickness of 4 μm. The sections were fixed at room temperature for 5 minutes and stained at 37°C. After staining, the sections were counterstained with eosin. For cultured cells, the cells were fixed with 4% paraformaldehyde for 5 minutes, washed three times with PBS, and then the samples were incubated at 37°C for 16 - 18 hours, and the enzymatic reaction was stopped with ice-cold PBS. Finally, the sections were photographed using a microscope (DM4B, Leica, Germany), and the ratio of positive cells was calculated by counting the proportion of blue cells.
[0031] 7. Determination of triglyceride (TG) content Serum and liver samples (weight to volume ratio of 1:9, diluted with normal saline) were prepared, and the concentration of liver samples was measured. The experimental procedure was carried out according to the instructions (A110-1, NJJCBIO, China), and the absorbance was measured at a wavelength of 500 nm. The TG content in the samples was calculated using the corresponding formula.
[0032] 8. Real-time quantitative PCR experiment DNA was extracted from mouse fecal samples using a fecal DNA extraction kit (D2700, Solarbio, China). DNA, primers, ddH2O, and SuperReal PreMix Plus (W0229, Tiangen, Beijing) were added to each well respectively. The PCR experiment was performed using a PCR instrument (bio-rad, USA). The changes in the total bacteria and A. muciniphila abundances in the mouse intestine were analyzed by the 2 -△△CT method.
[0033] 9. PAS staining A PAS staining kit (R20526, Yuanye, China) was used and the operation was carried out according to the instructions. Goblet cells were stained magenta, and observed and photographed using a microscope (DM4B, Leica, Germany).
[0034] 10. Oil Red O staining The frozen liver tissues were cut into 6-μm sections and stained according to the instructions in the tissue Oil Red kit (G1261, Solarbio, China). Images were observed and taken using a Leica microscope (DM4B, Germany).
[0035] 11. Western blot Western blot analysis was performed according to the established method. The primary antibodies included rabbit monoclonal antibody against YAP1 (14074S, CST, 1:1000), rabbit polyclonal antibody against P21 (30427, SAB, 1:1000), rabbit monoclonal antibody against α-SMA (PTM-5671, PTM-BIO, 1:1000), rabbit monoclonal antibody against γH2AX (Ser139) (PTM-727, PTM-BIO, 1:1000), antibody against cGAS (29958-1-AP, Proteintech, 1:1000), antibody against STING (13647, CST, 1:1000), TBK1 (ab40676, Abways, 1:1000), rabbit monoclonal antibody against p-TBK1 (Ser172) (5483S, CST, 1:1000), rabbit polyclonal antibody against Perilipin-2 (15294-1-AP, proteintech, 1:1000), rabbit monoclonal antibody against Vinculin (PTM-6939, PTM-BIO, 1:1000), and mouse monoclonal antibody against GAPDH (60004-1-1g, proteintech, 1:50000). The secondary antibodies were goat anti-rabbit IgG-HRP (abs20040, Absin, 1:5000) or goat anti-mouse IgG-HRP (AB0102 Abways, 1:5000). The target bands were observed and taken using a chemiluminescence imaging system (Chemidoc, bio-rad, USA).
[0036] 12. Immunohistochemistry (IHC) staining After repairing liver tissue antigens, the operation was carried out according to the instructions provided by Zhongshan Jinqiao IHC reagent (PV-9000, Beijing, China). The primary antibodies included P21 rabbit polyclonal antibody (30427, SAB, 1:1000), α-SMA rabbit monoclonal antibody (PTM-5671, PTM-BIO, 1:50), γH2AX (Ser139) rabbit monoclonal antibody (PTM-727, PTM-BIO, 1:200), cGAS antibody (29958-1-AP, Proteintech, 1:200), STING antibody (13647, CST, 1:200), Perilipin-2 rabbit polyclonal antibody (15294-1-AP, proteintech, 1:200). Images were taken using a microscope (DM4B, Leica, Germany).
[0037] 13. 16S rRNA gene sequencing At 13 months of age, mouse feces were collected and sent to Personalbio Technology Co., Ltd. (Shanghai, China) for 16S rRNA gene sequencing. The main steps included total DNA extraction of the microbiome, PCR amplification of the target fragment, detection and quantification of the amplification product, preparation of the sequencing library, and high-throughput sequencing. The primer sequences were (F: ACTCCTACGGGAGGCAGCA, R: GGACTACHVGGGTWTCTAAT). Subsequent analysis was completed on the Gene Cloud platform.
[0038] 14. Lipidomics analysis This process mainly included sample preparation, quality control settings, LC-MS / MS mass spectrometry analysis, and subsequent data interpretation. Through tandem mass spectrometry (LC-MS / MS), a comprehensive and unbiased analysis of various lipid species in the samples was performed. Then, the absolute concentration of lipids was obtained by the internal standard method, and the differences between groups and within groups were analyzed. Mouse liver samples were taken out and sent to Shanghai Personalbio Biotechnology Co., Ltd. for untargeted metabolic analysis.
[0039] 15. Statistical analysis GraphPad Prism 9.3 was used for statistical analysis and chart drawing. The t-test was used to analyze the normally distributed data, P and <0.05 was considered statistically significant.
[0040] II. Conclusions 1. Hepatocyte-specific knockout of Yap1 leads to liver senescence in mice AAV8 was used to intervene in 12-month-old senescent mice to knockout Yap1 ( Figure 1 A). At the 13th month, hepatocytes were detected Yap1Specifically knocked out ( Figure 1 B). Through H&E staining analysis, it was found that Yap1 -KO mouse hepatocytes had an increased cell volume, and lipid droplet vacuoles appeared in the hepatocytes, suggesting that hepatocyte Yap1 deletion led to liver senescence in mice ( Figure 1 C). The activity of the senescence biomarker SA-β-gal was detected by SA-β-gal staining. The results showed that specific knockout of hepatocytes Yap1 significantly increased the proportion of SA-β-gal-positive hepatocytes in the mouse liver ( Figure 1 D). By IHC analysis of liver Ki67 expression, it was found that Yap1 knockout significantly decreased the proportion of Ki67-positive cells in the mouse liver ( Figure 1 E). P21 is another typical senescence marker. We analyzed the expression of P21 in mouse liver tissues by Western blot and IHC. The results showed that Yap1 knockout led to a significant increase in the expression of P21 or the proportion of P21-positive cells in the liver ( Figure 1 F and 1G). Meanwhile, we used CRISP / Cas9 technology to knock out Yap1 gene in normal mouse AML12 hepatocytes ( Figure 1 H). After sgRNA transfection, we used western blot analysis to confirm the decrease in YAP1 protein expression level ( Figure 1 I). As expected, Yap1 gene knockout led to an increase in the proportion of SA-β-gal-positive cells and a significant increase in P21 expression in AML12 cells ( Figure 1 J and 1K). In summary, we confirmed in animal experiments and in vitro experiments that YAP1 deletion led to senescence of hepatocytes and the liver.
[0041] 2. Decreased YAP1 activity in hepatocytes induces DNA damage in the liver of senescent mice and activates the cGAS-STING pathway DNA damage is an important factor leading to senescence. We further detected the cell DNA damage markers α-SMA and γ-H2AX. Through western blot and IHC analysis, it was found that specific knockout of hepatocytes Yap1 significantly increased α-SMA and γ-H2AX in the mouse liver ( Figure 2 A and 2B), suggesting that decreased YAP1 activity induced liver DNA damage, resulting in genomic instability of hepatocytes. We further analyzed the cGAS-STING pathway in mouse liver by western blot and IHC. Specific knockout of hepatocytes Yap1Activation of mouse liver tissue significantly increased the expression of cGAS, STING, and p-TBK1 ( Figure 2 C and 2D), suggesting activation of the innate immune function of hepatocytes. In Yap1 AML12 cells with gene knockout, the DNA damage markers α-SMA and γ-H2AX were elevated, and the cGAS-STING pathway was activated ( Figure 2 E and 2F). In summary, decreased YAP1 activity induced DNA damage in hepatocytes and activated the cGAS-STING pathway in hepatocytes.
[0042] 3. Decreased YAP1 activity in hepatocytes leads to oxidative stress in the liver of aging mice Oxidative stress is another important factor inducing cellular senescence. The results of serum biochemical experiments showed that the activities of serum AST and ALT enzymes in hepatocyte-specific Yap1 knockout aging mice increased, suggesting liver damage ( Figure 3 A). We further detected the activities of antioxidant enzymes and the production of lipid peroxides in the serum and liver of mice. The results showed that compared with Yap1 Cont group mice, Yap1 the activities of antioxidant enzymes SOD and CAT in the serum and liver of KO group mice were significantly decreased ( Figure 3 B and 3C), while the content of lipid peroxide MDA increased ( Figure 3 D). These results indicate that hepatocyte-specific Yap1 knockout weakened the antioxidant function of the liver in aging mice, leading to liver damage.
[0043] 4. Decreased YAP1 activity in hepatocytes induces PLIN2-mediated lipid droplet deposition in the liver of aging mice During the aging process, excessive accumulation of cellular lipids triggers various diseases. Therefore, we used untargeted lipid analysis to characterize the regulation of lipid metabolism in the liver of aging mice by decreased YAP1 activity in hepatocytes. The correlation coefficient between quality control (QC) samples was greater than 0.9 ( Figure 4 A), indicating the reliability of the experimental results. Analysis of the main lipid components and their content distribution showed that compared with Yap1 Cont group mice, Yap1 the proportion of phosphatidylethanolamine (PE) in the liver of KO group mice decreased, while the proportion of triglyceride (TG) increased ( Figure 4 B). Comparison of the content of TG subclasses between groups showed that Yap1 the TG content in the liver of KO group mice was significantly higher than that of Yap1 Cont group mice ( Figure 4 C). Based on significantly different lipids (VIP>1, PExpression (<0.05) was analyzed by hierarchical clustering analysis of samples from each group, and it was found that Yap1 the content of TG with different chain lengths in KO group mice increased ( Figure 4 D). We further analyzed the TG content in mouse serum, liver and feces, and the results confirmed that compared with Yap1 Cont group mice, Yap1 the TG content in serum, liver and feces of KO group mice increased significantly ( Figure 4 E). Oil red O staining of mouse liver tissue showed that cell-specific knockout Yap1 increased lipid droplet deposition in the livers of aging mice ( Figure 4 F). PLIN2 on the surface of lipid droplets is a marker of cellular lipid accumulation [8] . Through western blot and IHC analysis, it was found that cell-specific knockout Yap1 significantly reduced the expression of PLIN2 in the liver tissue of aging mice ( Figure 4 F and 4G). Decreased YAP1 activity in hepatocytes induced PLIN2-mediated lipid droplet deposition in the livers of aging mice, leading to lipid accumulation.
[0044] 5. Decreased YAP1 activity in hepatocytes accelerated the dysbiosis of the gut microbiota in aging mice and reduced the abundance of Akkermansia Aging is a major factor affecting the human gut microbiota, and identifying and intervening in gut microbiota is a potential way to delay aging. YAP1 plays an important role in regulating gut microbiota balance. However, whether the anti-aging effect of YAP1 is related to gut microbiota is not clear. Therefore, we used 16S rRNA gene sequencing to detect changes in the gut microbiota structure of mice. The species dilution curve showed that as the sequencing depth increased, the curve tended to flatten, verifying the reliability of the data ( Figure 5 A). At the same time, Yap1 the total number of OTUs in the gut of KO group mice was higher than that of Yap1 Cont group mice, and the PCoA plot showed obvious separation between the two groups ( Figure 5 A and 5B). These results indicate that there are significant differences in biodiversity between the two groups of mice. We analyzed the composition and structure of the gut microbiota of the mice in the group at different taxonomic levels. At the phylum level, it was observed that Verrucomicrobia (Verrucomicrobia) abundance decreased significantly, while the ratio of Firmicutes (Firmicutes) to Bacteroidetes (Bacteroidetes) (F / B ratio) increased ( Figure 5 C). Then, we analyzed the changes in the gut microbiota of mice at the genus and species levels. At the genus level, Yap1 in the gut of KO group mice Allobaculum and AkkermansiaThe abundance of Lactobacillus (Lactobacillus) was significantly increased ( Figure 5 D). Species composition analysis and heatmap showed that hepatocyte-specific knockout of Yap1 reduced the abundance of A. muciniphila (Akkermansia muciniphila) and B. pseudolongum (Bifidobacterium pseudolongum subsp.) in the intestine of mice, and increased the abundance of L. reuteri (Lactobacillus reuteri) ( Figure 5 E and 5F). LEfSe analysis found that Allobaculum and Akkermansia were Yap1 biomarkers of the intestinal tract of mice in the Cont group, while Lactobacillus was Yap1 a biomarker of the intestinal tract of mice in the KO group ( Figure 5 G), suggesting that Akkermansia muciniphila might be the main altered intestinal microorganism in hepatocyte-specific knockout aging mice Yap1 gene. We further detected the abundance of Akkermansia muciniphila in the intestine of mice. Compared with Yap1 the Cont group, Yap1 the abundance of Akkermansia muciniphila in the intestine of mice in the KO group was significantly decreased ( Figure 5 H). The above results indicate that the decrease in hepatocyte YAP1 activity accelerates the intestinal flora dysbiosis in aging mice, and hepatocyte-specific knockout of Yap1 reduces the abundance of Akkermansia muciniphila in aging mice.
[0045] 6. Decrease in hepatocyte YAP1 activity weakens the intestinal barrier of aging mice Intestinal barrier dysfunction is another important feature of aging. We detected the structural changes of the intestinal tract of mice by H&E staining and PAS staining respectively. The results of H&E staining showed that compared with Yap1 mice in the Cont group, Yap1 KO mice had increased infiltration of inflammatory cells in the intestine, deeper crypts, and thinner mucosa, suggesting that specific knockout of hepatocytes Yap1 accelerated the intestinal aging of mice ( Figure 6 A). The results of PAS staining showed that compared with Yap1 mice in the Cont group, Yap1 KO mice had a reduced number of goblet cells in the intestine, irregular morphology, and sparse PAS-positive granules in the cytoplasm, suggesting that hepatocyte-specific knockout of Yap1 led to the decline of intestinal barrier function in mice ( Figure 6 B). Then, the expressions of tight junction proteins ZO-1 and occludin in the intestine of mice were analyzed by IHC. The results showed that compared with Yap1 mice in the Cont group, Yap1The expression of intestinal tight junction proteins ZO-1 and occludin in KO mice decreased significantly, indicating cell-specific knockout Yap1 resulted in increased intestinal permeability in mice ( Figure 6 C and 6D).
[0046] 7. Overexpression of hepatocyte YAP1 slows down aging We overexpressed the YAP1 gene in HepG2215 cells by lentiviral transfection ( Figure 7 A). After overexpression, we confirmed the increase in YAP1 protein expression level by Western blot analysis ( Figure 7 B). As expected, YAP1 gene overexpression led to a decrease in the proportion of SA-β-gal positive cells and a significant reduction in P21 expression in HepG2215 cells ( Figure 7 C and 7D). In summary, we further confirmed that overexpression of YAP1 can slow down the aging of hepatocytes.
Claims
1. Application of YAP1 gene in the preparation of drugs for treating liver aging.
2. The use according to claim 1, characterized in that: Liver aging symptoms include: DNA damage in hepatocytes and activation of the cGAS-STING pathway in hepatocytes; liver oxidative stress; PLIN2-mediated lipid droplet deposition in the liver; accelerated intestinal flora imbalance and reduced abundance of AKK bacteria; increased intestinal permeability; metabolic disorders and lipid accumulation.
3. The use according to claim 1 or 2, characterized in that: The drug is used for promoting overexpression of YAP1 gene in an aged liver host.
4. The use according to claim 3, characterized in that: The overexpression is YAP1 The gene was inserted into a lentiviral vector, the lentivirus was packaged in 293T cells, and HepG2215 cells were transfected with liposomes to screen YAP1 overexpressing stable cell lines.
5. The medicine for treating liver aging prepared by the use of claim 4.