Application of SND1 deletion-based tag modified tumor exosome vaccine

Abstract

The invention discloses an application of a tumor exosome vaccine modified by a label based on SND1 deletion, and particularly relates to an application of a tumor exosome vaccine modified by the label based on SND1 deletion and carrying IL-12 mRNA and modified by the label based on SND1 deletion in an anti-tumor curative effect, and the label modified exosome is KO-Exo at IL-12. The tag modified exosome KO-Exo-coated IL-12 disclosed by the invention is lack of proteins such as an immune checkpoint CD47 carried by the tumor exosome, so that the phagocytic ability of macrophages to the KO-Exo-coated IL-12 is enhanced. The KO-Exo-coated IL-12 can activate an STING signal channel, promote phenotypic transformation of macrophages to M1 type, enhance T cell cytotoxicity and enhance the anti-tumor curative effect at the same time.

Description

Technical Field

[0001] The present invention relates to the field of biomedical technology, and in particular to the application of a tumor exosome vaccine modified by a tag based on SND1 deletion. Background Art

[0002] Cancer treatment is currently divided into five major treatment strategies: surgery, radiotherapy, chemotherapy, targeted therapy and immunotherapy, and the latter two are new strategies for tumor diagnosis and treatment. Existing treatment strategies have many limitations, mainly in the following aspects.

[0003] First, tumors are highly heterogeneous, making individualized treatment difficult to achieve. Some researchers developed tumor vaccines based on common tumor antigens, that is, allogeneic vaccine development. Although the initial preparation is simple, it cannot overcome individual differences among patients, and the treatment effect is limited. However, as research deepens, it is found that tumors are highly heterogeneous, prompting researchers to pay more attention to specific tumor antigens to achieve individualized treatment. Currently, some researchers use autologous tumor tissues or cells to prepare tumor vaccines, but they are limited by the time-consuming and labor-intensive development of autologous vaccines, poor immunogenicity, and difficulty in obtaining tumor-specific antigens.

[0004] Secondly, patients have limited targeted therapeutic drugs, making it difficult to achieve precision treatment. In the existing clinical data, only 15% of cancer patients can choose marketed targeted drugs based on sequencing results; 10% of cancer patients can use targeted drugs that are still in the clinical trial stage; and another 10%-15% of patients can use targeted drugs that are still in the animal experiment stage. The research and development of tumor treatment drugs also has many difficulties, such as poor ability to specifically attack tumor cells and poor drugability. Based on this, under the policy of advocating precision and individualized treatment of tumors, there are still a large number of patients in a difficult situation where there are no suitable drugs available.

[0005] Third, tumor treatment has certain side effects that affect the quality of life of patients. In traditional tumor treatment programs, therapeutic drugs will indiscriminately attack normal cells and tissues, seriously affecting the quality of life of tumor patients. As research continues to deepen, tumor targeting continues to improve, but the side effects of tumor treatment still exist. For example, patients will experience rashes, hypertension, thrombosis, diarrhea, pneumonia, etc. after treatment, which still plague the quality of life of tumor patients during treatment and are also problems that need to be solved urgently. Summary of the invention

[0006] The purpose of the present invention is to provide an application of a tumor exosome vaccine modified by a tag based on SND1 deletion to solve the technical problems of side effects and difficulty in precise treatment of tumors in the prior art.

[0007] To achieve the above object, the present invention provides the following technical solutions: Application of tumor exosome vaccine with label modification based on SND1 deletion provided by the present invention.

[0008] Furthermore, application of tumor exosome vaccine with label modification based on SND1 deletion in anti-tumor treatment.

[0009] Furthermore, the exosome is KO-Exo.

[0010] Furthermore, the exosome is prepared by the following steps: (1) Cultivate wild-type B16F10 cells with DMEM containing 10% fetal bovine serum until the cell confluence reaches 60%-70%, and transfer the CRISPR / CAS9 plasmid using Neofect transfection reagent, where the third exon sequence of the SND1 gene can be recognized, and the sequences F: TCCCAATCAGCTTCTTGCGA and R: CTCCCCAGGGACGAGAGTAT are cloned onto the PX462 empty plasmid. (2) After 48 hours of transfection, screen the cells with 2 mg / ml puromycin for 3 days, then digest with trypsin, take 1 μl of cell suspension and add it to a 10 cm dish to culture until cell clusters visible to the naked eye are formed. (3) Pick monoclonal cells with a pipette tip and transfer them into a 96-well plate for culture. When the cell confluence in each well reaches 90%, passage them to a 48-well plate; when the cell confluence in each well reaches 90%, passage them to a 12-well plate; when the cell confluence reaches 90%, take half for subsequent Western blot identification, and passage the other half to a 6-well plate for continued culture. Identify the cells with SND1 knocked out, continue to culture and cryopreserve them. (4) Culture B16F10 SND1-KO cells in a 10 cm dish. When the cell confluence reaches 70%, wash the cells with PBS, replace the medium with exosome-free medium and culture for 48 hours, then collect the cell supernatant, remove cells by centrifugation at 500 g for 10 minutes at 4°C; remove dead cells by centrifugation at 2000 g for 20 minutes at 4°C; remove cell debris and large vesicles by centrifugation at 11000 g for 30 minutes at 4°C; then filter through a 0.2 μm filter; further obtain exosomes by ultracentrifugation at 120000 g for 1 hour and 30 minutes at 4°C; resuspend with PBS and wash by centrifugation at 120000 g for 1 hour and 30 minutes at 4°C to obtain exosomes.

[0011] The present invention also provides an application of a tumor exosome with label modification based on the deletion of tumor protein SND1 in the preparation of anti-tumor drugs, and the exosome is KO-Exo.

[0012] Furthermore, the exosome can load IL-12 mRNA (1)Construct nucleic acid sequences expressing IL-12 (p35 subunit) and (p40 subunit), which sequences contain 5’Cap + 5’UTR + IL-12A + linker + IL-12B + 3’UTR + Poly-A, (2)Transfer IL-12 mRNA into KO-Exo by electroporation, and detect the size and morphology of KO-Exo@ IL-12 by NTA and transmission electron microscopy, and detect the loading efficiency of IL-12 mRNA.

[0013] In the present invention, KO-SND1 exosomes are phagocytosed more strongly by macrophages, enabling more of their content dsDNA to be phagocytosed by macrophages, activating the cGAS-STING signaling pathway in macrophages, activating the phosphorylation of downstream TBK1 and p65 proteins, enabling phosphorylated p65 to enter the nucleus. p65 is a transcription factor for classical inflammatory factors, effectively initiating the transcription of downstream inflammatory factors such as IL-6 and TNF-α, ultimately promoting the M1 polarization of macrophages. Based on the above technical solutions, the present invention can at least produce the following technical effects: (1)Exosome vaccines have a double-membrane vesicle structure and can serve as natural transport carriers. Tumor-derived exosome vaccines have a tumor homing effect, and SND1-KO labeled modified exosomes can preferentially target macrophages in tumor foci. Loading IL-12 mRNA can achieve twice the result with half the effort and enhance the efficacy of tumor treatment.

[0014] (2)By genetically editing tumor exosome vaccines to reduce the proteins such as immune checkpoint CD47 and integrin carried by tumor exosomes, enhancing the phagocytosis and uptake of tumor exosomes by macrophages. The dsDNA carried by tumor exosomes can activate the STING signaling pathway, promoting the phenotypic conversion of macrophages to the M1 type, better activating the anti-tumor activity in the tumor immune microenvironment, thereby achieving better tumor vaccine efficacy. Loading IL-12 mRNA can effectively enhance the killing effects of T cells and NK cells and enhance the anti-tumor efficacy. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 are the results of Western Blot and Duolink experiments in the embodiments of the present invention, where Figure 1 A is the result of the Western Blot experiment, Figure 1 B is the result of the Duolink experiment.

[0016] Figure 2 is the result diagram of the immunofluorescence experiment in the embodiments of the present invention.

[0017] Figure 3It is a diagram showing that the SND1-KO-Exo in the embodiment of the present invention promotes the M1 polarization of macrophages.

[0018] Figure 4 It is a diagram showing that the SND1-KO-Exo in the embodiment of the present invention promotes the M1 polarization of macrophages by activating STING-TBK1-NF-κB.

[0019] Figure 5 It is a diagram of the experimental results of constructing an in-situ model of mouse melanoma in the embodiment of the present invention and injecting SND1-KO melanoma-derived exosomes and IL-12 mRNA-loaded KO-Exo. Detailed implementation manners

[0020] Now, various exemplary implementation manners of the present invention will be described in detail. This detailed description should not be considered as a limitation of the present invention, but should be understood as a more detailed description of certain aspects, characteristics, and implementation schemes of the present invention.

[0021] It should be understood that the terms described in the present invention are only for describing specific implementation manners and are not used to limit the present invention. Additionally, for the numerical ranges in the present invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Each intermediate value within any stated value or stated range, as well as each smaller range between any other stated value or intermediate value within the stated range, is also included in the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0022] Unless otherwise specified, all technical and scientific terms used herein have the same meaning as commonly understood by those of ordinary skill in the art to which the present invention pertains. Although the present invention only describes preferred methods and materials, any methods and materials similar or equivalent to those described herein can also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials related to the documents. In case of conflict with any incorporated document, the content of this specification shall prevail.

[0023] Without departing from the scope or spirit of the present invention, various improvements and changes can be made to the specific implementation manners of the present invention specification, which are obvious to those skilled in the art. Other implementation manners obtained from the present invention specification are obvious to those skilled in the art. The present invention specification and embodiments are only exemplary.

[0024] Regarding the terms "comprising", "including", "having", "containing", etc. used herein, they are all open-ended terms, meaning including but not limited to.

[0025] 1. Gene editing and modification of tumor cells a) Culture wild-type B16F10 cells in DMEM containing 10% fetal bovine serum until the cell confluence reaches 60%-70%. Transfect the CRISPR / CAS9 plasmid (PX462) using the Neofect transfection reagent, where the third exon sequence of the SND1 gene can be recognized. The sequences F: TCCCAATCAGCTTCTTGCGA and R: CTCCCCAGGGACGAGAGTAT are cloned onto the empty PX462 plasmid.

[0026] b) After 48 hours of transfection, screen the cells with 2 mg / ml puromycin for 3 days. Then digest the cells with trypsin, and take 1 μl of the cell suspension and add it to a 10 cm dish for culture until cell clusters visible to the naked eye are formed.

[0027] c) Pick monoclonal cells with a pipette tip and transfer them into a 96-well plate for culture. When the cell confluence in each well reaches 90%, passage them to a 48-well plate; when the cell confluence in each well reaches 90%, passage them to a 12-well plate; when the cell confluence reaches 90%, take half for subsequent Western blot identification, and passage the other half to a 6-well plate for continued culture. Identify the cells with SND1 knocked out and continue to culture and cryopreserve them.

[0028] 2. Obtain KO-Exo by differential centrifugation Culture B16F10 SND1-KO cells in a 10 cm dish. When the cell confluence reaches 70%, wash the cells with PBS and replace the medium with exosome-free medium for 48 hours. Then collect the cell supernatant and centrifuge at 500 g for 10 minutes at 4°C to remove cells; centrifuge at 2000 g for 20 minutes at 4°C to remove dead cells; centrifuge at 11000 g for 30 minutes at 4°C to remove cell debris and large vesicles; then filter through a 0.2 μm filter; and then obtain exosomes by ultracentrifugation at 120000 g for 1 hour 30 minutes at 4°C; resuspend with PBS, and then centrifuge at 120000 g for 1 hour 30 minutes at 4°C to wash the exosomes. Finally, resuspend with PBS for subsequent detection.

[0029] 3. Identify the purity and quality of the extracted engineered exosomes by nanoparticle tracking analyzer (NTA), transmission electron microscope (TEM), and Western blot a) Identify the concentration and particle size of exosomes by NTA b) Stain exosomes with phosphotungstic acid and observe the morphology of exosomes by transmission electron microscopy c) Identify exosome positive markers: CD63, CD81, TSG101 and exosome negative marker: Calnexin by Western blot; Store the qualified exosomes at -80°C.

[0030] 1. Prepare tumor vaccines by extracting tumor-derived exosomes, and effectively and conveniently obtain tumor-specific antigens.

[0031] 2. Modify tumor exosome vaccines through gene editing technology to improve the antigen presentation efficiency in tumor exosomes.

[0032] 3. Modify tumor exosome vaccines through gene editing technology to reduce the proteins such as immune checkpoint CD47 carried by tumor exosomes, enhance the phagocytosis of tumor exosomes by macrophages, promote the phenotypic conversion of macrophages to the M1 type, and better activate the anti-tumor activity in the tumor immune microenvironment, so as to achieve better tumor vaccine efficacy.

[0033] 4. Tumor-derived exosome vaccines have a homing effect and a transport function, and can be combined with the transfected IL-12 mRNA to enhance the efficacy of tumor treatment. 5. Modify tumor exosome vaccines through gene editing technology, which has natural adjuvant components and can effectively promote the innate and acquired immune responses against tumors.

[0034] It was demonstrated by Western Blot and Duolink experiments that KO-Exo could effectively alleviate the activation of the CD47-SIRPa phagocytosis inhibitory regulatory axis by reducing the enrichment of CD47 protein in late endosomes into exosomes. It was found through in vitro experiments that KO-Exo could be better phagocytosed and taken up by macrophages. (As shown in Figure 1 and Figure 2 ) Figure 1 A: Through Western blot experiments, the expression of CD47 in wild-type and KO-SND1 melanoma cells and the enrichment of CD47 in the exosomes secreted by them were detected. It was found that the enrichment of CD47 protein could be reduced in the exosomes of KO-SND1. Figure 1 B: Through Duolink experiments (proximity ligation assay), inside the cells, PLA probes were used to analyze whether the positions of the two proteins were close enough. When the two were close enough (<40 nm), a PLA signal would be generated, reflecting the influence of the presence of SND1 in the cells on the enrichment of CD47 in late endosomes (CD63). It was found that SND1 promoted the entry of CD47 into late endosomes, thus promoting the enrichment of CD47 in secreted exosomes.

[0035] Figure 2A: Through immunofluorescence experiments, wild-type and KO-SND1 melanoma exosomes were extracted, and the exosomes were labeled with DiO dye. DiO-labeled wild-type exosomes and KO-SND1 exosomes were co-cultured with BMDMs for 8 h. By analyzing the intensity of the green fluorescence signal inside BMDMs, the uptake of fluorescently labeled exosomes by BMDMs was analyzed, and it was found that KO-Exo could be better taken up by macrophages; Figure 2 B: Through immunofluorescence experiments, the uptake of DiO-labeled wild-type exosomes and KO-SND1 exosomes by macrophages was analyzed in the macrophage cell line RAW264.7. Similarly, it was found that KO-Exo could be better taken up by macrophages.

[0036] Through in vitro co-culture experiments, it was found that the engulfed KO-Exo could effectively promote the M1 polarization of macrophages through its dsDNA, and promote the secretion of IL-6 and TNF- expression and secretion. (As Figure 3 and Figure 4 shown) Figure 3 A: WT-Exo and KO-Exo were co-cultured in vitro for 24 h, and the expression of macrophage M1 markers IL-6 and Tnf- was analyzed by QPCR to determine that KO-Exo could further promote the M1 polarization of macrophages; Figure 3 B: Through ELISA analysis of the secretion of IL-6 and TNF-a, which are used as M1 markers, it was also found that KO-Exo could further promote the M1 polarization of macrophages.

[0037] Figure 4 A: Through Western blot experiments, the mechanism by which KO-Exo changes the polarization of BMDMs was explored, and it was found that KO-Exo could promote the activation of the STING-TBK1-p65 signaling regulatory axis inside M0-type BMDMs; Figure 4 B: Through immunofluorescence experiments, the co-localization of p65 protein and DAPI was detected to determine the nuclear entry of the transcription factor p65. KO-Exo could promote the nuclear entry of p65 to exert its transcriptional activity.

[0038] An in situ model of melanoma intervened by exosomes was constructed in C57BL6J mice. After subcutaneous injection of 5×10 5100 μl of wild-type mouse melanoma cells (B16F10) were used to establish an in-situ mouse melanoma model. Then, 10 μg / 100 μl of SND1-KO melanoma-derived exosomes (hereinafter referred to as KO-Exo) and KO-Exo loaded with IL-12 mRNA (hereinafter referred to as KO-Exo@IL-12) were injected. After administration 5 times, the status of the mice was closely observed. The mice were sacrificed on the 15th day, and it was found that the subcutaneous tumor formation and lung metastasis of melanoma in the mice treated with KO-Exo@IL-12 were significantly inhibited. By flow cytometry to detect the infiltration of immune cells in the subcutaneous lesions and lung metastases, it was found that the immune system was significantly activated, suggesting that KO-Exo@IL-12 can effectively activate the body's immune system to achieve the anti-tumor effect. (As Figure 5 shown) Figure 5 A: Through the LDH experiment, macrophages treated with KO-Exo were co-cultured with B16F10 cells for 24 h, and the secretion of LDH by B16F10 was detected to illustrate the killing effect on B16F10 cells. It was found that KO-Exo can not only promote the M1 polarization of macrophages but also promote their killing effect, and KO-Exo loaded with IL-12 mRNA can further promote the killing effect of macrophages; Figure 5 B: B16F10 cells were digested into single-cell suspensions and then subcutaneously injected into C57BL6 / J mice. Then, 100 l of 10 g / ml of KO-Exo or 10 g / ml of KO-Exo@IL-12 were injected on the third, sixth, ninth, eleventh, and thirteenth days respectively. The control group was treated with an equal volume of PBS as a control. On the 15th day, the mice were sacrificed and the subcutaneous tumor mass was detected; Figure 5 C: Through the detection of tumor size, it was found that the tumor mass in the KO-Exo@IL-12 treatment group was smaller than that in the other two groups, showing an obvious trend of inhibiting tumor growth; Figure 5 D: By plotting the tumor growth curve, it was found that the tumor size in the KO-Exo@IL-12 treatment group grew the slowest, suggesting that KO-Exo@IL-12 can inhibit the development of tumors; Figure 5 E: By digesting the subcutaneous tumor mass into single-cell suspensions and detecting the infiltration of immune cells in the tumor lesions, it was found that the immune infiltration of CD4+ T cells and CD8+ T cells in the KO-Exo@IL-12 treatment group was significantly enhanced, suggesting that KO-Exo@IL-12 inhibits tumor growth by promoting T cell infiltration.

[0039] Finally, it should be noted that: The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit them; although the present invention has been described in detail with reference to the foregoing embodiments, those of ordinary skill in the art should understand that they can still modify the technical solutions recorded in the foregoing embodiments, or perform equivalent replacements on some or all of the technical features; and these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. Application of tumor exosome vaccines based on tag modification of SND1 deficiency.

2. The use of the tumor exosome vaccine modified by tag based on SND1 deletion in anti-tumor treatment according to claim 1, characterized in that: The exosomes are KO-Exo.

3. The use of the tumor exosome vaccine modified by tag based on SND1 deletion in anti-tumor treatment according to claim 1, characterized in that: The exosomes are prepared by the following steps: (1) Wild-type B16F10 cells were cultured in DMEM containing 10% fetal bovine serum until the cell confluence reached 60%-70%, and then the CRISPR / CAS9 plasmid was transfected with Neofect transfection reagent. The third exon sequence of the SND1 gene, F:TCCCAATCAGCTTCTTGCGA and R:CTCCCCAGGGACGAGAGTAT, were cloned into the PX462 empty vector plasmid. (2) 48 hours after transfection, cells were selected with 2 mg / ml puromycin for 3 days, then digested with trypsin, and 1 μl of the cell suspension was added to a 10 cm dish and cultured until visible cell clusters were formed; (3) Use a pipette to pick up a single clone and transfer it to a 96-well plate for culture. When the cell confluence in each well reaches 90%, subculture it to a 48-well plate. When the cell confluence in each well reaches 90%, subculture it to a 12-well plate. When the cell confluence reaches 90%, take half of the cells for subsequent Western blot identification, and subculture the other half to a 6-well plate for continued culture. The cells that have been identified to have knocked out SND1 are continued to be cultured and cryopreserved. (4) B16F10 SND1-KO cells were cultured in a 10 cm dish. When the cell confluence reached 70%, the cells were washed with PBS and replaced with exosome-free medium for 48 h. The cell supernatant was then collected and centrifuged at 500 g for 10 min at 4 °C to remove cells; at 2000 g for 20 min at 4 °C to remove dead cells; at 11000 g for 30 min at 4 °C to remove cell debris and large vesicles; then filtered through a 0.2 μm filter; and then ultracentrifuged at 120000 g for 1 h 30 min at 4 °C to obtain exosomes; resuspended in PBS, and then centrifuged and washed at 120000 g for 1 h 30 min at 4 °C to obtain exosomes.

4. Application of tumor exosomes modified by SND1 deletion tag in the preparation of anti-tumor drugs, characterized in that: The exosomes are KO-Exo.

5. The use of tumor exosomes modified by tag based on SND1 deletion in the preparation of anti-tumor drugs according to claim 4, characterized in that: The exosomes are capable of loading IL-12 mRNA and are prepared by the following steps: (1) Constructing a nucleic acid sequence for expressing the p35 subunit and p40 subunit of IL-12, the sequence comprising 5'Cap+5'UTR+IL-12A+linker+IL-12B+3'UTR+Poly-A, (2) IL-12 mRNA was transferred into KO-Exo by electroporation, and the size and morphology of KO-Exo@IL-12 were detected by NTA and transmission electron microscopy, and the loading efficiency of IL-12 mRNA was detected.

Images