Gene responding to benzoic acid concentration and application thereof
By constructing gene combinations and recombinant vectors that respond to benzoic acid concentration, combined with the expression of fluorescent protein genes, accurate detection of benzoic acid concentration in the environment is achieved, and the problem of inaccurate detection in the prior art is solved.
Patent Information
- Application Number
- CN202510069543.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2025-01-16
- Publication Date
- 2025-06-20
AI Technical Summary
The prior art is difficult to accurately detect the concentration of benzoic acid in the environment, especially when other substances that can absorb 225nm ultraviolet light in the sample will lead to inaccurate detection results.
A gene combination in response to benzoic acid concentration is provided, consisting of the gene BenR and the regulatory sequence BenO, combining the fluorescent protein gene as reporter gene, constructing a recombinant vector and transforming it into E. coli, and evaluating the concentration of benzoic acid in the sample by detecting the fluorescence intensity.
This method can effectively distinguish between target substances and interfering substances, and is suitable for detection of various biological samples. It has high detection accuracy, can accurately reflect the concentration of benzoic acid, and is not disturbed by other substances.
Smart Images

Figure CN120173972A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the technical field of genetic engineering and relates to a gene responding to benzoic acid concentration and application thereof. Background Art
[0002] Benzoic acid, also known as benzoic acid, is an aromatic acid organic compound and the simplest aromatic acid. Benzoic acid is acidic due to its carboxyl group. It can react with alkali to form salts and can also undergo esterification. It is widely present in nature in the form of free acid, ester or its derivatives. Benzoic acid is often used as an antibacterial agent for food, latex, toothpaste, jam, etc., an intermediate for pharmaceuticals and dyes, and an additive for fragrances and coatings. However, the presence of benzoic acid in the environment may have an impact on the ecosystem and human health. High concentrations of benzoic acid can be toxic to aquatic organisms, affecting their survival and reproduction.
[0003] Determining the concentration of benzoic acid in the environment can assess its potential harm to the ecosystem and take corresponding protective measures. At present, physical methods are commonly used to detect the concentration of benzoic acid in the environment, such as high performance liquid chromatography, ultraviolet spectrophotometry, capillary gas chromatography, fluorescence analysis, etc. However, when the sample contains other substances that can absorb 225nm ultraviolet light, the detection of ultraviolet spectrophotometry will produce errors, resulting in inaccurate test results. Gene response detection can effectively distinguish target substances from interfering substances, only respond to target substances, and is suitable for a variety of biological sample detection. It is a method with a wide range of applications and high detection accuracy. There is currently no relevant report on detecting benzoic acid concentration through gene response. Therefore, it is of great significance to provide a gene that can respond to benzoic acid concentration and apply it to benzoic acid detection. Summary of the invention
[0004] In order to solve the above technical problems, the present invention provides a gene that responds to benzoic acid concentration and its application. The gene that responds to benzoic acid concentration is composed of gene BenR and regulatory sequences BenO The present invention clones a gene that responds to benzoic acid concentration into a pKT100 vector, inserts a fluorescent protein gene as a reporter gene, obtains a recombinant vector, and transforms the recombinant vector into Escherichia coli to obtain a recombinant bacterium. The recombinant vector and recombinant bacterium of the present invention can be used to detect benzoic acid concentration, and different concentrations of benzoic acid have an effect on the protein BenR and the regulatory sequence. BenO The different promoting effects of the binding resulted in different degrees of inhibition of the expression of the fluorescent protein gene in the recombinant vector and the recombinant bacteria. The concentration of benzoic acid in the sample was determined by detecting the fluorescence intensity, and the fluorescence intensity was negatively correlated with the benzoic acid concentration.
[0005] To achieve the technical purpose of the present invention, the present invention provides a gene combination that responds to benzoic acid concentration, comprising the geneBenR and regulatory sequences BenO and consists of a gene BenR whose nucleotide sequence is shown in SEQ ID NO:1, and the nucleotide sequence of the regulatory sequence BenO is shown in SEQ ID NO:2.
[0006] On the other hand, the present invention claims a recombinant vector responsive to benzoic acid concentration, said recombinant vector comprising the above-mentioned gene combination for detecting benzoic acid concentration and a vector, said vector being the pKT100 vector, and said recombinant vector further comprising a fluorescent protein gene.
[0007] The present invention does not specifically limit the type of the fluorescent protein gene, and those skilled in the art can select a commonly used fluorescent protein gene, such as the mCherry fluorescent protein gene.
[0008] Specifically, the present invention places the gene BenR behind the LacI promoter, and repeats the regulatory sequence BenO twice in front of the T7 promoter, inserts a fluorescent protein gene as a reporter gene behind it, and clones it into the pKT100 vector to obtain the pKT-2-BenO-T7-mCherry vector.
[0009] On the other hand, the present invention claims a recombinant bacterium responsive to benzoic acid concentration, which transfers the above-mentioned recombinant vector into Escherichia coli.
[0010] The present invention does not specifically limit the type of Escherichia coli, and those skilled in the art can select a commonly used Escherichia coli, such as Escherichia coli E.coli BL21.
[0011] On the other hand, the present invention claims a method for detecting benzoic acid concentration, inoculating the above-mentioned recombinant bacterium into a medium containing a sample to be tested, and then determining the benzoic acid concentration in the sample to be tested according to the detected fluorescence intensity, and the benzoic acid concentration in the sample to be tested is negatively correlated with the fluorescence intensity.
[0012] Furthermore, inoculate the recombinant bacterium into an LB medium containing the sample to be tested, and detect the fluorescence intensity after culturing at 37 °C for 10 h, and the sample to be tested contains benzoic acid.
[0013] Specifically, within the range of 0-3 mM of benzoic acid concentration, the higher the benzoic acid concentration, the lower the fluorescence intensity, and the expression of the fluorescent protein gene is gradually inhibited. After the benzoic acid concentration is higher than 3 mM, the expression level of the fluorescent protein gene is even lower. This is because benzoic acid can promote the benzoic acid regulatory protein BenR transcribed by the pKT-2-BenO-T7-mCherry vector and the regulatory sequence BenOThe combination leads to the inhibition of the transcriptional expression of the fluorescent protein gene in the pKT-2-BenO-T7-mCherry vector, resulting in a decrease in fluorescence intensity.
[0014] Furthermore, the present invention claims the use of the above gene combination, recombinant vector, or recombinant bacterium in detecting the concentration of benzoic acid.
[0015] Compared with the prior art, the technical solution provided by the present invention has at least the following beneficial effects or advantages: (1) In the present invention, the gene BenR was cloned from Pseudomonas putida. The protein BenR transcribed by this gene binds to the regulatory sequence BenO is regulated by the concentration of benzoic acid. High concentrations of benzoic acid can promote the binding of the protein BenR to the regulatory sequence BenO . In the present invention, the gene BenR was placed after the LacI promoter, and the regulatory sequence BenO was repeated twice in front of the T7 promoter, and a fluorescent protein was inserted as a reporter gene behind it, and cloned into the pKT100 vector to obtain the pKT-2-BenO-T7-mCherry vector. This vector can reflect the concentration of benzoic acid in the test sample through the expression of the fluorescent protein gene. In the present invention, mCherry was used as the fluorescent protein gene, and the fluorescence intensity was detected using an enzyme-linked immunosorbent assay (ELISA) reader at an excitation wavelength of 580 nm and an emission wavelength of 610 nm, which can quantitatively analyze the expression of the fluorescent protein gene. The recombinant vector constructed in the present invention only responds to the target substance benzoic acid, can effectively distinguish the target substance from interfering substances, and is applicable to the detection of various biological samples, which is a method with a wide range of applications and high detection accuracy.
[0016] (2) In the present invention, the recombinant vector was transferred into Escherichia coli to obtain a recombinant bacterium. The recombinant bacterium was inoculated into LB medium containing the test sample. After culturing at 37 °C for 10 h, it was found that the higher the concentration of benzoic acid, the lower the fluorescence intensity, and the expression of the fluorescent protein gene was gradually inhibited. The fluorescence intensity was negatively correlated with the concentration of benzoic acid. This is because benzoic acid can promote the binding of the benzoic acid regulatory protein BenR transcribed by the pKT-2-BenO-T7-mCherry vector and the regulatory sequence BenO , thereby resulting in the inhibition of the transcriptional expression of the fluorescent protein gene in the pKT-2-BenO-T7-mCherry vector and a decrease in fluorescence intensity. BRIEF DESCRIPTION OF THE DRAWINGS
[0017] In order to more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the following will briefly introduce the drawings required for the description of the embodiments or the prior art. Obviously, the following drawings are only some embodiments of the present invention.
[0018] Figure 1 This is the plasmid map of plasmid pKT100.
[0019] Figure 2 This is the plasmid map of pKT-2-BenO-T7 vector.
[0020] Figure 3 This is the schematic diagram of the MCS of pKT-2-BenO-T7 vector.
[0021] Figure 4 This is the detection result of the system's response to benzoic acid concentration. Specific implementation manners
[0022] Next, the technical solutions of the present invention will be described in conjunction with the embodiments. However, the present invention is not limited to the following embodiments. The experimental methods and detection methods described in each embodiment are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.
[0023] The restriction endonuclease and 2×SmartSeamless Cloning Mix of the present invention are both purchased from Takara Bio Inc. (Dalian); the DNA marker and gel extraction kit are both purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0024] Benzoic acid is purchased from Tianli Chemical Reagent Co., Ltd. Benzoic acid is dissolved in absolute ethanol to prepare a 1M stock solution for standby.
[0025] Escherichia coli E.coli TG1 and Escherichia coli E.coli BL21 are both purchased from Tiangen Biochemical Technology (Beijing) Co., Ltd.
[0026] LB medium (1L): 10 g peptone, 5 g yeast extract, 10 g NaCl.
[0027] Example 1 This example provides the construction of pKT-2-BenO-T7 vector.
[0028] 1. Amplification and purification of benzoic acid regulatory gene BenR and purification Using the cDNA of Pseudomonas putida (provided by the laboratory of Northwest A&F University) as a template to amplify the target gene (benzoic acid regulatory gene BenR ), designing amplification primers ( BenR -F and BenR-(R), PCR amplification was carried out. The PCR amplification system is shown in Table 1. The PCR reaction program was: pre-denaturation at 95°C for 5 min; (denaturation at 95°C for 30 s; annealing at 54°C for 30 s; extension at 72°C for 1 min / kb) × 30 cycles; finally, extension at 72°C for 10 min; incubation at 16°C. The PCR products were separated by electrophoresis on a 1% agarose gel containing 0.5 μg / mL ethidium bromide (EB). The electrophoresis conditions were: 1×TAE buffer, voltage 120 V, electrophoresis for 25 min. The target band was cut under ultraviolet light and gel extraction was performed using a gel extraction kit. The extraction operation method can be found in the kit instruction manual. After sequencing, the benzoic acid regulatory gene BenR has the nucleotide sequence shown in SEQ ID NO:1.
[0029] BenR -F: 5'-ACAAATCCAGATGGAGTTCTGAGGTCATTACTGGATCTATCAACAGGAGTCCAAGCGAGCTCTCGAACCCCAGAGTCCCGCTCACCCCCGACGCTTGAA-3'; BenR -R: 5'-CCGGAAGAGAGTCAATTCAGGGTGGTGAATATGGAAAGCCGCCTGCTGA-3'.
[0030] Table 1 PCR amplification system
[0031] 2. Amplification and purification of the fragment with BenO and the pKT100 fragment Using plasmid pKT100 (provided by the laboratory of Northwest A&F University) as a template, the replicon and resistance gene part were amplified, and a terminator element was introduced on the primers. The amplification primers were F1 and R1. PCR amplification was carried out. The PCR amplification system and PCR reaction program were the same as above. The purification steps were the same as the above electrophoresis separation and gel extraction to obtain the pKT100 fragment. The plasmid map of plasmid pKT100 is as shown in Figure 1 . Using plasmid pET28a (provided by the laboratory of Northwest A&F University) as a template, the LacI promoter sequence was amplified, and two BenO sites were introduced on the primers. The amplification primers were F2 and R2. PCR amplification was carried out. The PCR amplification system and PCR reaction program were the same as above. The purification steps were the same as the above electrophoresis separation and gel extraction to obtain the fragment with BenO . The nucleotide sequence of the regulatory sequence BenO is shown in SEQ ID NO:2.
[0032] F1: 5'GCCTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGATATACCATGGGATCCGAATTCGAGCTCGTCGACCTCGAGAGAAGGCCATCCTGACGGATGGCCTTTTAAGCTTTTTCCATAGGCTCCGCCC-3'; R1: 5'AGAACTCCATCTGGATTTGTTCAGAACGCTCGGTTGCCGCCGGGCGTTTTTTATTGGTGAGAATGGTACCTCAGAAGAACTCGTCAAGAAGGC-3'; F2: 5'TCAGCAGGCGGCTTTCCATATTCACCACCCTGAATTGACTCT-3'; R2: 5'ACAAAATTATTTCTAGAGGCCTATAGTGAGTCGTATTATATCCGGATTGTGCAGAGTGTTATCCAGTTCTGCCTATCCGGATTGTGCAGAGTGTTATCCAGTTCTGCCATTTCGCGGGATCGAGATCTC-3'.
[0033] 3. Construction of pKT-2-BenO-T7 vector The benzoic acid regulatory gene purified after amplification BenR (Template 1) and the fragment with BenO were ligated together by overlapping PCR. The reaction system of overlapping PCR is shown in Table 2. The reaction procedure of overlapping PCR is the same as the above PCR amplification, and the purification and recovery are the same as the above electrophoresis separation and gel recovery. Subsequently, the purified target fragment was ligated to the pKT100 fragment. The reaction system of the ligation reaction includes: 5 μL of 2×SmartSeamless Cloning Mix, 2 μL of the target fragment, and 3 μL of the pKT100 fragment. After mixing, the reaction was carried out at 50 °C for 1 h to obtain the pKT-2-BenO-T7 vector.
[0034] Table 2 Reaction system of overlapping PCR
[0035] 4. Transformation and culture of pKT-2-BenO-T7 vector The ligation product was transformed into Escherichia coli E.coli TG1 competent cells. The preparation and transformation of competent cells were both carried out using Ca 2+The transformation was carried out by adding 10 μL of the ligation product to 100 μL of competent cells, gently mixing, incubating on ice for 30 min, heat-shocking in a 42 °C water bath for 90 s, then incubating on ice for 3 min, adding 1 mL of LB medium, recovering at 37 °C and 200 rpm in a constant temperature shaker for 1 h, centrifuging at 5000 rpm for 3 min, removing 800 μL of the supernatant, resuspending the cells with the remaining medium, and spreading on an LB plate containing kanamycin (Km, concentration 100 μg / mL), and culturing overnight at 37 °C. Single colonies on the LB plate were inoculated onto a new LB plate, cultured overnight at 37 °C, the plasmid was extracted using a plasmid miniprep kit, verified by sequencing, and the plasmid map of the pKT-2-BenO-T7 vector was obtained as Figure 2 shown.
[0036] Example 2 This example provides the construction of the pKT-2-BenO-T7-mCherry vector.
[0037] According to mCherry the sequence, primers ( mCherry -F-EcoRI and mCherry -R-XhoI) were designed, and EcoRI and XhoI restriction sites were introduced onto the primers to amplify mCherry , the PCR amplification system and PCR reaction program were the same as above, and the purification steps were the same as the above electrophoresis separation and gel extraction, obtaining mCherry fragment. The plasmid pKT-2-BenO-T7 was digested with double enzymes, and the double digestion reaction system is shown in Table 3, and the reaction was carried out at 37 °C for 2 - 3 h. The mCherry fragment and the digested pKT-2-BenO-T7 vector fragment were ligated, and the ligation reaction was the same as above. The ligation product was transformed into Escherichia coli E.coli TG1 competent cells, and the transformation and culture methods were the same as above. The single colonies were identified by PCR, the positive colonies were picked and inoculated onto a new LB plate, cultured overnight at 37 °C, the plasmid was extracted using a plasmid miniprep kit and verified by a small-scale digestion, obtaining the pKT-2-BenO-T7-mCherry plasmid.
[0038] mCherry -F-EcoRI: 5'-AGAAGGAGATATACCATGGGATCCGAATTCATGGTGAGCAAGGGCGAG-3'; mCherry -R-XhoI: 5'-GGCCATCCGTCAGGATGGCCTTCTCTCGAGTTACTTATACAGCTCGTCCATGCCG-3'.
[0039] Table 3 Double digestion reaction system
[0040] Example 3 This example provides the detection of the response of the pKT-2-BenO-T7-mCherry vector to benzoic acid concentration.
[0041] The pKT-2-BenO-T7-mCherry plasmid obtained in Example 2 was transformed into Escherichia coli E.coli BL21 competent cells. After overnight culture at 37 °C, the positive monoclonal was inoculated onto a new LB plate and cultured until the stationary phase. Then, it was transferred to a new LB medium at an inoculation amount of 1% and different final concentrations (0, 1, 2, 3 mM) of benzoic acid were added. After culturing at 37 °C for 10 h, the fluorescence intensity was detected. 100 μL of the bacterial liquid cultured to the stationary phase was taken into a black 96-well plate with a transparent bottom, and the fluorescence intensity was detected using a microplate reader at an excitation wavelength of 580 nm and an emission wavelength of 610 nm. The detection results are as Figure 4 shown.
[0042] As can be seen from Figure 4 this, the pKT-2-BenO-T7-mCherry vector constructed in the present invention can respond to the benzoic acid concentration. The higher the benzoic acid concentration, the lower the fluorescence intensity, and the expression of the fluorescent protein gene is gradually inhibited. The fluorescence intensity is negatively correlated with the benzoic acid concentration. This is because benzoic acid can promote the binding of the benzoic acid regulatory protein BenR transcribed by the pKT-2-BenO-T7-mCherry vector and the regulatory sequence BenO thereby resulting in the inhibition of the transcriptional expression of the fluorescent protein gene in the pKT-2-BenO-T7-mCherry vector and the decrease in fluorescence intensity.
[0043] The above-described examples are some, but not all, of the examples of the present invention. The detailed description of the embodiments of the present invention is not intended to limit the scope of the present invention claimed, but merely represents the selected embodiments of the present invention. All other embodiments obtained by relevant deductions and substitutions made by those of ordinary skill in the art under the premise of not making creative efforts based on the concept of the present invention belong to the scope of protection of the present invention.
Claims
1. A gene combination that responds to benzoic acid concentration, characterized in that: By gene BenR and regulatory sequences BenO composition; The gene BenR The nucleotide sequence is shown in SEQ ID NO: 1; The regulatory sequence BenO The nucleotide sequence is shown in SEQ ID NO:
2.
2. A recombinant vector responsive to benzoic acid concentration, characterized in that: The recombinant vector comprises the gene combination and vector responsive to benzoic acid concentration as claimed in claim 1.
3. The recombinant vector according to claim 2, characterized in that The vector is a pKT100 vector.
4. The recombinant vector according to claim 2, characterized in that The recombinant vector also includes a fluorescent protein gene.
5. The recombinant vector according to claim 4, characterized in that The fluorescent protein gene is the mCherry fluorescent protein gene.
6. A recombinant bacterium that responds to benzoic acid concentration, characterized in that: The invention comprises the recombinant vector and host bacteria as described in any one of claims 2 to 5.
7. The recombinant bacterium according to claim 6, characterized in that The host bacteria is Escherichia coli.
8. A method for detecting benzoic acid concentration, characterized in that: include: The recombinant bacteria according to any one of claims 6 to 7 are inoculated into a culture medium containing a sample to be tested, and then the benzoic acid concentration in the sample to be tested is determined based on the fluorescence intensity obtained by detection. The benzoic acid concentration in the sample to be tested is negatively correlated with the fluorescence intensity.
9. Use of the gene combination that responds to benzoic acid concentration according to claim 1, or the recombinant vector according to any one of claims 2 to 5, or the recombinant bacteria according to any one of claims 6 to 7 in detecting benzoic acid concentration.