Non-glutinous rice mutant with ultralow amylose content and detection molecular marker thereof

Abstract

The invention discloses a non-glutinous rice mutant with ultralow amylose content and a detection molecular marker of the non-glutinous rice mutant, the mutant has a mutant Wxf gene, and the mutant Wxf gene is a DNA (deoxyribonucleic acid) molecule obtained by performing mutation on a wild Wx gene of rice: replacing SEQ ID No. 1 in the wild Wx gene in the rice with a DNA molecule of SEQ ID No. 2. The amylose content of rice of the mutant is only about 4.56%, grains are white and opaque similar to glutinous rice, but a small amount of GBSSI protein expression exists in the mutant, it is indicated that the mutant is not glutinous rice, the blank that non-glutinous rice germplasm lacks when the amylose content is about 5% in rice breeding is filled up, the cooking taste quality of existing good-taste soft rice is expected to be further improved, and the method is worthy of popularization and application. The method has important breeding utilization value.

Description

Technical Field

[0001] The present invention relates to rice molecular breeding, and in particular, to a non-waxy rice mutant with an ultra-low amylose content and its detection molecular markers. Background Art

[0002] High quality is one of the core competitiveness of the rice industry. Among the rice quality traits, the taste quality (how delicious it is) is the primary factor determining consumer choice, and the amylose content (AC) in the rice endosperm is the most critical factor determining the taste quality of rice. A large number of studies have confirmed that reducing the amylose content in rice can significantly improve the physical and chemical indexes such as the hardness and viscosity of cooked rice, thereby improving the taste quality of rice. Therefore, exploring new rice germplasms with low amylose content and developing their molecular marker-assisted selection breeding system are important prerequisites for breeding new rice varieties with excellent taste.

[0003] The synthesis of amylose in the rice endosperm is mainly regulated by the Wx gene encoding granule-bound starch synthase GBSSI. In cultivated rice varieties, Wx the gene has multiple natural allelic variations, resulting in wide differences in amylose content and rice taste quality among different varieties. In the past few decades, breeders in China have used related germplasms carrying low amylose content Wx b alleles to breed a series of new rice varieties with excellent taste and amylose content of about 13% - 18%, significantly improving the taste quality of rice in China (especially indica rice and hybrid rice). In recent years, a type of excellent-taste "soft rice" with a lower amylose content (8% - 13%) has shown an obvious popularity trend. Its cooked rice has the advantages of being soft but not mushy, sweet and refreshing, good puffing property, elastic, not easy to harden after cooling, and small degree of retrogradation. Research results show that this type of soft rice is mainly achieved by introducing Wx op / Wx hp , Wx mp or Wx mq alleles.

[0004] In addition, in some areas such as Yunnan in China, a type of excellent-taste soft rice with an apparent amylose content of only about 5% has been found. This type of soft rice shows better taste quality characteristics. However, from a genetic perspective, in this type of soft rice WxAn 11-base deletion in the second exon of the gene results in a frameshift mutation and the inability to encode a functional GBSSI protein. Essentially, it is a type of waxy rice. Due to the lack of GBSSI protein, waxy rice cannot synthesize amylose, and its true amylose content should be 0%. However, since the method of measuring the apparent amylose content of rice by iodine staining misidentifies long chains of branched starch as amylose, the apparent amylose content of waxy rice is usually not 0%.

[0005] In summary, reducing the amylose content of rice significantly to about 5% is expected to further improve the eating quality of rice. However, there is a lack of non-waxy germplasm with an amylose content of about 5% in current rice breeding. Summary of the Invention

[0006] To address the above problem of the lack of non-waxy germplasm with an amylose content of about 5% in current rice breeding, the present invention provides a non-waxy rice mutant with an ultra-low amylose content and its detection molecular marker. By crossing the non-waxy mutant with other rice materials, after harvesting individual plants of the hybrid offspring, observing the appearance of polished rice grains and measuring the apparent amylose content of rice by iodine staining, a new high-quality eating rice germplasm with grains similar to those of waxy rice, white and opaque, and an amylose content significantly reduced to about 4.56% can be screened.

[0007] To achieve the above object, on the one hand, the present invention provides a mutant Wx f gene, and the mutant Wx f gene is a DNA molecule obtained by mutating the wild-type Wx gene of rice as follows: replacing the SEQ ID No.1 in the wild-type Wx gene in rice with the DNA molecule of SEQ ID No.2.

[0008] SEQ ID No.1 SEQ ID No.2 TGTAGCTGAGGCACTGACGTGCGGG The second aspect of the present invention provides a non-waxy rice mutant with an ultra-low amylose content, which has the above-mentioned mutant Wx f gene.

[0009] The amylose content of the rice of the mutant is only about 4.56%, and the grains are of a white opaque type similar to waxy rice; in the mutant Wx the gene has a mutation, 1056 nucleotides as shown in SEQ ID No.1 are replaced by 25 nucleotides as shown in SEQ ID No.2, but it can still encode a small amount of GBSSI protein, indicating that the mutant is not a waxy rice type that cannot encode GBSSI protein at all. Hybridize the non-waxy mutant with other rice materials, observe the appearance of polished rice grains after harvesting individual plants of the hybrid offspring, and measure the apparent amylose content of the rice by the iodine staining method, and excellent new germplasms of rice with good taste can be screened, with grains being white opaque similar to waxy rice and the amylose content of the rice significantly reduced to about 4.56%.

[0010] The third aspect of the present invention provides the application of the above-mentioned mutant Wx f gene in any of the following: 1) Regulating the amylose content of plants; 2) Preparing products for regulating the amylose content of plants; 3) Cultivating plants with changed amylose content; 4) Preparing products for cultivating plants with changed amylose content; 5) Reducing the amylose content of rice; 6) Preparing non-waxy rice.

[0011] The fourth aspect of the present invention provides a method for preparing non-waxy rice with an ultra-low amylose content, which includes the step of replacing the DNA molecule of SEQ ID No.1 in the genome of the target rice with the DNA molecule of SEQ ID No.2, thereby reducing the amylose content of the target rice.

[0012] The fifth aspect of the present invention provides a specific molecular marker for detecting the above-mentioned mutant Wx f gene. The upstream primer FN-F sequence of the specific molecular marker is as shown in SEQ ID No.3, and the downstream primer FN-R sequence is as shown in SEQ ID No.4.

[0013] SEQ ID No.3: ACCCATGAGCTGATTGCCTGATTAG; SEQ ID No.4: ACCTTGCAGATGTTCTTCCTGATGA.

[0014] Single plant leaves of the hybrid offspring of the above non-waxy mutant and other rice materials were taken. After extracting DNA, PCR amplification was carried out using molecular markers FN-F and FN-R.

[0015] PCR reaction system (20 μL): 10 μL of 2 x Taq Master Mix containing Taq enzyme, 1 μL of FN-F primer working solution (10 nmol / μL), 1 μL of FN-R primer working solution (10 nmol / μL), 1 μL of DNA from single plant leaves of the hybrid offspring, and 7 μL of deionized water.

[0016] PCR amplification conditions: pre-denaturation at 95 °C for 2 minutes; then denaturation at 95 °C for 30 seconds, annealing at 60 °C for 30 seconds, extension at 72 °C for 100 seconds, for 35 cycles; then extension at 72 °C for 5 minutes and cooling at 16 °C for more than 10 minutes.

[0017] The PCR amplification products were separated by agarose gel electrophoresis. If there is only one band with a size of 324 bp in the product, it indicates that the rice single plant carries a homozygous mutant Wx genotype; if there is only one band with a size of 1355 bp in the product, it indicates that the rice single plant does not carry the mutant Wx genotype; if the product contains two bands with sizes of 324 bp and 1355 bp at the same time, it indicates that the rice single plant carries a heterozygous mutant Wx genotype.

[0018] Through the above technical solutions, the present invention has achieved the following beneficial effects: 1. The amylose content of the mutant rice is only about 4.56%, and the grains are white and opaque similar to glutinous rice. However, there is still a small amount of GBSSI protein expressed in the mutant, indicating that it is not glutinous rice. This fills the gap in the lack of non-waxy germplasm with an amylose content of about 5% in rice breeding, and is expected to further improve the cooking and eating quality of existing excellent soft rice (amylose content of about 8% - 13%), having important breeding and utilization value; 2. The specific molecular markers for detecting the non-waxy mutant are directly designed for the Wx genotype in the mutant, which is directly associated with the phenotype of ultra-low amylose content. The amplified fragments of the primers are significantly different and easy to distinguish, and can be used for accurate and efficient identification of the genotypes of the hybrid offspring seedlings of the non-waxy mutant and different rice materials. Description of the Drawings

[0019] Figure 1 Comparison of the polished rice appearance (A) and apparent amylose content of rice (B) between the non-waxy mutant and wild type and conventional waxy rice. Different lowercase letters indicate P statistical significance differences at <0.01. "Sub 1056-25" means that 1056 bases are replaced by 25 bases; Figure 2 is the non-waxy mutant Wx Schematic diagram of gene sequence differences (A) and comparison of GBSSI protein expression in mature rice flour between it and wild type and conventional waxy rice (B); Figure 3 is the molecular marker detection map of the separated individual plants of the F2 generation from the cross between the non-waxy mutant and the rice variety Yangnongjing 1030. Specific embodiments

[0020] The following details the specific embodiments of the present invention. It should be understood that the specific embodiments described herein are only for explaining and understanding the present invention, and are not used to limit the present invention.

[0021] For the instruments, reagents, materials, etc. involved in the following examples, unless otherwise specified, they are all conventional instruments, reagents, materials, etc. existing in the prior art and can be obtained through conventional commercial channels. For the experimental methods, detection methods, etc. involved in the following examples, unless otherwise specified, they are all conventional experimental methods, detection methods, etc. in the prior art.

[0022] 1. Experimental materials (1) The nearly isogenic line 2661- Wx obtained by introducing the original allelic type of the Wx lv gene in the background of the high-yield japonica rice line 2661; Wx lv (hereinafter collectively referred to as "wild type"); (2) The non-waxy mutant with ultra-low apparent amylose content generated by gene mutation in the background of 2661- Wx lv (hereinafter collectively referred to as "mutant"); Wx (3) To compare the differences between the mutant and existing common waxy rice, a waxy rice nearly isogenic line obtained by introducing the gene mutant type Wx allelic gene of "Nipponbare" was also added for comparison (hereinafter collectively referred to as "conventional waxy rice"). wx

[0023] 2. Polished rice appearance and apparent amylose content of the mutant The mature paddy of the relevant materials was ground into polished rice, and it was found that the polished rice of the mutant showed a white opaque phenotype similar to that of conventional waxy rice ( Figure 1In A). The relevant material, polished rice, was ground into rice flour. The results of apparent amylose content determination showed that the AAC of the mutant rice decreased significantly from 24.62% of the wild type to 4.56%, but was still significantly higher than 2.64% of conventional waxy rice ( Figure 1 In B).

[0024] 3. Mutant Wx Gene sequence analysis and GBSSI protein expression The synthesis of amylose in rice is mainly controlled by the Wx gene encoding GBSSI protein. To clarify the reason for the significant decrease in the apparent amylose content of the mutant rice, first, the full-length sequence of the Wx gene in the mutant was amplified by PCR and sequenced. The sequencing results were compared with the existing different Wx natural allele sequences using biological software such as SnapGene. The specific references for the relevant primers and different Wx allele sequences are: Zhang et al., Molecular Plant, 12(8):1157-1166. The specific primer sequences are as follows: LamH-F: TAAGCTTGGACGAGTTGGGTGAACCTGGGA QWx-2: CGCCTGCAAAGAACACAAGAACACAACATT QWx-3: AACAATTCAATTCAGTGCAGAGATCTTCCA QWx-4: CTCCACAGCCATAAGCCACACCAACT.

[0025] The sequencing alignment results showed that compared with the existing different Wx natural alleles, 1056 bases in the Wx gene in the mutant were replaced by 25 bases, and the other sequences were the same as those of the Wx lv allele. We named it " Wx f " ( Figure 2 In A). The expression of GBSSI protein encoded by the Wx gene in the relevant materials was detected using a specific protein antibody. The results showed that although this large fragment deletion severely disrupted the transcript of the Wx gene in the mutant, it did not disrupt its coding sequence. There was still a small amount of GBSSI protein expression in the mutant rice, which was significantly different from the absence of GBSSI protein expression in conventional waxy rice ( Figure 2In B), it shows that although the AAC of the mutant is close to that of glutinous rice and the grains also exhibit a phenotype similar to that of glutinous rice, it does not belong to the glutinous rice type, but is a non-glutinous mutant with an ultra-low amylose content.

[0026] 4. Development of a molecular marker-assisted selection system for the mutant Based on the great potential of the mutant with an ultra-low amylose content of 4.56% in improving the eating quality of rice breeding, in order to facilitate its breeding utilization, we designed a pair of molecular markers FN-F and FN-R that can specifically distinguish the gene mutation sites in the mutant. The specific sequences are as follows: Wx FN-F (SEQ ID NO.3): ACCCATGAGCTGATTGCCTGATTAG FN-R (SEQ ID NO.4): ACCTTGCAGATGTTCTTCCTGATGA.

[0027] The mutant was crossed with the high-yield japonica rice variety Yangnongjing 1030. Leaves of individual plants in the F2 generation of the cross were taken, DNA was extracted, and PCR amplification was performed using the molecular markers FN-F and FN-R. The amplified products were separated by agarose gel electrophoresis. The results showed that the DNA of rice individual plants carrying the homozygous mutant genotype could only amplify a single band with a size of 324 bp, the DNA of rice individual plants carrying the heterozygous mutant genotype could amplify two DNA fragments with sizes of 1355 bp and 324 bp respectively, while the DNA of rice individual plants not carrying the mutant genotype could only amplify a single DNA fragment with a size of 1355 bp ( Wx f ). This result indicates that the molecular markers FN-F and FN-R can effectively distinguish the genotypes of the offspring of the mutant crossed with other rice materials. Wx f Wx f ). This result shows that the molecular markers FN-F and FN-R can effectively distinguish the genotypes of the offspring of the mutant crossed with other rice materials. Figure 3 ). This result indicates that the molecular markers FN-F and FN-R can effectively distinguish the genotypes of the offspring of the mutant crossed with other rice materials. Figure 3 ). This result shows that the molecular markers FN-F and FN-R can effectively distinguish the genotypes of the offspring of the mutant crossed with other rice materials.

[0028] The preferred embodiments of the present invention have been described in detail above. However, the present invention is not limited to the specific details in the above embodiments. Within the scope of the technical concept of the present invention, various simple modifications can be made to the technical solutions of the present invention, and these simple modifications all fall within the protection scope of the present invention.

[0029] In addition, it should be noted that in the above specific embodiments, the various specific technical features described can be combined in any suitable manner without contradiction. To avoid unnecessary repetition, the present invention will not separately describe various possible combination methods.

[0030] In addition, any combination can be made among various different embodiments of the present invention, as long as it does not violate the idea of the present invention, and it should equally be regarded as the content disclosed by the present invention.

Claims

1. Mutant Wx f A gene characterized by The mutant Wx f wild type Wx The DNA molecule obtained by the following mutation of the gene: the wild type in rice Wx A DNA molecule in which SEQ ID No. 1 in the gene is replaced by SEQ ID No.

2.

2. A non-glutinous rice mutant with ultra-low amylose content, characterized in that: Having the mutant type according to claim 1 Wx f Gene.

3. The mutant according to claim 2, characterized in that It encodes a small amount of GBSSI protein.

4. The mutant according to claim 1 Wx f Use of genes in any of the following: 1) Regulate the content of plant amylose; 2) Preparation of products for regulating plant amylose content; 3) Cultivating plants with altered amylose content; 4) preparing products for cultivating plants with altered amylose content; 5) Reduce the amylose content of rice; 6) Preparation of non-glutinous rice.

5. A method for preparing non-glutinous rice with ultra-low amylose content, characterized in that: The method comprises the steps of replacing the DNA molecule of SEQ ID No. 1 in the genome of the target rice with the DNA molecule of SEQ ID No. 2, thereby reducing the content of amylose in the target rice.

6. A method for detecting the mutant according to claim 1 Wx f Gene-specific molecular markers, characterized in that The sequence of the upstream primer FN-F of the specific molecular marker is shown in SEQ ID No.3, and the sequence of the downstream primer FN-R is shown in SEQ ID No.4.

Images