Composition for diagnosing Crohn disease, kit and application of enhancer RNA44345 in preparation of composition

By using enhancer RNA44345 as a composition for detection markers, the problem of low specificity and sensitivity of existing biomarker detection methods in disease activity assessment and prognosis prediction is solved, and efficient detection of early diagnosis and prognosis assessment of Crohn's disease is achieved.

CN120174078APending Publication Date: 2025-06-20NINGBO UNIV
View PDF 3 Cites 0 Cited by

Patent Information

Application Number
CN202510188883.1
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-02-20
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

Existing biomarker detection methods have low specificity and sensitivity in disease activity assessment and prognosis prediction.

Method used

A composition for diagnosing Crohn's disease is provided, using enhancer RNA44345 as a detection marker, combined with upstream primer Prime F and downstream primer Prime R, and is detected by a kit and a qPCR reaction premix.

Benefits of technology

The sensitivity of enhancer RNA44345 is 74.6% and specificity of 81.7%, which can provide new tools for the early diagnosis and prognosis evaluation of Crohn's disease.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174078A_ABST
    Figure CN120174078A_ABST
Patent Text Reader

Abstract

The invention provides a composition for diagnosing Crohn's disease, a kit and application of an enhancer RNA44345 in preparation of the composition, and relates to the technical field of biological medicines. The invention relates to an application of an enhancer RNA44345 in preparation of a composition for diagnosing Crohn's disease, and the enhancer RNA44345 is used as a detection marker of the composition for diagnosing Crohn's disease. The enhancer RNA44345 serves as a detection marker of the composition for diagnosing the Crohn disease, the sensitivity is 74.6%, the specificity is 81.7%, the sensitivity and the specificity are high, and a new tool can be provided for early diagnosis and prognosis evaluation of the Crohn disease.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biomedical technologies, and more particularly, to a composition for diagnosing Crohn's disease, a kit, and the use of enhancer RNA44345 in the preparation of the composition. Background Art

[0002] Crohn's disease (CD) is a chronic inflammatory disease of the gastrointestinal tract, and its diagnosis mainly relies on methods such as endoscopic examination, imaging examination, and histopathological examination. However, although endoscopic examination and histopathological examination can directly observe gastrointestinal lesions, the acceptance of patients is low, and there are certain risks and discomforts; although computed tomography (CT) and magnetic resonance imaging (MRI) commonly used in imaging examinations are non-invasive, they cannot provide information at the molecular level and are difficult to be used for molecular diagnosis in the early stage of the disease.

[0003] In recent years, with the development of molecular biology technologies, biomarker-based detection methods have attracted wide attention. Existing biomarker detection methods mainly include C-reactive protein test (CRP) and fecal calprotectin detection. However, the specificity and sensitivity of C-reactive protein test and fecal calprotectin detection are both low in the assessment of disease activity and prognosis prediction. Summary of the Invention

[0004] The problem solved by the present invention is how to solve the problem that the specificity and sensitivity of existing biomarker detection methods are both low in the assessment of disease activity and prognosis prediction.

[0005] To solve the above problems, the present invention provides a composition for diagnosing Crohn's disease, a kit, and the use of enhancer RNA44345 in the preparation of the composition.

[0006] In a first aspect, the present invention provides the use of enhancer RNA44345 in the preparation of a composition for diagnosing Crohn's disease, and enhancer RNA44345 is used as a detection biomarker of the composition for diagnosing Crohn's disease.

[0007] Optionally, the sequence of enhancer RNA44345 is SEQ ID NO: 1.

[0008] In a second aspect, the present invention provides a composition for diagnosing Crohn's disease, the detection biomarker is enhancer RNA44345, and the composition for diagnosing Crohn's disease includes an upstream primer Prime F and a downstream primer Prime R. The specific sequences of the upstream primer Prime F and the downstream primer Prime R are as follows:

[0009] Prime F(5'-CAAACAAACAATTAGCTCTGAGGTC-3'): SEQ ID NO: 2;

[0010] Prime R(5'-TTGCTGAAAGCTCCCTCGTTA-3'): SEQ ID NO: 3.

[0011] In a third aspect, the present invention provides a kit for diagnosing Crohn's disease, comprising the composition for diagnosing Crohn's disease as described above.

[0012] Optionally, it further comprises a qPCR reaction premix and RNase-free water.

[0013] Optionally, the qPCR reaction premix comprises a hot-start DNA polymerase, SYBR Green I fluorescent dye, deoxynucleoside triphosphates, and Mg 2+ .

[0014] Optionally, it further comprises an RNA extraction reagent.

[0015] Optionally, the RNA extraction reagent comprises Trizol LS reagent, chloroform, isopropanol, 75% (volume fraction) ethanol, and RNase-free water.

[0016] Optionally, it further comprises a cDNA synthesis reagent.

[0017] Optionally, the cDNA synthesis reagent comprises 5×Polestar RT MasterMix, 20 μM OligodT (18) primer, and RNase-free water.

[0018] The beneficial effects of a composition for diagnosing Crohn's disease, a kit, and the use of enhancer RNA44345 in the preparation of the composition according to the present invention are as follows: enhancer RNA44345, as a detection marker for the composition for diagnosing Crohn's disease, has a sensitivity of 74.6% and a specificity of 81.7%. Both the sensitivity and specificity are relatively high, which can provide a new tool for the early diagnosis and prognosis evaluation of Crohn's disease. BRIEF DESCRIPTION OF THE DRAWINGS

[0019] Figure 1 It is a schematic diagram of the eRNA44345 plasmid standard product in Example 1 of the present invention;

[0020] Figure 2 It is the RACE sequencing result of eRNA44345 in Example 1 of the present invention, including the agarose gel electrophoresis diagram of the amplified fragment, the complete 5'-end sequence, the complete 3'-end sequence, and the schematic diagram of the specific upstream and downstream amplification primers designed for fluorescence quantitative PCR according to the eRNA44345 sequence;

[0021] Figure 3 It is the fluorescence quantitative standard curve graph of the eRNA44345 plasmid in Example 1 of the present invention;

[0022] Figure 4 It is the result graph of the levels of eRNA44345 in healthy human plasma and plasma of Crohn's patients in Example 1 of the present invention.

[0023] Figure 5 It is the ROC curve graph of the kit for diagnosing Crohn's disease in Example 1 of the present invention. Detailed implementation manners

[0024] To make the above objects, features and advantages of the present invention more obvious and understandable, the following detailed description of the specific embodiments of the present invention will be given with reference to the accompanying drawings. Although some embodiments of the present invention are shown in the drawings, it should be understood that the present invention can be implemented in various forms and should not be construed as limited to the embodiments set forth herein. On the contrary, these embodiments are provided to more thoroughly and completely understand the present invention. It should be understood that the drawings and embodiments of the present invention are only for exemplary purposes and are not used to limit the protection scope of the present invention.

[0025] Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as commonly understood by those skilled in the technical field to which the present invention belongs. The terms used in the present invention in the specification are only for the purpose of describing specific implementation manners and are not intended to limit the present invention.

[0026] In the related art, biomarker-based diagnostic methods have shown great potential in the diagnosis of various diseases. In the field of inflammatory bowel disease research, studies have reported the abnormal expression of certain microRNAs (miRNAs) and long non-coding RNAs (lncRNAs, non-coding RNAs with a length greater than 200 nucleotides) in the blood of patients with Crohn's disease (CD). Enhancers are short clusters of regulatory DNA elements, spanning 500 - 2000 bp, usually marked by histone modification, which can be recognized and transcribed by transcription factors, generating enhancer RNAs (eRNAs) through RNA polymerase II (RNA Pol II). Recent studies have found that enhancer RNA (eRNA) transcription may be a biomarker in response to enhancer activity and can participate in the regulation of coding gene transcription. In inflammatory responses, active enhancers and nuclear eRNAs are preferentially expressed in inflammation-related genes, indicating that enhancer transcription events and their products affect the expression and function of inflammatory genes. Therefore, eRNA may be a potential biomarker for various diseases, capable of reflecting specific tissue or disease states, providing the possibility for the development of new diagnostic methods. Especially in inflammatory diseases such as CD, the detection and application of eRNA have important clinical value.

[0027] In view of the problems existing in the above-mentioned related art, this embodiment provides a composition for diagnosing Crohn's disease, a kit, and the use of enhancer RNA44345 in the preparation of the composition.

[0028] The use of enhancer RNA44345 provided by the embodiment of the present invention in the preparation of a composition for diagnosing Crohn's disease, where enhancer RNA44345 is used as a detection biomarker for the composition for diagnosing Crohn's disease.

[0029] In this embodiment, as a detection biomarker for the composition for diagnosing Crohn's disease, enhancer RNA44345 has a sensitivity of 74.6% and a specificity of 81.7%. Both the sensitivity and specificity are relatively high, which can provide a new tool for the early diagnosis and prognosis assessment of Crohn's disease.

[0030] Optionally, the sequence of enhancer RNA44345 is SEQ ID NO: 1.

[0031] Specifically, the sequence of enhancer RNA44345 is

[0032]

[0033] A composition for diagnosing Crohn's disease provided by an embodiment of the present invention has an enhancer RNA44345 as a detection marker. The composition for diagnosing Crohn's disease includes an upstream primer Prime F and a downstream primer Prime R. The specific sequences of the upstream primer Prime F and the downstream primer Prime R are as follows:

[0034] Prime F(5'-CAAACAAACAATTAGCTCTGAGGTC-3'): SEQ ID NO: 2;

[0035] Prime R(5'-TTGCTGAAAGCTCCCTCGTTA-3'): SEQ ID NO: 3.

[0036] A kit for diagnosing Crohn's disease provided by an embodiment of the present invention includes the composition for diagnosing Crohn's disease as described above.

[0037] Optionally, it further includes a qPCR reaction premix (qPCR Master Mix) and RNase-free water (RNase-free H2O).

[0038] Optionally, the qPCR reaction premix includes a hot start DNA polymerase, SYBR Green I fluorescent dye, deoxynucleoside triphosphates, and Mg 2+ .

[0039] Specifically, the qPCR reaction system (25 μL) is shown in Table 1. In Table 1, μM is a concentration unit, which refers to the concentration expressed as the parts per million of the solute mass in the total solution mass, also known as parts per million concentration. 1 μM = 1 μmol / L = 1 pmol / μL.

[0040] Table 1 qPCR reaction system table

[0041] Component Volume (μL) <![CDATA[RNase-free H2O]]> 10.9 μL cDNA 1 μL Prime F (10 μM) 0.3 μL Prime R (10 μM) 0.3 μL qPCR Master Mix 12.5 μL

[0042] The qPCR reaction program in the kit is shown in Table 2.

[0043] Table 2 qPCR reaction program table

[0044]

[0045] Optionally, it further includes an RNA extraction reagent.

[0046] Optionally, the RNA extraction reagent includes Trizol LS reagent, chloroform, isopropanol, 75% (volume fraction) ethanol, and RNase-free water.

[0047] Specifically, 250 μL of plasma sample can be taken into a 1.5 mL nuclease-free centrifuge tube; 750 μL of Trizol LS reagent is added, vortex-shaken for 15 seconds, and left standing at 4 °C for 10 minutes; after instantaneous centrifugation, 200 μL of chloroform is added and manually shaken 6 times; after leaving standing at 4 °C for 3 minutes, centrifuge at 12,000 rpm for 15 minutes; take 500 μL of the upper clear liquid and add it to 500 μL of pre-prepared isopropanol; after mixing, leave standing at 4 °C for 10 minutes, and then centrifuge at 12,000 rpm for 10 minutes; discard the supernatant, add 1 mL of pre-cooled 75% (volume fraction) ethanol to wash the precipitate; centrifuge at 12,000 rpm for 3 minutes, discard the supernatant and then centrifuge briefly for 1 minute again; dry at room temperature for 3 minutes, and add 8 μL of RNase-free water to dissolve the RNA. Take 8 μL of the qualified RNA solution for subsequent reverse transcription reaction to synthesize cDNA.

[0048] Optionally, it further includes cDNA synthesis reagents.

[0049] Optionally, the cDNA synthesis reagents include 5×Polestar RT MasterMix, 20 μM OligodT (18) primer and RNase-free H2O.

[0050] Specifically, cDNA synthesis is carried out by the reverse transcription reaction of RNA. The reverse transcription reaction system (20 μL) of RNA is shown in Table 3.

[0051] Table 3 Reverse transcription reaction system table

[0052] Component Volume (μL) <![CDATA[RNase-free H2O]]> 7 μL 5×Polestar RT MasterMix (with dsDNase) 4 μL <![CDATA[OligodT (18)( 20μM)]]> 1 μL RNA amount 8 μL Total system 20 μL

[0053] cDNA synthesis reaction program: 25 °C for 10 min, 55 °C for 60 min, 85 °C for 5 min; the obtained cDNA can be stored frozen at -20 °C or directly used for fluorescence quantitative PCR.

[0054] The present invention will be further described below in conjunction with specific embodiments.

[0055] Example 1, enhancer RNA44345 is used as a detection marker for diagnosing Crohn's disease. The detection process in the kit is as follows.

[0056] This application collected 60 cases of plasma samples from CD patients and 139 cases of healthy people in the First Affiliated Hospital of Ningbo University. Informed consent was obtained from each person or their family members, and the relevant patient information was complete and a clinical data database was established according to regulations.

[0057] I. Plasma separation

[0058] Collect 5 mL of peripheral blood in a blood collection tube containing EDTA anticoagulant. Immediately place the blood collection tube in an environment at 4°C and let it stand for 30 minutes. Centrifuge at a speed of 3000 rpm for 10 minutes under the condition of 4°C. Carefully aspirate the upper-layer plasma and transfer it to a nuclease-free centrifuge tube. After aliquoting the plasma, store it in an ultra-low temperature freezer at -80°C for long-term preservation.

[0059] II. Plasma RNA Extraction

[0060] Take 250 μL of plasma sample in a 1.5 mL nuclease-free centrifuge tube. Add 750 μL of Trizol LS reagent, vortex for 15 seconds, and let it stand at 4°C for 10 minutes. After instantaneous centrifugation, add 200 μL of chloroform and manually shake 6 times. After standing at 4°C for 3 minutes, centrifuge at 12000 rpm for 15 minutes. Take 500 μL of the upper clear liquid and add it to 500 μL of pre-prepared isopropanol. After mixing, let it stand at 4°C for 10 minutes, and then centrifuge at 12000 rpm for 10 minutes. Discard the supernatant, add 1 mL of pre-cooled 75% (volume fraction) ethanol to wash the precipitate. Centrifuge at 12000 rpm for 3 minutes, discard the supernatant, and then centrifuge briefly for 1 minute again. Dry at room temperature for 3 minutes, and add 8 μL of RNase-free water to dissolve the RNA. Take 8 μL of the qualified RNA solution for the subsequent reverse transcription reaction to synthesize cDNA.

[0061] III. cDNA Synthesis: Strictly prepare the reverse transcription reaction solution according to the reverse transcription reaction system of the following components; perform the reverse transcription reaction to obtain the cDNA sample; the reverse transcription reaction system refers to Polestar1st cDNA Synthesis Kit (gDNA removal) produced by Beijing Baoying Tonghui Biotechnology Co., Ltd.

[0062] Reverse transcription reaction system (20 μL):

[0063]

[0064]

[0065] cDNA synthesis reaction program: 25°C for 10 min, 55°C for 60 min, 85°C for 5 min. The obtained cDNA can be stored at -20°C or directly used for fluorescence quantitative PCR.

[0066] IV. Construction of Standard Plasmid:

[0067] First, perform PCR amplification on eRNA44345, and the obtained product is verified by cloning and sequencing. Subsequently, insert the confirmed sequence (SEQ ID NO: 1) into the pUC57 vector to construct the recombinant plasmid pUC57-eRNA44345 (the sequence is SEQ ID NO: 4), as Figure 1As shown. The recombinant plasmid contains a 191-bp target insertion sequence (SEQ ID NO: 5) and has a total length of 2895 bp. The preparation of the recombinant plasmid was completed by a professional biotechnology company, such as Figure 2 as shown, Figure 2 shows the RACE sequencing results of eRNA44345, Figure 2 which includes the agarose gel electrophoresis diagram of the amplified fragment, the complete 5'-end sequence, the complete 3'-end sequence, and the schematic diagram of the specific upstream and downstream amplification primers designed for fluorescence quantitative PCR based on the eRNA44345 sequence, the RACE sequencing results of eRNA44345, Figure 2 which reflects the full length of eRNA44345 and the gene binding site when constructing the recombinant plasmid.

[0068] The sequence of the recombinant plasmid pUC57-eRNA44345 is specifically

[0069]

[0070] cacctgacgt ctaagaaacc attattatca tgacattaac ctataaaaat aggcgtatca cgaggccctt tcgtc (SEQ ID NO: 4).

[0071] The target insertion sequence is specifically

[0072] CAAACAAACAATTAGCTCTGAGGTCACATTGTGGGGATAATGGGGGTAGGGAGGGAAGAAAGAAAATTAGCACACACATTATCTGAGATTTTATTTCACAGCACGCGTACAAAGAAGTGCTGCATCCAGGGCACAAGAGATTACTGATGAAAGGAATTTACAGTGAAAGATAACGAGGGAGCTTTCAGCAA (SEQ ID NO: 5)

[0073] V. Quantitative analysis of the standard plasmid:

[0074] The lyophilized recombinant plasmid pUC57-eRNA44345 was resuspended with 50 μL of nuclease-free water (RNase-free H2O) to prepare an initial high-concentration standard. Its concentration and OD260 value were measured using a UV spectrophotometer. The measurement results showed that the concentration of pUC57-eRNA44345 was 168.4 ng / μL, and the corresponding OD260 reading was 3.373.

[0075] To calculate the plasmid copy number, the following formula is used: copies / μL = (6.02×10 23 copies / mol) × (OD260 × dilution factor × 50) ng / μL / (DNA length × 660 × 10 9 ) ng / mol. Among them, 660 represents the average molecular weight of 1 bp DNA, and the total plasmid length includes the sum of the vector backbone and the inserted sequence.

[0076] VI. Absolute quantitative PCR:

[0077] (1) Establishment of the standard curve: Dilute the high-concentration standard product in 7 gradients, and the dilution range is 5.31×10 3 -5.31×10 9 copies / μL; set 3 replicates for each concentration, add the samples to a 96-well PCR reaction plate; perform PCR amplification using the two-step method to obtain the Cq values corresponding to each concentration.

[0078] PCR reaction conditions: Initial denaturation at 95°C for 5 min; then 45 cycles: (denaturation: 95°C, 15 sec; annealing: 62°C, 20 sec; extension: 72°C, 30 sec).

[0079] (2) Standard curve analysis: Automatically generate the standard curve through the real-time fluorescence quantitative PCR system, as Figure 3 shown. Standard curve parameters: Correlation coefficient R 2 = 0.992, linear equation: Y = -4.343X + 51.62. Among them, Y is the Cq value, X is log 10 (copy number), amplification efficiency E = 69.9%.

[0080] (3) Sample quantitative analysis: Obtain the Cq value of the sample to be tested; calculate the copy number of eRNA44345 in the sample according to the standard curve equation; use the formula: copies / mL plasma = 80×10 X for conversion. Then perform statistical analysis on the copy number of eRNA44345 in the plasma of CD patients to evaluate its potential value as a biomarker.

[0081] VII. Evaluation of diagnostic efficacy:

[0082] Through the quantitative analysis of eRNA44345 in the plasma samples of Crohn's disease (CD) patients and healthy control groups, as Figure 4As shown, the copy number of eRNA44345 in plasma samples of patients with Crohn's disease (CD) was significantly lower than that in the healthy control group. The significantly downregulated expression of eRNA44345 in the plasma of patients with Crohn's disease, with the optimal cut-off value being 410,786 copies / mL plasma. Compare the copy number of the plasma sample to be tested with the cut-off value of 410,786 copies / mL to determine whether the patient has Crohn's disease (CD); if Figure 5 As shown, eRNA44345 has reliable diagnostic performance, and its curve (i.e., Figure 5 the thick curved solid line in Figure 5 ) significantly deviates from the reference line of random prediction (i.e., the straight diagonal line in

[0083] ). The potential value of eRNA44345 as a diagnostic biomarker was evaluated, and the specific results are as follows: the AUC was 0.868; the sensitivity was 74.6%; and the specificity was 81.7%.

[0084] Based on the above data, the present invention confirms that eRNA44345 can be used as an effective plasma biomarker for the early screening and diagnosis of Crohn's disease.

[0085] Although the present invention is disclosed as above, the scope of protection of the present invention is not limited thereto. Those skilled in the art can make various changes and modifications without departing from the spirit and scope of the present invention, and these changes and modifications will all fall within the scope of protection of the present invention.

Claims

1. Use of enhancer RNA 44345 in preparing a composition for diagnosing Crohn's disease, characterized in that: The enhancer RNA 44345 is used as a detection marker of the composition for diagnosing Crohn's disease.

2. Use of the enhancer RNA 44345 according to claim 1 in preparing a composition for diagnosing Crohn's disease, characterized in that: The sequence of the enhancer RNA 44345 is SEQ ID NO:

1.

3. A composition for diagnosing Crohn's disease, characterized in that: The detection marker is enhancer RNA 44345. The composition for diagnosing Crohn's disease includes an upstream primer Prime F and a downstream primer Prime R. The specific sequences of the upstream primer Prime F and the downstream primer Prime R are as follows: Prime F(5'-CAAACAAACAATTAGCTCTGAGGTC-3'): SEQ ID NO: 2; Prime R(5'-TTGCTGAAAGCCTCCTCGTTA-3'): SEQ ID NO:

3.

4. A kit for diagnosing Crohn's disease, characterized in that: The composition for diagnosing Crohn's disease as claimed in claim 3.

5. The kit for diagnosing Crohn's disease according to claim 4, characterized in that: Also included are qPCR reaction master mix and RNase-free water.

6. The kit for diagnosing Crohn's disease according to claim 5, characterized in that: The qPCR reaction premix includes hot-start DNA polymerase, SYBR Green I fluorescent dye, deoxyribonucleoside triphosphates and Mg 2+ .

7. The kit for diagnosing Crohn's disease according to claim 4, characterized in that: Also included are reagents for RNA extraction.

8. The kit for diagnosing Crohn's disease according to claim 7, characterized in that: The RNA extraction reagent comprises Trizol LS reagent, chloroform, isopropanol, 75% (volume fraction) ethanol and RNase-free water.

9. The kit for diagnosing Crohn's disease according to claim 4, characterized in that: Also included are reagents for cDNA synthesis.

10. The kit for diagnosing Crohn's disease according to claim 9, characterized in that: The cDNA synthesis reagents include 5×Polestar RT MasterMix, 20 μM OligodT (18) Primers and RNase-free water.

Citation Information

Patent Citations

  • Compositions and methods for modifying target RNA

    CN116547384A

  • ERNA molecular marker for auxiliary diagnosis of Crohn disease and application of eRNA molecular marker

    CN119061137A

  • Use of enhancer RNA as target in preparation of drug for preventing and treating inflammatory bowel disease

    WO2024207619A1