GADD45G as chemotherapeutic drug induced myocardial injury biomarker and application of GADD45G in research and development of therapeutic drugs

By finding that Gadd45g is upregulated in doxorubicin-induced myocardial injury, and by specifically knocking out or knocking down Gadd45g of cardiomyocytes, the problem of doxorubicin-induced myocardial injury was solved, and technical means of detection and reduction of damage were realized.

CN120174083APending Publication Date: 2025-06-20CHINESE ACADEMY OF MEDICAL SCIENCES FUWAI HOSPITAL SHENZHEN HOSPITAL (SHENZHEN SUN YAT-SEN CARDIOVASCULAR HOSPITAL)
View PDF 0 Cites 0 Cited by

Patent Information

Application Number
CN202510335742.8
Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Filing Date
2025-03-20
Publication Date
2025-06-20

AI Technical Summary

Technical Problem

Doxorubicin-induced myocardial injury has problems that are difficult to solve in clinical and basic research, and its specific molecular mechanism has not been fully elucidated.

Method used

Through research, it was found that Gadd45g was upregulated in myocardial injury induced by doxorubicin in vitro. The specific knockdown of Gadd45g in cardiomyocytes can inhibit the pathological process of myocardial injury induced by doxorubicin, and explored the mode of death. It was found that overexpression of Gadd45g inhibited autophagy and ferrode death and promoted cardiomyocyte apoptosis; knockdown of Gadd45g promoted autophagy and ferrode death and inhibited cardiomyocyte apoptosis.

Benefits of technology

It is revealed that Gadd45g can be used as a biomarker for cardiomyocyte injury induced by doxorubicin. By detecting the expression level of Gadd45g, it can detect the degree of myocardial injury induced by doxorubicin, providing a new technical means for in vitro detection, and reducing doxorubicin-induced myocardial injury by knocking down Gadd45g.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN120174083A_ABST
    Figure CN120174083A_ABST
Patent Text Reader

Abstract

The invention relates to the technical field of adriamycin-induced myocardial injury, in particular to GADD45G serving as a chemotherapeutic drug-induced myocardial injury biomarker and application of the GADD45G in research and development of therapeutic drugs. The biomarker is 45g of Gadd. The Gadd45g can be used as a biomarker of adriamycin-induced myocardial cell injury, the adriamycin-induced myocardial cell injury degree can be detected by detecting the expression level of the Gadd45g, and a brand-new technical means is provided for in-vitro detection of the adriamycin-induced myocardial cell injury degree. In addition, by knocking down 45g of Gadd, myocardial injury induced by adriamycin can be relieved.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present application relates to the technical field of doxorubicin-induced myocardial injury, and specifically to GADD45G as a biomarker of myocardial injury caused by chemotherapy drugs and its application in the development of therapeutic drugs. Background Art

[0002] Doxorubicin (Dox) is an anthracycline antibiotic widely used in tumor treatment. It exerts its anti-tumor effect by interfering with DNA synthesis and replication of tumor cells. However, the clinical application of Dox is limited by its severe cardiotoxicity, especially the myocardial damage induced by it, which is a difficult problem to be solved urgently in clinical and basic research. Studies have shown that Dox-induced myocardial damage is closely related to mechanisms such as oxidative stress, cell death, inflammatory response, and fibrosis, but its specific molecular mechanism has not yet been fully elucidated. Summary of the invention

[0003] This application found through research that Gadd45g is upregulated in Dox-induced myocardial injury in vitro; cardiomyocyte-specific knockout of Gadd45g inhibits the pathological process of Dox-induced myocardial injury in mice; further exploration of the mode of death found that overexpression of Gadd45g inhibits autophagy and ferroptosis, and promotes Dox-induced cardiomyocyte apoptosis; knocking down Gadd45g promotes autophagy and ferroptosis, and inhibits Dox-induced cardiomyocyte apoptosis. The results of differential fund enrichment analysis and KEGG analysis of myocardial tissue transcriptome sequencing showed that cardiomyocyte-specific knockout of Gadd45g mainly affected the expression of related genes such as translation and ribosomes. The results of the puromycin incorporation experiment showed that overexpression of Gadd45g further enhanced the effect of Dox on protein translation. This application reveals that Gadd45g can be used as a biomarker for doxorubicin-induced cardiomyocyte injury, and the degree of doxorubicin-induced myocardial injury can be detected by detecting the expression level of Gadd45g, providing a new technical means for in vitro detection of the degree of doxorubicin-induced cardiomyocyte injury. In addition, the present application can alleviate doxorubicin-induced myocardial injury by knocking down Gadd45g.

[0004] The GADD45 family (Growth Arrest and DNA Damage-inducible 45) is a protein that is highly expressed under cellular stress conditions and is involved in processes such as DNA damage repair, cell cycle regulation, apoptosis, and inflammatory response. GADD45g is a member of the GADD45 family and can be used as a new tumor suppressor to treat various cancers such as acute myeloid leukemia, liver cancer, and breast cancer. In addition, GADD455g-mediated DNA demethylation is also believed to contribute to the antidepressant effect of metformin.

[0005] To this end, the embodiments of the present application disclose at least the following technical solutions:

[0006] In a first aspect, an embodiment discloses a biomarker for adriamycin-induced cardiomyocyte injury, and the biomarker is Gadd45g.

[0007] In a second aspect, an embodiment discloses a reagent for detecting adriamycin-induced cardiomyocyte injury, including primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2, and primer pairs shown in SEQ ID NO:3 and SEQ ID NO:4. The primer pairs are used for PCR amplification of the gene sequence of Gadd45g.

[0008] In a third aspect, an embodiment discloses an RT-PCR kit for detecting adriamycin-induced cardiomyocyte injury, including primer pairs shown in SEQ ID NO:1 and SEQ ID NO:2, and primer pairs shown in SEQ ID NO:3 and SEQ ID NO:4. The primer pairs are used for PCR amplification of the gene sequence of Gadd45g.

[0009] In a fourth aspect, an embodiment discloses a double-stranded RNA for interfering with Gadd45g in cardiomyocytes. The sense strand of the double-stranded RNA is as shown in SEQ ID NO:15, and the antisense strand of the double-stranded RNA is as shown in SEQ ID NO:16.

[0010] In a fifth aspect, an embodiment discloses a drug for alleviating adriamycin-induced cardiomyocyte injury, which uses a double-stranded RNA for interfering with Gadd45g in cardiomyocytes as an active ingredient. The sense strand of the double-stranded RNA is as shown in SEQ ID NO:15, and the antisense strand of the double-stranded RNA is as shown in SEQ ID NO:16.

[0011] In a sixth aspect, an embodiment discloses the use of a double-stranded RNA for interfering with Gadd45g in cardiomyocytes and a gRNA in the preparation of a drug for alleviating adriamycin-induced cardiomyocyte injury. The sense strand of the double-stranded RNA is as shown in SEQ ID NO:15, and the antisense strand of the double-stranded RNA is as shown in SEQ ID NO:16. The gRNA is as shown in SEQ ID NO:16, and the gRNA guides Cas9 to targetedly knockout Gadd45g in cardiomyocytes.

[0012] In a seventh aspect, an embodiment discloses the application of Gadd45g, and the application is selected from at least one of: being used as a biomarker for adriamycin-induced cardiomyocyte injury; being used as a target to prepare a drug for preventing or treating adriamycin-induced cardiomyocyte injury; and being used as a target to prepare a reagent for detecting adriamycin-induced cardiomyocyte injury.

[0013] In an eighth aspect, an embodiment discloses a method for constructing a Gadd45g gene knockout mouse, including: synthesizing a gRNA as shown in SEQ ID NO: 16, and introducing it together with Cas9 enzyme (GMP-CA9S18, AcroBIOSYSTEMS) into a mouse fertilized egg; and cultivating the fertilized egg into which the gRNA and Cas9 enzyme have been introduced into a positive embryo and a positive mouse individual.

[0014] In some embodiments of the eighth aspect, the steps of obtaining a Flox conditional knockout mouse with a LoxP sequence upstream of the Gadd45g gene include:

[0015] Preparing a PX458 recombinant plasmid carrying the sgRNA expression element and Cas9 protein expression element of the nucleotide sequences shown in SEQ ID NO: 18 and 19;

[0016] Synthesizing a donor DNA fragment as shown in SEQ ID NO: 20;

[0017] Introducing the PX458 recombinant plasmid and the donor DNA into mouse embryonic stem cells, and screening for positive single cell clones;

[0018] Injecting the positive monoclonal cells into a mouse blastocyst, transplanting the injected blastocyst into the uterus of a pseudopregnant female mouse, allowing the embryo to develop in the female mouse, and screening for Flox conditional knockout mice from the offspring mice. Description of the Drawings

[0019] Figure 1 Results of the test example of constructing a mouse model of myocardial injury induced by doxorubicin. Figure 1 A is the gross view of the hearts of mice in the Vehicle group and the Dox group. Figure 1 B is a column chart of the HW / BW of mice in the Vehicle group and the Dox group. Figure 1 C is a column chart of the relative expression levels of IL6 mRNA in mice in the Vehicle group and the Dox group. Figure 1 D is a column chart of the relative expression levels of Tnfα mRNA in mice in the Vehicle group and the Dox group. Figure 1 E is a column chart of the CK enzyme activity in the sera of mice in the Vehicle group and the Dox group. Figure 1 F is a column chart of the CK-MB enzyme activity in the sera of mice in the Vehicle group and the Dox group. Figure 1 G is a column chart of the LDH enzyme activity in the sera of mice in the Vehicle group and the Dox group. Figure 1 H is a column chart of the LDH1 enzyme activity in the sera of mice in the Vehicle group and the Dox group. *P<0.05, ***P<0.001.

[0020] Figure 2 Results of the alleviation of the pathological process of doxorubicin-induced myocardial injury in the hearts of Gadd45g mice in the Vehicle group and Dox group provided for the test example.

[0021] Figure 2 A is the gross view of the hearts of Gadd45g mice in the Vehicle group and Dox group provided for the test example.

[0022] Figure 2 B is the column statistical chart of HW / BW of Gadd45g mice in the Vehicle group and Dox group provided for the test example.

[0023] Figure 3 HE staining map of myocardial tissue of Gadd45g mice in the Vehicle group and Dox group provided for the test example.

[0024] Figure 4 Column statistical chart of the relative expression levels of Gadd45g mRNA (A), IL6 mRNA (C), and Tnfα mRNA (B) in myocardial tissue of Gadd45g mice in the Vehicle group and Dox group provided for the test example. *P<0.05, ***P<0.001, compared with Vehicle, ##P<0.01, P<0.001.

[0025] Figure 5 Column statistical chart of the activity detection of CK myocardial enzyme (A), CK-MB myocardial enzyme (B), LDH myocardial enzyme (C), and LDH1 myocardial enzyme (D) in myocardial tissue of Gadd45g mice in the Vehicle group and Dox group provided for the test example.

[0026] Figure 6 Survival curves of Flox and cKO mice after doxorubicin treatment provided for the test example.

[0027] Figure 7A PCA map of the overall gene distribution profile of Gadd45g knockdown mice provided for the test example,

[0028] Figure 7B Scatter plot of up- and down-regulated differential genes between different groups of Gadd45g knockdown mice provided for the test example.

[0029] Figure 7C GO analysis map of Gadd45g knockdown mice provided for the test example.

[0030] Figure 7D KEGG analysis map of Gadd45g knockdown mice provided for the test example.

[0031] Figure 8 Microscopic examination images (A) and bar chart of Gadd45g mRNA expression levels of cardiomyocytes treated with different concentrations of Dox.

[0032] Figure 9 Results of overexpressing Gadd45g promoting Dox-induced cardiomyocyte apoptosis provided for WB test cases, *P < 0.05, ***P < 0.001, compared with Vehicle, ##P < 0.01, P < 0.001, with 3 samples in each group.

[0033] Figure 10 Results of knocking down Gadd45g promoting Dox-induced cardiomyocyte apoptosis provided for WB test cases, *P < 0.05, ***P < 0.001, compared with Vehicle, ##P < 0.01, P < 0.001, with 3 samples in each group.

[0034] Figure 11 Coomassie blue staining images (A) and quantitative statistical charts (B) of total protein gels in Gadd45g inhibiting Dox-induced myocardial injury provided for puromycin incorporation test cases. *P < 0.05, ***P < 0.001; compared with Vehicle, #P < 0.05, with 3 samples in each group. Detailed implementation manners

[0035] In order to make the objectives, technical solutions and advantages of this application clearer, the following further details this application in combination with embodiments. It should be understood that the specific embodiments described herein are only used to explain this application and are not used to limit this application. Reagents not described in detail and separately in this application are all conventional reagents and can be obtained from commercial channels; methods not described in detail and specifically are all conventional experimental methods and can be learned from the prior art.

[0036] Gadd45g can serve as a marker for doxorubicin-induced myocardial injury

[0037] 1. Animal feeding

[0038] All experimental procedures in this project have been reviewed and approved by the Animal Care and Use Committee of Shenzhen Hospital, Fuwai Hospital, Chinese Academy of Medical Sciences, and are carried out in accordance with the Guide for the Care and Use of Laboratory Animals (8th Edition) published by the National Institutes of Health (USA). All mice are raised in a specific relatively clean environment (room temperature, 24 ± 3 °C; room humidity 55 ± 5%); 12-hour light / 12-hour dark cycle, and fed with normal feed. This study uses 8-week-old male mice with a C57BL / 6 background (body weight 24 - 26 g); the number of mice studied in each experiment is stated.

[0039] 2. Construction of mice with adriamycin-induced myocardial injury

[0040] Wild-type C57BL / 6j mice were randomly divided into a Vehicle group and a Dox group. The grouping information was blinded between the researchers performing the surgery and the data analysts. Mice in the Dox group were intraperitoneally injected with adriamycin at a single dose of 7.5 mg / kg every other day for a total of 2 times, with a total dose of 15 mg / kg (n = 10). Mice in the Vehicle group were given an equal volume of normal saline, and the remaining operations were the same as those in the Dox group. They were sacrificed 1 week after the last administration.

[0041] Subsequently, the heart size was observed and statistically analyzed, and the ratio of heart weight to body weight (HW / BW) was calculated.

[0042] Whole blood samples were collected from the mice in the Vehicle group and the Dox group after the last administration, allowed to stand at room temperature for 30 minutes, centrifuged at 3000 rpm for 10 minutes at 4°C, and the serum was separated. The contents of four myocardial enzymes in the serum were detected by a fully automatic biochemical analyzer (Rayto Life and Analytical Sciences) using detection kits for CK (Rayto Life and Analytical Sciences), CK-MB (Rayto Life and Analytical Sciences), LDH (Rayto Life and Analytical Sciences), and LDH1 (Huili Biotech) to evaluate the degree of myocardial injury.

[0043] In addition, the relative expression levels of the inflammatory factors IL-6 and Tnf-α mRNA in the myocardial tissues of the mice in the Vehicle group and the Dox group were detected by RT-PCR to evaluate the degree of myocardial injury.

[0044] Total RNA was extracted from the myocardial tissues of the mice in the Vehicle group and the Dox group using Trizol. Reverse transcription was performed using the First Strand cDNA Synthesis Kit purchased from Thermo Fisher Scientific to obtain cDNA. After the reverse transcription reaction was completed, it was centrifuged briefly, and the cDNA product was diluted to 10 times its volume with ddH2O for real-time fluorescence quantitative PCR. The PCR amplification system consisted of 0.5 μL of upstream primer, 0.5 μL of downstream primer, 1 μL of cDNA product, 5 μL of 2×SYBR Green Master MIX (Mona, Suzhou, China), and the remaining volume of double-distilled water in a total of 10 μL. The PCR reaction steps included: pre-denaturation at 95°C for 5 min; one cycle consisting of denaturation at 95°C for 10 s, annealing at 60°C for 10 s, and extension at 72°C for 10 s, for a total of 35 cycles; final extension at 72°C for 5 min and incubation at 16°C. After the reaction was completed, the specificity of the primers was judged by the melting curve, and by 2 -ΔΔCtThe value was calculated to obtain the relative expression level of the target gene mRNA. Table 1 involves primer pairs for genes rGadd45g, mGadd45g, mTnfα, mIL6, and mGAPDH. In Table 2, "m" represents mouse and "r" represents rat.

[0045] Table 1

[0046] Primer Name Sequence (5'→3') rGadd45g-qF aagtcctgaatgtggaccctg, SEQ ID NO:1 rGadd45g-qR gggttcgaaatgaggatgcaa, SEQ ID NO:2 mGadd45g-qF tgattcaggcgttctgctgt, SEQ ID NO:3 mGadd45g-qR agggtccttccatgtgtcct, SEQ ID NO:4 rGAPDH-qF acagcaacagggtggtggac, SEQ ID NO:5 rGAPDH-qR tttgagggtgcagcgaactt, SEQ ID NO:6 mTnfα-qF aggcactcccccaaaagatg, SEQ ID NO:7 mTnfα-qR ccacttggtggtttgtgagtg, SEQ ID NO:8 mIL6-qF acaaagccagagtccttcagag, SEQ ID NO:9 mIL6-qR tgtgactccagcttatctcttgg, SEQ ID NO:10 mGAPDH-qF tcctgcaccaccaactgcttag, SEQ ID NO:11 mGAPDH-qR gatgaccttgcccacagccttg, SEQ ID NO:12

[0047] As Figure 1 shown in A Figure 1 and B, the heart weight of the mice in the Dox group decreased and the volume became smaller, indicating that doxorubicin did cause damage to the myocardium of the mice. As Figure 1 shown in C Figure 1 and D, the expression of inflammatory factors in the heart tissue of the mice in the Dox group increased significantly, indicating that doxorubicin induced a myocardial inflammatory response in the mice. As Figure 1 shown in E - H, the activities of four myocardial enzymes in the heart tissue of the mice in the Dox group increased significantly, indicating that doxorubicin induced myocardial damage in the mice.

[0048] This indicates that doxorubicin did cause damage to the myocardium of the mice, and the model was successfully constructed.

[0049] Knockout of the Gadd45g gene alleviates or eliminates doxorubicin - induced myocardial cell damage in mice

[0050] This application further found that the Gadd45g gene (GeneBank ID: 23882) is related to doxorubicin - induced myocardial cell damage in mice, and knocking out the Gadd45g gene can alleviate or eliminate doxorubicin - induced myocardial cell damage.

[0051] For this purpose, the embodiment provides a method for constructing Gadd45g heart - specific knockout mice. The method includes: obtaining Flox conditional knockout mice with LoxP sequences upstream of the Gadd45g gene; hybridizing the expanded and bred Flox conditional knockout mice with αMHC - MerCreMer (MCM, Jiangsu Jicui Yakang Biotechnology Co., Ltd.) mice carrying CRE enzyme to obtain the mice to be induced with inducible knockout of the Gadd45g gene; inducing the mice to be induced with tamoxifen (for example, at a concentration of 40 mg / kg) to obtain Gadd45g heart - specific knockout mice (named cKO mice). Among them, the steps of obtaining Flox conditional knockout mice with LoxP sequences upstream of the Gadd45g gene include:

[0052] (1) Synthesize sgRNA

[0053] Synthesize the sgRNA targeting the upstream of the Gadd45g gene knockout region (SEQ ID NO:18) and the sgRNA targeting the downstream of the Gadd45g gene knockout region (SEQ ID NO:19).

[0054] (2) Construct an expression vector carrying the Cas9 protein expression element and the sgRNA expression element:

[0055] Clone the nucleotide sequences shown in SEQ ID NO:18 and 19 into the appropriate expression vector PX458, which carries the Cas9 protein expression element and the sgRNA expression element.

[0056] (3) Synthesize the donor DNA:

[0057] Synthesize the donor DNA fragment shown in SEQ ID NO:20 (containing the LoxP sequence, ATAACTTCGTATAATGTATGCTATACGAAGTTAT, as shown in SEQ ID NO:21).

[0058]

[0059] (4) Cell transfection:

[0060] Isolate embryonic stem cells (ES cells) from mouse embryos and culture them in a suitable medium to keep them in good growth condition. Introduce the constructed expression vector carrying the Cas9 protein expression element and the sgRNA expression element and the donor DNA fragment into ES cells by methods such as electroporation and liposome transfection. When performing electroporation, set appropriate voltage, capacitance, and pulse time parameters, such as voltage 200 - 300V, capacitance 950 - 1000 μF, and pulse time 5 - 10 ms, to improve the transfection efficiency.

[0061] (5) Screen for positive clones

[0062] Use the selection marker carried on the vector, such as the puromycin resistance gene, to screen the transfected ES cells in a medium containing puromycin. After 2 - 3 days of culture, pick the surviving monoclonal cells, expand the culture, and verify by PCR to screen out the positive monoclonal cells, which are the ES cells carrying the LoxP sequence. The screened positive monoclonal cells can be further identified by Southern blot.

[0063] (6) Embryo manipulation and transplantation:

[0064] ​Inject the identified positive monoclonal cells into mouse blastocysts, usually injecting 10 - 15 ES cells into each blastocyst. Transplant the injected blastocysts into the uterus of pseudopregnant female mice to allow the embryos to develop in the female mice. After the offspring mice are born, cut the tail tissues of the mice, extract genomic DNA, and detect the mouse genome again by methods such as PCR and Southern blot to confirm whether the LoxP sequence has been successfully integrated upstream of the target gene, thereby obtaining a mouse model with LoxP sequence insertion.

[0065] 2. Doxorubicin induction

[0066] Randomly divide the Flox mice (8 weeks old, body weight 24 - 26 g) and cKO mice (8 weeks old, body weight 24 - 26 g) constructed in the above steps into a Vehicle group and a Dox group respectively. The grouping information is double - blind between the researchers performing the surgery and the data analysts. Inject the mice in the Dox group intraperitoneally with a single dose of 7.5 mg / kg body weight of doxorubicin, administer the drug every other day for a total of 2 times. Sacrifice the mice 1 week after the last administration. The Vehicle group is given an equal volume of normal saline, and the rest of the operations are the same as those in the Dox group.

[0067] 3. Detection of organ indexes and HE staining

[0068] Sacrifice the mice 1 week after the last administration. Weigh the mice, dissect and take samples. Refer to the above method to detect the ratio of heart weight to body weight (HW / BW), the ratio of lung weight to body weight (LW / BW), and the ratio of heart weight to tibia length (HW / TL).

[0069] As Figure 2 shown, it can be seen from the gross heart diagram and cross - sectional diagram that Dox treatment makes the hearts of mice smaller, and compared with Flox, knocking out Gadd45g can reverse the heart reduction caused by Dox treatment.

[0070] 4. HE staining

[0071] For each group, take 5 hearts and fix them with 10 - fold volume of 4% paraformaldehyde. After 24 h, place the mouse hearts on a photographing board and take gross heart pictures with a camera (Nikon D700). Then dehydrate the hearts, embed them in paraffin, and section (longitudinal section, thickness 5 μm). Stain the sections with hematoxylin - eosin (HE) for histopathological examination, or stain with wheat germ agglutinin (WGA) to measure the cross - sectional area (CSA) of cardiomyocytes, or use masson staining to evaluate collagen deposition. Observe these stained sections under a microscope and then analyze them with Image - Pro Plus 6.0 (Media Cybernetics, Bethesda, MD, USA). In each group, more than 200 cardiomyocytes are measured to calculate the CSA and count the myocardial infarction area.

[0072] As Figure 3 shown, knocking out Gadd45g inhibits cardiomyocyte apoptosis.

[0073] 5. RT-PCR

[0074] Referring to the above method, the relative expression levels of inflammatory factors and Gadd45g mRNA in myocardial tissues were detected. As Figure 4 shown, the relative expression level of Gadd45g mRNA in cKO mice was significantly lower than that in Flox mice in both the Vehicle group and the Dox group, indicating successful cardiac-specific knockout of Gadd45g. In addition, compared with Flox mice, the pathological degree of myocardial tissues in cKO mice was less severe. This shows that knocking out Gadd45g can reduce or alleviate the inflammatory response of the myocardium induced by doxorubicin in mice.

[0075] 6. Detection of myocardial enzyme content

[0076] Referring to the above method, the myocardial enzyme content in the serum of mice in each group was detected. As Figure 5 shown, the myocardial enzyme content in the serum of cKO mice was significantly lower than that in Flox mice, indicating that cardiac-specific knockout of Gadd45g inhibits Dox-induced myocardial injury.

[0077] 7. Mortality statistics

[0078] As Figure 6 shown, within 10 days after Dox treatment, nearly 85% of Flox mice died, and the remaining 15% of Flox mice all died within 70 days; while for cKO mice, only about 35% died around 10 days after Dox treatment, and the remaining cKO mice had a maximum lifespan of more than 75 days.

[0079] The above results indicate that specific knockdown of cardiac Gadd45g inhibits the degree of Dox-induced myocardial injury and increases the survival rate. Gadd45g has the same change trend as Dox-induced myocardial death and has the application prospect as a biomarker for Dox-induced myocardial death.

[0080] 8. Transcriptome sequencing analysis

[0081] To explore the mechanism of action of Gadd45g in promoting cardiomyocyte apoptosis, the test example performed transcriptome sequencing analysis on the myocardial tissues of Flox and cKO mice with or without Dox treatment.

[0082] As Figure 7AAs shown, principal component analysis (PCA) revealed that knockout of Gadd45g resulted in a gene expression pattern different from that of Dox-induced transcriptional reprogramming in myocardial injury. Under Dox treatment conditions, knockout of Gadd45g significantly altered the transcriptional pattern of cardiomyocytes, with 1,257 genes showing altered expression; treatment with Dox alone led to changes in the expression of 2,045 genes; and comparing the differentially expressed genes between these two groups, 34 genes had the same expression trend in both groups, and 1,631 genes had opposite expression trends( Figure 7B ), suggesting that knockout of Gadd45g inhibited transcriptional reprogramming in Dox-induced myocardial injury.

[0083] As Figure 7C shown by GO analysis and as Figure 7D shown by KEGG analysis, specific knockout of Gadd45g in cardiomyocytes mainly affected the expression of genes related to translation, ribosome, etc. The overall analysis results indicated that Gadd45g might lead to transcriptional reprogramming of pro-myocardial injury by regulating the expression of genes related to translation and ribosome.

[0084] Interference with Gadd45g expression alleviates adriamycin-induced injury in rat cardiomyocytes

[0085] The example also interfered with the expression of the Gadd45g gene by an RNA interference-based method, and it was found that it could alleviate adriamycin-induced injury in rat cardiomyocytes.

[0086] 1. Treatment of neonatal rat cardiomyocytes with adriamycin

[0087] Newborn neonatal rats were humanely sacrificed, the heart tissue was taken out with surgical forceps, minced, digested with type II collagenase and 0.125% trypsin, and primary mouse cardiomyocytes (NRVMs) were obtained by density gradient centrifugation. The obtained cells were cultured in high-glucose DMEM (Hyclone) medium containing 10% fetal bovine serum (Gbico) and 1% penicillin / streptomycin for 24 h, and then the medium was changed to high-glucose DMEM containing 1% ITS and 1% penicillin / streptomycin for starvation treatment for 12 h for normalization, and divided into the Dox group and the Vehicle group. Cells in the Dox group were treated with medium containing 0 μM, 0.1 μM, 0.3 μM, 1 μM adriamycin for 24 h, and cells in the Vehicle group were added with an equal volume of ddH2O as a control.

[0088] 2. Cell morphology and relative expression level of Gadd45g mRNA

[0089] The morphology of cardiomyocytes in each group of rats was observed under a microscope, and the relative expression level of Gadd45g mRNA in cells of each group was detected by RT-PCR, and its primers were referred to Table 1 above.

[0090] As shown Figure 8 in Figure A, with the increase in the concentration of Dox-treated NRVMs, the death of primary cardiomyocytes increased. As shown Figure 8 in Figure B, with the increase in the concentration of Dox-treated NRVMs, the relative expression level of Gadd45g mRNA in each group of cells increased. This indicates that doxorubicin can promote cardiomyocyte death, and Gadd45g has the same changing trend as doxorubicin-induced myocardial death, showing the application prospect as a biomarker for doxorubicin-induced myocardial death.

[0091] 3. WB detection

[0092] Wash the rat cardiomyocytes to be tested with PBS, add RIPA lysis buffer at 100 μL / 1.5×10 5 cells to lyse them, extract total protein, measure the protein concentration by the BCA method, and adjust the concentration by supplementing RIPA lysis buffer with the lowest concentration as the standard. Subsequently, add 5× protein sample treatment solution according to the actual volume, boil the sample at 100 °C for 10 min, cool it on ice, then vortex, and then centrifuge at 12,000 rpm at room temperature for 1 min. Load the supernatant onto SDS-PAGE, transfer to a PVDF membrane, block it with 5% skim milk at room temperature for 1 h, then incubate with specific primary antibodies at 4 °C for 12 h. After washing 3 times with TBST, incubate with secondary antibodies (CST, 7074 / 7076, 1:10000) at room temperature for 1 h, and then wash 3 times with TBST. Finally, detect the protein bands on the membrane with a chemiluminescent reagent (Yeasen, Shanghai, China). The chemiluminescent signal is quantified using an ECL imager, and the gray value of the protein bands is statistically analyzed using software Image J. The specific primary antibodies are: anti-Flag (CST, 1:1000), anti-GAPDH-HRP (Proteintech, 1:10000), anti-P62 (Abclonal, 1:1000), anti-LC3 (CST, 1:1000), anti-Bax (CST, 1:1000), anti-Caspase3 (CST, 1:1000), anti-Cleaved Caspase3 (CST, 1:1000), anti-Gpx4 and anti-SLC7A11 (Abclonal, 1:1000).

[0093] 4. Overexpression of Gadd45g

[0094] The comparative example also transfected a recombinant plasmid overexpressing Gadd45g into rat cardiomyocytes to overexpress Gadd45g in rat cardiomyocytes, and it was found that the degree of damage to rat cardiomyocytes was aggravated.

[0095] Gadd45g CZF (SEQ ID NO:13, 5'ATAGGGAGACCCAAGCTGGCTAGCgccaccatgactctggaagaagtcc-3') and Gadd45g CZ (SEQ ID NO:14, 5'-ATCTGGTACGTCGTATGGGTATCTAGActcgggaagggtgatgctggg-3') were used as primer pairs to amplify the cDNA fragment of Gadd45g mature peptide (NM_001077640.2), which was cloned into the pcDNA3.1-HA plasmid (SEQ ID NO:17) to obtain the plasmid pcDNA3.1-Gadd45g-HA overexpressing Gadd45g. The pcDNA3.1-Gadd45g-HA plasmid was sent to Hanheng Biotechnology for adenovirus packaging to obtain the adenovirus containing the overexpressed Gadd45g sequence (adGadd45g). The empty adenovirus without the Gadd45g sequence was used as a control (adVector), and the adenovirus vectors were transfected into the cells of the Dox group and the Vehicle group respectively.

[0096] As Figure 9 shown, in the Vehicle group, compared with the control group adVector, overexpression of GADD45G led to an increase in the autophagy index P62 and a decrease in LC3II / I, indicating that the increase in P62 caused by the inhibition of autophagosome degradation inhibited cell autophagy; at the same time, the ferroptosis marker molecule GPX4 increased significantly with the overexpression of GADD45G, indicating that GADD45G inhibited the occurrence of ferroptosis; while the apoptosis index Bax increased significantly after overexpression of GADD45G, suggesting that GADD45G promoted cardiomyocyte apoptosis.

[0097] In the Dox group, overexpression of GADD45G also increased the autophagy marker P62 and decreased LC3II / I; the ferroptosis effector molecule GPX4 increased; the apoptosis index Cleaved caspase3 / caspasse3 increased significantly, and its increase effect was significantly higher than that in the Vehicle group; the above indicates that overexpression of GADD45G inhibits cardiomyocyte autophagy and ferroptosis and promotes cardiomyocyte apoptosis.

[0098] This indicates that overexpression of Gadd45g inhibits cardiomyocyte autophagy and ferroptosis and promotes cardiomyocyte apoptosis.

[0099] 5. Interference with the expression of Gadd45g gene

[0100] The embodiment provides a double-stranded RNA interfering with Gadd45g. The sense strand of the double-stranded RNA is ACGCUAUCGUGGAAGCUUUGAAUUU, as shown in SEQ ID NO:15. The antisense strand of the double-stranded RNA is AAAUUCAAAGCUUCCACGAUAGCGUCC, as shown in SEQ ID NO:16.

[0101] Based on this, the embodiment also provides a method for inhibiting Gadd45g in cardiomyocytes. The method includes: mixing the double-stranded RNA interfering with Gadd45g with a transfection reagent to form a complex of the double-stranded RNA and the transfection reagent; co-culturing the complex with cardiomyocytes; harvesting and screening positive cells from the co-culture, and the positive cells are the cardiomyocytes in which Gadd45g is inhibited.

[0102] In some embodiments, the method for inhibiting Gadd45g in cardiomyocytes specifically includes:

[0103] 1) Chemically synthesize the above double-stranded RNA interfering with Gadd45g and dissolve it in RNase-free water to 20 μM.

[0104] 2) Seed primary cardiomyocytes in a 6-well plate at an appropriate density (such as 3×10 5 cells / well), add 2 ml of complete medium to each well, culture in an incubator for 24 h, and then change to serum-free medium (1% ITS, 1% PS, 98% high-glucose DMEM medium) and culture for 12 h.

[0105] 3) Preparation of transfection complex: Operate according to the instructions of Lipofectamine RNAiMAX transfection reagent. In a sterile centrifuge tube, dilute 50 pmol of double-stranded RNA and 5 μL of transfection reagent to 100 μL with Opti-MEM medium respectively, gently mix, and incubate at room temperature for 5 min. Then mix the diluted double-stranded RNA and transfection reagent, gently mix, and incubate at room temperature for 20 min to form a complex of the double-stranded RNA and the transfection reagent.

[0106] 4) Cell transfection: Aspirate the original medium in the 6-well plate, and add 1.5 ml of serum-free double-antibody medium (1% ITS, 99% high-glucose DMEM medium) to each well. Then add the complex of double-stranded RNA and transfection reagent dropwise to the cell culture wells, gently shake the culture plate to make the complex evenly distributed. Put the culture plate back into the incubator and continue to culture for 6 h, then add serum-free medium (1% ITS, 1% PS, 98% high-glucose DMEM medium) and continue to culture for 42 h. During this period, the medium can be changed and drugs can be added according to different treatments.

[0107] Such as Figure 10As shown, in the Vehicle group, compared with the control group siNeg, interfering with the expression of the Gadd45g gene had no significant effect on autophagy and apoptosis indicators, but significantly reduced GPX4 and SLC7A11, suggesting that at the background level without drug stimulation, interfering with the expression of the Gadd45g gene could induce ferroptosis, which was opposite to the effect of overexpressing Gadd45g in inhibiting ferroptosis.

[0108] In the Dox group, interfering with the expression of the Gadd45g gene also significantly reduced GPX4 and SLC7A11; at the same time, it down-regulated the autophagy indicator P62 and up-regulated LC3II / I to promote autophagy; and inhibited the apoptosis indicators Bax and Cleaved caspase3 / caspase3 to inhibit cardiomyocyte apoptosis. Given that the effect of ferroptosis in overexpressing GADD45G was not significant, and GADD45G was up-regulated in Dox-induced myocardial injury, we believe that ferroptosis does not play a major role in GADD45G-regulated myocardial injury.

[0109] This indicates that interfering with the expression of the Gadd45g gene can promote cardiomyocyte autophagy, inhibit cardiomyocyte apoptosis, and reduce myocardial injury.

[0110] 6. Puromycin incorporation experiment

[0111] Based on the hints from the transcriptome sequencing results, in order to explore the effect of GADD45G on protein translation regulation, the test example conducted a puromycin incorporation experiment to evaluate the effect of Gadd45g on adriamycin-induced protein synthesis in cardiomyocytes.

[0112] The structure of puromycin is similar to the 3'-end of tyrosine or phenylalanine aminoacyl-tRNA carriers, can occupy the ribosomal A site, bind to the polypeptide chain synthesized by peptidyl transferase, and block the entry of the next aminoacyl-tRNA. Since puromycin binds weakly to the ribosomal A site, the formed polypeptide chain is released, and protein synthesis is prematurely terminated. Therefore, after cells are treated with puromycin, the rate of protein synthesis in cells can be reflected by detecting the content of puromycin using anti-puromycin specific antibodies through Western blot. The structure of puromycin is similar to the aminoacyl terminus of amino acid-tRNA and can bind to nascent polypeptides during translation. Therefore, the rate of protein synthesis can be detected by specific anti-puromycin antibodies.

[0113] For NRVMs with different treatments, 30 minutes before harvesting the cells, the cells were treated with puromycin at a final concentration of 1 μM for 30 minutes, and then the cells were harvested to extract proteins. The binding level of puromycin was detected by Western blot to reflect the translation rate of proteins.

[0114] As Figure 11 shown, the protein synthesis of cardiomyocytes treated with doxorubicin decreased significantly, and overexpression of Gadd45g could further reduce the protein synthesis rate of cardiomyocytes treated with doxorubicin, indicating that Gadd45g has a conserved inhibitory effect on protein synthesis.

[0115] As described above, the above are only the preferred specific embodiments of the present application, but the protection scope of the present application is not limited thereto. Any changes or substitutions that can be easily thought of by those skilled in the art within the technical scope disclosed by the present application should be covered by the protection scope of the present application.

Claims

1. A biomarker for doxorubicin-induced cardiomyocyte injury, the biomarker being Gadd45g.

2. A reagent for detecting adriamycin-induced cardiomyocyte injury, comprising a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and a primer pair as shown in SEQ ID NO: 3 and SEQ ID NO: 4, wherein the primer pair is used for PCR amplification of the gene sequence of Gadd45g.

3. An RT-PCR kit for detecting adriamycin-induced cardiomyocyte injury, comprising a primer pair as shown in SEQ ID NO: 1 and SEQ ID NO: 2, and a primer pair as shown in SEQ ID NO: 3 and SEQ ID NO: 4, wherein the primer pair is used for PCR amplification of the gene sequence of Gadd45g.

4. A double-stranded RNA that interferes with Gadd45g in cardiomyocytes, wherein the sense strand of the double-stranded RNA is shown in SEQ ID NO:15, and the antisense strand of the double-stranded RNA is shown in SEQ ID NO:

16.

5. A drug for alleviating adriamycin-induced cardiomyocyte injury, comprising a double-stranded RNA that interferes with cardiomyocyte Gadd45g as an active ingredient, wherein the sense strand of the double-stranded RNA is shown in SEQ ID NO: 15, and the antisense strand of the double-stranded RNA is shown in SEQ ID NO:

16.

6. Use of a double-stranded RNA and gRNA that interferes with cardiomyocyte Gadd45g in the preparation of a drug for reducing doxorubicin-induced cardiomyocyte damage, the sense strand of the double-stranded RNA being as shown in SEQ ID NO: 15, the antisense strand of the double-stranded RNA being as shown in SEQ ID NO: 16, the gRNA being as shown in SEQ ID NO: 16, and the gRNA guiding Cas9 to target knockout of cardiomyocyte Gadd45g.

7. Application of Gadd45g, the application is selected from: as a biomarker of doxorubicin-induced cardiomyocyte injury; as a target for the preparation of drugs to prevent or treat doxorubicin-induced cardiomyocyte injury; and At least one of the reagents for detecting adriamycin-induced cardiomyocyte injury is prepared as a target.

8. A method for constructing a Gadd45g knockout mouse, comprising: Obtain Flox conditional knockout mice with LoxP sequences upstream of the Gadd45g gene; The expanded Flox conditional knockout mice were crossed with mice carrying the CRE enzyme to obtain mice with inducible knockout of the Gadd45g gene; Gadd45g heart-specific knockout mice can be obtained by inducing the induced mice with tamoxifen.

9. The method according to claim 8, wherein: The steps for obtaining a Flox conditional knockout mouse having a LoxP sequence upstream of the Gadd45g gene include: Prepare a PX458 recombinant plasmid carrying the sgRNA expression element and the Cas9 protein expression element of the nucleotide sequence described in SEQ ID NO: 18 and 19; synthesizing a donor DNA fragment as shown in SEQ ID NO:20; Introducing the PX458 recombinant plasmid and donor DNA into mouse embryonic stem cells, and screening positive single cell clones; The positive monoclonal cells are injected into mouse blastocysts, and the injected blastocysts are transplanted into the uterus of pseudo-pregnant female mice, the embryos are allowed to develop in the female mice, and Flox conditional knockout mice are screened from the offspring mice.