Primer for molecular marker for detecting shank circumference of Dongtao chicken and its application
Through genome-wide association analysis and molecular marker primer design, the problem of slow progress in genetic selection of chicken tibia in the prior art was solved, and rapid genetic improvement of tibia traits in Dongtao chicken was achieved.
Patent Information
- Application Number
- CN202510608380.5
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2025-05-13
- Publication Date
- 2025-07-29
- Estimated Expiration
- 2045-05-13
AI Technical Summary
The prior art lacks genome-wide significance tests in chicken tibial genetic breeding, resulting in slow progress in genetic selection and difficulty in effectively improving chicken tibial traits.
Through genome-wide association analysis, the Chr1:68713248 (GRCg7b) site was excavated with the extremely high genetic correlation between the chicken tibia circumference. Molecular marker primers were designed to detect the tibia circumference of Dongtao chickens, and assisted selection breeding was used using PCR amplification and Sanger sequencing, and AA or AT genotype individuals were selected as breeders.
It significantly accelerated the genetic selection progress of specialized lines related to the thick tibial circumference of Dongtao Chicken and improved the genetic improvement efficiency of tibial traits.
Smart Images

Figure CN120174111B_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to the technical field of molecular markers, in particular to a primer for detecting molecular markers of the shank circumference of Dongtao chickens and its application. Background Art
[0002] The shank circumference of chickens is an important growth and carcass economic trait. A thicker shank circumference usually means stronger bones, which can support a greater body weight and reduce the culling rate caused by bone problems (such as lameness, fractures). At the same time, the thickness of the shank circumference is also one of the important indicators affecting carcass uniformity. Genetically, the shank circumference is a complex trait regulated by multiple genes, belonging to a trait with medium to high heritability, and has a strong phenotypic and genetic positive correlation with the body weight of broiler chickens.
[0003] For example, the application of genetic markers associated with the shank circumference in the FOXO1 gene disclosed in Chinese Patent Publication No. CN118995953A in chicken genetic breeding; the molecular markers of the SERCA2 gene related to chicken carcass traits and their application disclosed in Chinese Patent Publication No. CN116334235A; a SNP molecular marker related to the shank circumference of chickens and its application disclosed in Chinese Patent Publication No. CN117418016A. The similarity between this application and the above three is that they all develop relevant markers for chicken shank circumference for assisted selection breeding. The marker loci are respectively located in the gene regions of FOXO1 (1:170460219-170524492; GRCg7b), SERCA2 (15:5319274-5360262; GRCg7b), and PLA2G7 (3:109631987-109645042; GRCg7b), and are all developed based on SNPs loci within specific gene regions without performing a genome-wide significance test.
[0004] Therefore, developing molecular marker-assisted selection related to the shank circumference of chickens with a large genetic effect can accelerate the genetic selection progress of the shank circumference trait. Summary of the Invention
[0005] In order to solve the above technical problems, the present invention provides a primer for detecting molecular markers of the shank circumference of Dongtao chickens and its application.
[0006] To achieve the above object, the present invention is implemented according to the following technical scheme:
[0007] The first technical solution provided by the present invention is a primer for detecting molecular markers of the shank circumference of Dongtao chickens, including:
[0008] The upstream primer, with the sequence F: 5’-TGTGTGCTCACCCATAACCA-3’;
[0009] Downstream primer, with the sequence R: 5’-AGATGGGGTACAGAGGTCGAA-3’;
[0010] Among them, the specific chromosomal position of the molecular marker locus in the genome is determined after alignment with the chicken 7.0 reference genome GRCg7b. The molecular marker is Chr1:68713248, which is located on chromosome 1 of the chicken genome SCUBE1 At the 68713248th position within the gene region, it is an A / T mutation; the chicken is an F1 generation individual produced by cross-breeding Dongtao chicken as the paternal line of the F0 generation and Guangxi Nandan Yao chicken hen as the maternal line of the F0 generation, and then the F2 generation population is produced based on the F1 generation population cross
[0011] The second technical solution provided by the present invention is an application of the above primers in the assisted selection breeding for improving the shank circumference of Dongtao chicken, including the following steps:
[0012] S1. Extract the genomic DNA of the chicken to be tested;
[0013] S2. Use the primers to perform PCR amplification on the genomic DNA of the chicken to be tested. After the PCR amplification reaction program ends, perform Sanger sequencing on the product; select individuals with the AA or AT genotype at the molecular marker Chr1:68713248 locus as breeding chickens.
[0014] Furthermore, the PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2X Pro TaqMaster Mix (dye plus), 1 μL upstream primer with a concentration of 0.2 μM, 1 μL downstream primer with a concentration of 0.2 μM, and add enzyme-free and sterile water to make the total reaction system 50 μl; the PCR reaction program is 94 °C for 30 s; 98 °C for 10 s, 60 °C for 30 s, 72 °C for 1 min, 35 cycles; 72 °C for 2 min.
[0015] Compared with the prior art, the present invention conducts phenotypic determination related to the shank circumference at 300 days of age and whole-genome resequencing (individual average sequencing depth >10×) on 297 Dongtao chicken - Yao chicken F2 generation resource population individuals, conducts a genome-wide association analysis, and discovers that the locus Chr1:68713248 (GRCg7b) has a very high genetic correlation with the shank circumference at 300 days of age, and the genetic effect is very significant. Therefore, it can be effectively used for molecular marker-assisted selection breeding in the cultivation of Dongtao chicken specialized lines related to thick shanks. Selecting individuals with the AA or AT genotype at the molecular marker Chr1:68713248 (GRCg7b) locus as breeding chickens can accelerate the genetic selection progress of thick-shanked chickens in specialized lines related to Dongtao chicken blood Description of the Drawings
[0016] Figure 1 It is the construction process of the F2 full-sib family resource population of Dongtao chicken - Yaoji chicken.
[0017] Figure 2 It is the phenotypic statistics of shank circumference at 300 days old for the male and female populations of F0, F1, and F2 generations of Dongtao chicken and Yaoji chicken.
[0018] Figure 3 It is the Q - Q plot of the genome - wide association analysis of shank circumference at 300 days old for the 277 - individual F2 full - sib family population of Dongtao chicken - Yaoji chicken.
[0019] Figure 4 It is the Manhattan plot of the genome - wide association analysis of shank circumference at 300 days old for the 277 - individual F2 full - sib family population of Dongtao chicken - Yaoji chicken.
[0020] Figure 5 It is the gene typing of the molecular marker locus Chr1:68713248 (GRCg7b): a is the AA genotype; b is the AT genotype; c is the TT genotype. Specific implementation manner
[0021] To make the purpose, technical solutions and advantages of the present invention clearer, the following further details the present invention in combination with embodiments. The specific embodiments described here are only used to explain the present invention and are not used to limit the invention.
[0022] The chickens to be detected in this embodiment are the F1 individuals produced by using Dongtao chicken as the F0 - generation paternal line and Guangxi Nandan Yaoji chicken hens as the F0 - generation maternal line for cross - breeding, and then the F2 - generation population is produced by crossing based on the F1 - generation population; the specific cross - breeding method is as follows:
[0023] Using 6 Dongtao chicken roosters as the F0 - generation paternal line and 12 Guangxi Nandan Yaoji chicken hens as the F0 - generation maternal line, mating and cross - breeding in a ratio of 1:2 for male and female to produce 152 F1 individuals (61 roosters and 91 hens), and then the F2 - generation population is produced by crossing based on the pedigree record from the F1 - generation population, including 150 roosters and 147 hens, with a total of 297 individuals used for the excavation of molecular markers related to the thick shank circumference of Dongtao chicken ( Figure 1 ). In the constructed F2 - generation resource population of Dongtao chicken - Yaoji chicken, the shank circumference at 300 days old of both the F1 - generation population and the F2 - generation male and female populations is significantly higher than that of the pure - line male and female Yaoji chicken populations, but significantly lower than that of the pure - line male and female Dongtao chicken populations, indicating that when using thick - shank - circumference Dongtao chicken as breeding material and cross - breeding with other chicken breeds with ordinary shank circumferences to cultivate specialized lines related to thick shank circumferences, it can indeed significantly improve the shank circumference of the related line populations ( Figure 2 ).
[0024] Example 1: Mining of Molecular Marker-Assisted Selection Locus Chr1:68713248 (GRCg7b)
[0025] Using 297 individuals from the Dongtao Chicken-Yao Chicken F2 resource population as the research objects, the shank circumference was measured at 300 days of age. After collecting blood samples, whole-genome resequencing was performed (average sequencing depth > 10×). After excluding 20 individuals without phenotypic records, duplicate numbers, duplicate samples, and individuals without numbers, the genomic data of 277 individuals were retained, and VCFtools was used for population SNP quality control. The quality control conditions were: "--not-chr W --not-chr Z --min-alleles 2 --max-alleles 2 --maf 0.05 --max-missing 0.95", obtaining 11,434,236 high-quality autosomal SNPs for genome-wide association analysis. At the same time, based on the adjustment of the effective independent test times, Plink 1.9 was used to perform LD-pruning on autosomal SNPs (parameter "--indep-pairwise 50 5 0.5"), estimating 2,225,843 low-linkage autosomal SNP loci as the effective locus numbers, and the Bonferroni correction was adopted for significance testing of genome-wide association analysis, that is, the recommended significance threshold was 4.493E-07 (1 / 2,225,843), and the genome-wide significance threshold was 2.246E-08 (0.05 / 2,225,843);
[0026] Based on the obtained 11,434,236 high-quality autosomal SNPs, using the mixed linear model of GCTA (PC1-PC10 as quantitative covariates and sex as a discrete covariate), genome-wide association analysis was performed on the shank circumference at 300 days of age. With 4.493E-07 (Bonferroni correction; 1 / 2,225,843) as the recommended significance threshold and 2.246E-08 (0.05 / 2,225,843) as the genome-wide significance threshold, the results showed that 22 and 3 SNPs respectively reached genome-wide recommendatory (<4.493E-07) and genome-wide significance (<2.246E-08) with the shank circumference at 300 days of age (see Figure 3 and Figure 4 ); The genome-wide significant loci included Chr2:58227650 (p = 9.40E-09), Chr2:58227636 (p = 1.17E-08), and Chr1:68713248 (p = 1.81E-08) (GRCg7b), and only the locus Chr1:68713248 was located at SCUBE1The intron region of the (Signal peptide, CUB domain and EGF like domain containing 1) protein-coding gene, and the locus Chr1:68713242 within this gene region reached the recommended threshold (p = 4.44E-08), while there were no protein-coding genes within 50 Kb upstream and downstream of the other 2 significant loci. Importantly, previous studies have shown that SCUBE1 can serve as a cofactor for the BMP2 receptor, and BMP2 the gene plays a key role in bone formation and maintenance. Therefore, considering the correlation between the functions of the genes associated with the significant SNPs and the shank circumference trait, the locus Chr1:68713248 is the best marker locus for shank circumference in the Dongtao chicken-Yao chicken F2 resource population.
[0027] Further statistics on the genotypes and phenotypes of the locus Chr1:68713248 are shown in Table 1.
[0028] Table 1
[0029]
[0030] Note: REF represents the reference allele, and ALT represents the mutant allele.
[0031] As can be seen from Table 1, the genotype AA population > the genotype AT population > the genotype TT population. Individuals with the A allele have a thicker shank circumference and belong to the dominant allele for shank circumference.
[0032] Example 2. Design and synthesis of primers for detecting gene molecular markers related to the shank circumference of Dongtao chicken SCUBE1 Design and synthesis of primers for detecting gene molecular markers related to the shank circumference of Dongtao chicken
[0033] Using NCBI Primer-BLAST (https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ), upstream and downstream primers for amplifying the locus Chr1:68713248 (GRCg7b) were designed. The upstream primer sequence is:
[0034] F: 5’-TGTGTGCTCACCCATAACCA-3’ (see SEQ ID NO.1);
[0035] The downstream primer sequence is:
[0036] R: 5’-AGATGGGGTACAGAGGTCGAA-�’ (see SEQ ID NO.2);
[0037] The upstream primer and the downstream primer were entrusted to Sangon Biotech (Shanghai) Co., Ltd. for synthesis.
[0038] Example 3. Application of Primers for Detecting Gene Molecular Markers Related to the Shank Circumference of Dongtao Chickens in the Auxiliary Selection Breeding for Improving the Shank Circumference of Dongtao Chickens SCUBE1
[0039] 1) Extract the blood samples of the chickens to be tested, and extract genomic DNA by the phenol-chloroform method;
[0040] 2) Use the above primers to perform PCR amplification on the genomic DNA of the chickens to be tested; the PCR reagents, methods and reaction procedures are all selected from Aikerui Bioengineering Co., Ltd. (Changsha, China), and the reaction system and reaction conditions are shown in Tables 2 and 3 below.
[0041] Table 2 PCR Reaction System
[0042]
[0043] *1: When the 2X Pro Taq Master Mix (dye plus) in the product is used for the first time, centrifuge it first and then use it to avoid loss of enzyme amount.
[0044] *2: Usually, it is recommended that the template addition amount does not exceed 500 ng; the template usage can be adjusted according to actual needs.
[0045] *3: The primers are usually used at a final concentration of 0.2 μM, and can be adjusted within the range of 0.2 - 1.0 μM according to the experimental results.
[0046] *4: The reaction system needs to be prepared on ice, and finally place the prepared reaction solution in the PCR instrument for reaction.
[0047] Table 3 PCR Reaction Conditions
[0048]
[0049] After the PCR amplification reaction program is completed, the product is stored at 4 °C for standby, and sent to Sangon Biotech (Shanghai) Co., Ltd. for Sanger sequencing. The full length of the PCR amplification sequence is as follows (see SEQ ID NO.3):
[0050] GCTCTTACTG CATAGCGCCA CTAAGCCTGA TTCTGCAGGA GTATTTGAGA ACTGTCCCTGTCTCTTTAAC TGAGAACAGA TGCTGAGAGT GGTATCAGAC GCTCTTTTCT GATCTCCTTT CCCGTGTCCWGAGTTTTAAC GCATTCGTGA AGGATAAAAT GCCAAGGTTC TTATGCTGTC TTTGGAACAG TAAAAGCCAAGCATGAACTG AAAAGCTCAG ACTGTGCACT AATAAATGTT GCTTTGGTTT TCCTTTACAG CTAGCTACTTCTAATGTTTT GAAGGAGCAG AAATGGGCAA CTATTTGATT TTTTCCCAGT AATACCTCTG CAGCTTTTGCTTAGCCTCAA TTAGTGATCA ACAGTTGACA AAGATTTGGT TGAGATTTTT AACCTCAATT TTGAATAGAAAAATTCAGGC ATCACCGCAG GATTGAATTT TTAGAAGTGT ATCAGACTAC CTTTTGTAAC TGAATGTTTCTGCAGCCCAG AGTTACTCAT CTAAATCTCT GTCCAGTTAA AAACAGTTCG ACCTCTGTAC CCCATCTCTTTGCGGTAATA AAACCCTCTA ATAAAAAGAG AAAAATGACT GAAGTAGGTA AATGCAGAAG AATTAAGGATGAGGAAAGCT AATGAACTCA ACTGCAATCA CTGTGCCAGT AACAGCCTTA ACTTAAAAGT ATTGATTAAATATCTGAATA TTTACATCTT GTACCGAAAC CGCTGAAGGC AAATGATGCA TTGCAAAGCA AACAGAAGCTGACCTTTGCA CGTTTTCCCA TCAGGCTGCA GGGTAAATCC AACTGGGCAA CTGCATCGTA CCCCTGTCG。
[0051] The full length of the PCR amplified sequence is 829 bp, and the 130th base (the shaded base W; A / T mutation) therein is the SNP marker at the locus Chr1:68713248 (GRCg7b); the genotyping of the locus Chr1:68713248 (GRCg7b) is as Figure 5 shown. When the Sanger sequencing peak map of an individual is AA (see Figure 5 a in), the shank circumference of individuals of the Dongtao chicken-related hybrid strain at 300 days of age is thicker. When the sequencing peak map is AT (see Figure 5 b in), the shank circumference of individuals of the Dongtao chicken-related hybrid strain at 300 days of age is medium. When the sequencing peak map is TT (see Figure 5 c in), the shank circumference of individuals of the Dongtao chicken-related hybrid strain at 300 days of age is thinner. Therefore, when using Dongtao chickens to crossbreed with other chicken breeds to cultivate specialized strains with thick shanks, the genetic progress of population selection for thick or thin shanks can be accelerated by detecting this SNP marker and selectively retaining breeding chickens with the AA or TT genotype through directional selection.
[0052] The technical solution of the present invention is not limited to the limitations of the above specific embodiments. Any technical deformation made according to the technical solution of the present invention falls within the protection scope of the present invention.
Claims
1. Application of a primer in the assisted selection breeding for improving the shank circumference of F2 generation Dongtao chicken-Yao chicken, characterized in that, It includes the following steps: S1. Extract the genomic DNA of the to-be-detected Dongtao chicken-Yao chicken F2 generation chickens; S2. Use primers to perform PCR amplification on the genomic DNA of the to-be-detected Dongtao chicken-Yao chicken F2 generation chickens. After the PCR amplification reaction program ends, perform Sanger sequencing on the product; Select individuals with the AA or AT genotype at the Chr1:68713248 locus as breeding chickens; The primers include an upstream primer and a downstream primer: Upstream primer, the sequence is F: 5’-TGTGTGCTCACCCATAACCA-3’; Downstream primer, the sequence is R: 5’-AGATGGGGTACAGAGGTCGAA-3’; Among them, the specific chromosomal position of the Chr1:68713248 locus in the genome is determined as an A / T mutation after alignment with the chicken 7.0 reference genome GRCg7b; The Dongtao chicken-Yao chicken F2 generation chickens are the F1 generation individuals produced by using Dongtao chickens as the F0 generation paternal line and Guangxi Nandan Yao chicken hens as the F0 generation maternal line for mating and hybridization, and then the F2 generation population is produced based on the F1 generation population through hybridization.
2. The application according to claim 1, wherein The PCR amplification reaction system is: 500 ng genomic DNA, 25 μL 2× Pro Taq Master Mix, 1 μL upstream primer with a concentration of 0.2 μM, 1 μL downstream primer with a concentration of 0.2 μM, and add enzyme-free and sterile water to make the total reaction system 50 μl; The PCR reaction program is 94 °C for 30 s; 98 °C for 10 s, 60 °C for 30 s, 72 °C for 1 min, 35 cycles; 72 °C for 2 min.
Citation Information
Patent Citations
SERCA2 gene molecular marker related to chicken carcass traits and application of SERCA2 gene molecular marker
CN116334235A
SNP (Single Nucleotide Polymorphism) molecular marker related to chicken shin girth and application of SNP molecular marker
CN117418016A
Application of genetic marker associated with chicken shin girth in FOXO1 gene in chicken genetic breeding
CN118995953A