Application of a variable site combination, application of a molecular marker combination, primer combination and application thereof, detection product, and method for identifying long oyster, Fujian oyster and hybrid oyster of the two

Abstract

The present invention discloses an application of a variant site combination, an application of a molecular marker combination, a primer combination and its application, a detection product, and a method for identifying long oysters, Fujian oysters, and hybrid oysters of the two, relating to the field of biotechnology. The method comprises the following steps: extracting genomic DNA from the individual to be tested; using the genomic DNA as a template, performing multiplex PCR amplification using a primer combination, and sequencing the PCR products; determining the species of the individual to be tested based on the base type of the SNV variant site; the primer combination comprises the primer pairs described in (c1) and (c2): (c1) a primer pair having a nucleotide sequence as shown in SEQ ID NO.1-2 and / or a primer pair having a nucleotide sequence as shown in SEQ ID NO.3-4; (c2) a primer pair having a nucleotide sequence as shown in SEQ ID NO.5-6. The method can effectively distinguish long oysters, Fujian oysters, and hybrid oysters of the two.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to an application of a mutation site combination, an application of a molecular marker combination, a primer combination and its application, a detection product, and a method for identifying Crassostrea gigas, Crassostrea fujianensis, and a hybrid oyster thereof. Background Art

[0002] The long oyster and the Fujian oyster are important oyster aquaculture varieties. The two oysters are closely related species that have adapted to different environments. Their genome sequences are very similar and they can hybridize and produce fertile offspring. Therefore, many scholars believe that the long oyster and the Fujian oyster are two sister subspecies. Because the oysters produced by the hybridization of the two exhibit certain hybrid advantages, especially in terms of high temperature adaptation, the application of hybrid oysters in oyster aquaculture has gradually increased in recent years. The long oyster, the Fujian oyster and the hybrid oysters are similar in appearance and difficult to accurately identify with the naked eye. Accurately distinguishing between the long oyster, the Fujian oyster, the Changfu hybrid oyster and the Fuchang hybrid oyster is an urgent need in the fields of genetic breeding, aquaculture, etc. Existing oyster identification technology mainly targets different oyster species, and species identification is carried out based on the differences in the mitochondrial COXI gene sequences of different oyster species, such as the identification of the long oyster and the Omi oyster.

[0003] Existing species identification technologies based on oyster genetics or gene information primarily rely on differences in mitochondrial COXI gene sequences. These methods are unable to accurately distinguish between Crassostrea longissima, Crassostrea fujiani, and hybrids of the two. Due to the maternal inheritance pattern of oyster mitochondrial gene sequences, it is impossible to distinguish between Crassostrea longissima and the Changfu hybrid oyster (Crssostrea longissima ♀ × Crassostrea fujiani ♂ hybrid, i.e., a hybrid with Crassostrea longissima as the female parent and Crassostrea fujiani as the male parent), nor between the Fujian oyster and the Fuzhou-Chang hybrid oyster (Fujian oyster ♀ × Crassostrea longissima ♂ hybrid, i.e., a hybrid with Crassostrea fujiani as the female parent and Crassostrea longissima as the male parent). Furthermore, due to the high similarity between the genome sequences of Crassostrea longissima and Fujian oysters, existing detection methods based on single-base differences in mitochondrial COXI sequences have a high failure rate when distinguishing pure Crassostrea longissima from pure Fujian oysters. The maternal inheritance pattern of oyster mitochondrial genes precludes the ability to distinguish purebred oysters from hybrids based on mitochondrial sequences. To determine whether it is a hybrid individual of the long oyster and the Fujian oyster, it is necessary to base it on the specific base sequences of the nuclear genomes of the long oyster and the Fujian oyster, while the mitochondrial specific base sequences can only serve as evidence of the maternal parental origin of the oyster individual.

[0004] Based on the above, the present invention intends to develop a method for identifying long oysters, Fujian oysters and hybrid oysters, thereby achieving effective identification of long oysters, Fujian oysters and hybrid oysters. Summary of the Invention

[0005] The present invention aims to address the problems of the prior art by providing a method for distinguishing between Crassostrea gigas, Fujian oysters, and hybrids of Crassostrea gigas and Fujian oysters, using a combination of variant sites, a combination of molecular markers, a primer combination and its application, a detection product, and a method for distinguishing between Crassostrea gigas, Fujian oysters, and hybrids of the two. The method can effectively distinguish between purebred Crassostrea gigas, purebred Fujian oysters, Longfu hybrid oysters, and Fuzhou-Chang hybrid oysters.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides an application of a combination of variant sites, which is used in identifying long oysters, Fujian oysters, and hybrid oysters thereof; the combination of variant sites is determined based on comparison with the Fujian oyster reference genome with version number GCA_025765675.3;

[0008] The ectopic site combination includes the following SNV variant sites (a1) and (a2):

[0009] (a1) at least one of canscf7:35341023, canscf7:35341084, canscf7:35341419, canscf7:35341500, canscf8:29552247, and canscf8:29552645;

[0010] (a2) at least one of COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621 and COX3:736.

[0011] The present invention also provides an application of a molecular marker combination, wherein the application is for identifying Crassostrea gigas, Crassostrea fujianensis, and a hybrid of the two. The molecular marker combination comprises the molecular markers described in (b1) and (b2):

[0012] (b1) a molecular marker having a nucleotide sequence as shown in SEQ ID NO. 7 and / or SEQ ID NO. 8;

[0013] (b2) A molecular marker having a nucleotide sequence as shown in SEQ ID NO.9.

[0014] The present invention also provides a primer combination, comprising the primer pairs described in (c1) and (c2):

[0015] (c1) a primer pair having a nucleotide sequence as shown in SEQ ID NOs. 1-2 and / or a primer pair having a nucleotide sequence as shown in SEQ ID NOs. 3-4;

[0016] (c2) A primer pair having nucleotide sequences as shown in SEQ ID NO. 5-6.

[0017] The present invention also provides an application of the primer combination, which is an application in preparing a detection product for identifying Crassostrea gigas, Crassostrea fujianensis, and a hybrid oyster thereof.

[0018] Furthermore, the detection product is a kit.

[0019] The present invention also provides a detection product, which is used to identify Crassostrea gigas, Crassostrea fujianensis and their hybrid oysters; the detection product includes the above-mentioned primer combination.

[0020] Furthermore, the detection product is a kit.

[0021] The present invention also provides a method for identifying Crassostrea gigas, Crassostrea fujianensis, and a hybrid oyster thereof, comprising the following steps:

[0022] Extracting genomic DNA from the individual to be tested;

[0023] Using the genomic DNA as a template, multiplex PCR amplification is performed using the above primer combination, and the PCR products are sequenced;

[0024] Determine the breed of the individual to be tested based on the base type of the SNV variant site:

[0025] According to the SNV variant site identification of the long oyster and the Fujian oyster as described in (a1) above, when the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is determined to be the long oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is determined to be the Fujian oyster;

[0026] When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one SNV variation site is selected from the SNV variation sites described in (a2) above to identify the Changfu hybrid oyster and the Fuchang hybrid oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

[0027] Furthermore, the reaction system for the multiplex PCR amplification is: 17 μL of ddH2O, 25 μL of 2 × Phanta Max Buffer, 1 μL of dNTP Mix, 2 μL of upstream primer, 2 μL of downstream primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 2 μL of template DNA.

[0028] Furthermore, the reaction procedure of the multiplex PCR amplification is: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, 35 cycles; and final extension at 72°C for 5 min.

[0029] The present invention discloses the following technical effects:

[0030] The present invention utilizes species-specific variation sites in the nuclear genome genes and mitochondrial genome genes of the long oyster and the Fujian oyster to design multiplex PCR amplification primers. By performing second-generation sequencing on the multiplex PCR amplification products, the distribution type of the species-specific variation sites is analyzed, thereby achieving the technical effect of effectively distinguishing purebred long oysters, purebred Fujian oysters, Longfu hybrid oysters and Fuzhou-Long hybrid oysters, and solving the technical problem of being unable to effectively identify these four oyster types in the fields of aquaculture and genetic breeding. DETAILED DESCRIPTION

[0031] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0032] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0033] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0034] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be exemplary only.

[0035] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0036] Example 1

[0037] 1. 313 wild Crassostrea gigas oysters (Crassostrea gigas) were collected from 10 locations along the northern coast of China, and 206 wild Fujian oysters (Crassostrea angulata) were collected from 6 locations along the southern coast of China. Whole-genome DNA was extracted from these 519 oysters using a marine animal genomic DNA extraction kit.

[0038] 2. Whole-genome resequencing of the extracted DNA samples was performed using a second-generation sequencing platform. The sequencing data volume of each sample was no less than 8G. The reads obtained by sequencing were then aligned to the Fujian oyster reference genome (GenBank version number: GCA_025765675.3) using bwa software. Whole-genome single nucleotide variation (SNV) sites were then identified using samtools and gatk software, and allele frequency analysis of each SNV was performed using vcftools software.

[0039] 3. Identify species-specific SNV variants in Crassostrea gigas and Crassostrea fujianensis using the following screening criteria:

[0040] (1) Biallelic SNV;

[0041] (2) The first allele has a distribution frequency of >97% in long oysters;

[0042] (3) The distribution frequency of the second allele in Fujian oysters is >97%.

[0043] 4. Further screening of the obtained species-specific SNV variant sites requires the presence of at least two species-specific SNVs within an 800bp range, thus forming a "specific site cluster."

[0044] 5. Design multiplex PCR primers based on the species-specific SNV and the sequence region within 500 bp upstream and downstream. Specific requirements are as follows:

[0045] (1) Design one set of primers for each “specific site group”;

[0046] (2) The expected PCR amplification product size is 600-800 bp, with a GC content of 35%-45%;

[0047] (3) The primer sequence does not contain SNVs with a minor allele frequency greater than 0.5%;

[0048] (4) Primer length 19-25 bp, primer annealing temperature 51°C-53°C;

[0049] (5) Each primer does not contain a sequence that can form an obvious self-"hairpin" structure;

[0050] (6) Each primer does not contain a sequence that can form an obvious "dimer" structure with other primers;

[0051] (7) Each primer sequence does not have any other sequence with a similarity greater than 60% at other locations in the genome.

[0052] 6. The PCR primers obtained above were individually amplified and screened in 30 Crassostrea gigas and 30 Crassostrea fujianensis, and primers that could amplify in all Crassostrea chub and Crassostrea fujianensis were selected. The PCR products were then sent to a biotechnology company for next-generation sequencing. The sequencing reads were aligned and SNVs were identified according to the process in step 2. Primers with expected SNVs were selected.

[0053] 7. Perform multiplex PCR amplification using primers that meet the expectations in 30 Crassostrea gigas and 30 Crassostrea fujianensis. Optimize PCR parameters such as annealing temperature and cycle number. Align sequencing reads and identify SNVs according to the process in step 2. Identify the optimal multiplex PCR primer combination using the following screening criteria:

[0054] (1) The PCR multiplicity (i.e., the number of primer pairs) is between 2 and 5;

[0055] (2) At least two “specific site groups” in the PCR product can be amplified (i.e., at least two sets of PCR primers can be amplified);

[0056] (3) No less than three species-specific SNVs can be detected.

[0057] 8. Through steps 3-5 above, the following three groups of "specific site groups" are obtained, as follows:

[0058] (1) There are four species-specific variant sites in the AChRa gene (specific site group 1):

[0059] At position canscf7:35341023, the base type of the long oyster is A, and the base type of the Fujian oyster is G;

[0060] At position canscf7:35341084, the long oyster base type is T, and the Fujian oyster base type is C;

[0061] At position canscf7:35341419, the long oyster base type is G, and the Fujian oyster base type is A;

[0062] At position canscf7:35341500, the long oyster base type is T and the Fujian oyster base type is A.

[0063] (2) There are two species-specific variant sites in the TRHR gene (specific site group 2):

[0064] At position canscf8:29552247, the base type of the long oyster is T, and the base type of the Fujian oyster is G;

[0065] At position canscf8:29552645, the long oyster base type is T and the Fujian oyster base type is A.

[0066] (3) There are 9 species-specific variant sites in the mitochondrial COX3 gene (specific site cluster 3):

[0067] At position COX3:351, the long oyster base type is A, and the Fujian oyster base type is T;

[0068] At position COX3:381, the long oyster base type is T, and the Fujian oyster base type is C;

[0069] At position COX3:441, the long oyster base type is A, and the Fujian oyster base type is G;

[0070] At position COX3:465, the long oyster base type is C, and the Fujian oyster base type is T;

[0071] At position COX3:568, the long oyster base type is A, and the Fujian oyster base type is G;

[0072] At position COX3:576, the long oyster base type is G, and the Fujian oyster base type is A;

[0073] At position COX3:609, the long oyster base type is T, and the Fujian oyster base type is C;

[0074] At position COX3:621, the long oyster base type is A, and the Fujian oyster base type is G;

[0075] At the COX3:736 position, the long oyster base type is C and the Fujian oyster base type is G.

[0076] 9. The optimal primer sequences for multiplex PCR amplification of the above 8 specific locus groups 1-3 are shown in Table 1.

[0077] Table 1 Optimal primer sequences

[0078]

[0079] The PCR amplification reaction system was as follows: ddH2O 17 μL, 2 × Phanta Max Buffer 25 μL, dNTP Mix (10 mM each) 1 μL, upstream primer (10 μM) 2 μL, downstream primer (10 μM) 2 μL, Phanta Max Super-Fidelity DNA Polymerase 1 μL, and template DNA 2 μL.

[0080] The PCR amplification reaction program was as follows: pre-denaturation at 95°C for 2 min; 35 cycles of denaturation at 95°C for 15 s, annealing at 52°C for 15 s, and extension at 72°C for 30 s; and final extension at 72°C for 5 min.

[0081] Using primers F1 and R1 in Table 1, molecular markers containing specific locus group 1 can be amplified:

[0082] CCGACCGAGTTTTTACTCTTTTTAGAA[A / G]GAGCGACACCACTTCTTGAATTTTTCAAAATTCAGGAAAGAAACCACGTGTCTGAGCCAC[T / C]TCGGGACAACTGTGTCCTCGTCTTGGTGATAAACTCTGAGCGTCATGATCGTAATAACACAGGACAGGGCACTCAAAACCAACATCAGCGTCAGAAAGTAGCACAGGAG GGACATGGGCTCGGCAGCCCGCGGTAAGTTCGCAGACACCATAGTCAGAAACACGGCAAAAGTAAGGAAAGCTGTAATCGCGAACCCGACCCTTTCCCCGGAATCCACAGGCAATATAAAAACCATGCCGTTGAGAAGCCCGAGAATTAGAATAGGGATTACGATATTGATAACAAAGTAGCCAGGC CGCCTCTTCATAACGATTGTAAAATGTAAGAAAGACGT[G / A]CTGCTGACGGATTTTGTTTCGATTGTAGAATTGGAAAGTTCCCATTGGACGTTCTCCATGTAATGCGTCAGGTCGATTGA[T / A]TCTTGATTAGACGTCAGGTAAATCTAAAACAAAAATAACCAAATAAGGGAAGAATGTC TTAGTTTTAGTCGTTCGTTTACAAGTATTACCACTCTCAAATGTTCCATACAAACATATACAAACTACTGTTAAGATAAGAAAGATGAAAGGATGCAATTCCTATAAAGCTACATGTAACAACTGATTTAAATGCATCTATGTAATCTAGTAGAATTATTACATGTAAATATACTTCTTGGGTATAT CTCAAAAGTTATTATTGCACAGAA (SEQ ID NO.7), the underlined part is the primer design site.

[0083] The primers F2 and R2 in Table 1 can be used to amplify the molecular markers containing the specific locus group 2:

[0084] CAGAATGAGATTGCCAGTAGAATGATTGTGAATTCAAGTCGAATGATGCTTTCCTCGGTGATGATTTTACATTCCCGTTTGCGTTTGTTGCGAATAATTAGTCTTCGCATGATTAAAATGTTCAACACCGTGATAATTACGAATGGTACCAGCGTGATGAGAACGGCATAAATACTATCCAAAACAAAAGACGCAAAGTCGTAATCTCT ATCTGTCGTACAGTAATGTTTCCCGTCGGTTCCCACGTATATAGCACTGAGTATTGGCTTATAAAGAGCAATCACAATGGAGATTACGAAGATAGACCCCACAATCCGCCGCGTACCACTTTT[T / G]GTGCATATATCCCTCCTCCTTAATGGATGACACACACCGATGTATCTCCCCTGTGAATG CCACCACAAGCCAAGCTGAGAGGAATCTGGACACATAGGACATATAAAGCTGAAACTGACATAATCCCTCCACATCAATAAACGTTAACTTTAGGTCAGGTCTGACGTAAACTAGTCCTCGCCTGATCCATTCCACCGTTACGTAGAATATCAACGTCAAAAGATCTGATGTCGACAGGGAGGCTAAG TAGGGTGCTGGCAGATATACCACGCATGTTTCTGGATAAGAAGACGTACAGGGATAACAGGTTCCCAAGAAATCCCACCACGAGAATCACGGGGGTAAAGTAAGCGTAAAATATCCGTGCGCTTTTCAGAAACGAAGCTTCTGTCCCGA[T / A]GTCACCAATCCATTCGTTAATACTCGAATTTTGACT GCTGTTTATGGAGTCTTTTCG (SEQ ID NO.8), the underlined part is the primer design site.

[0085] The primers F3 and R3 in Table 1 can be used to amplify the molecular markers containing the specific locus group 3:

[0086] ATTATGGGTGCAAACTTATGGGGAGTTGCAGCGATGTTCATTTGCTGAGTTAATGAGATTAGGCTTGATAGCTTATATTGAGGTATTCCTCTTTTGTACTAACTTTTTATAGTTGAGTACGTGACATTATTAATGAAGCAACATTTCAGGGGTTTCATACTGAAAAAGTTCAGTCAGGGCTTACTTTGGGTTTTATTCTGTTCCT[A / T]ATT TCTGAGTTAATATTATTTTTTTCATT[T / C]TTTTGAGCATTTTTCCATAGGGCTTTGTCATCTTCTGTTGAGATTGGGTGCTGCTGACC[A / G]CCAGTCGGGCTAGAGTGTTTAGA[C / T]TGAAGAAAAGTGCCATTACTATAATACAGCATTATTAGTAGCATCTTCTGCAAGTATTACTTTAAGACATAA CTACCTGCAATGGGGGGACATTTGGGTAGCA[A / G]CAGCAAC[G / A]TATATTGCTACTTTAGGCTTGTCGGTAATATT[T / C]ATTAAGAATCA[A / G]TACGAAGAGTATGCCTGATCTAGGTTTTCTATTTCTGATGGTGTATATGGCAGATGTTTTTTTATGTTAACAGGCCTTCATGGTTTACATGTA ATTGGAGGAACTTGTGGTCTT[C / G]TGTTTTGTTTTGTTCGTATAATGCTTTTGCAATTTTCTTCTGAGCATCATGTTGCATTGACTTTGGCTATTTGGTACTGACATTTTGTTGATATTGTATGGCTTGGATTGTTTTTTATTATCTACATCTGAGGCTCTTAGAGTATTGTGCCAGAGTTTTAATGGGCTT TGTTGATGTCAAAGAATACGAG (SEQ ID NO.9); the underlined part is the primer design site.

[0087] 10. Identification criteria for Crassostrea gigas, Fujian oysters, Crassostrea fujiani hybrid oysters, and Crassostrea fujiani hybrid oysters:

[0088] At least one specific locus is selected from a total of 6 specific loci in specific locus groups 1 and 2 for identification of Crassostrea gigas and Crassostrea fujianensis:

[0089] When the individual to be tested is a homozygote with the same base type as that of the long oyster, the individual to be tested is determined to be the long oyster.

[0090] When the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster.

[0091] When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one specific site is selected from the 9 specific sites in the specific site group 3 to identify the Changfu hybrid oyster and the Fuchang hybrid oyster: when the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

[0092] Example 2

[0093] In addition, long oysters, Fujian oysters, Changfu hybrid oysters and Fuchang hybrid oysters were collected and the specific SNV sites in Example 1 were used for variety identification.

[0094] Genomic DNA was extracted from the individuals to be tested. Multiplex PCR amplification was performed using the primers designed in Example 1 (the PCR amplification system and procedure were the same as in Example 1). The PCR products were sent to a biotechnology company for next-generation sequencing. The sequence reads were analyzed, and the oyster species were determined based on the base types of specific SNVs. The results are shown in Table 2 (30 Crassostrea gigas, 30 Fujian oysters, 30 Longfu hybrid oysters, and 30 Fuchang hybrid oysters were used in each experiment). The results show that the method of the present invention can accurately identify Crassostrea gigas, Fujian oysters, Longfu hybrid oysters, and Fuchang hybrid oysters.

[0095] Table 2 Statistics of the accuracy of variety identification based on different specific loci

[0096]

[0097] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. Application of a species-specific SNV variant site combination in identifying long oysters, Fujian oysters and their hybrid oysters, characterized in that: The species-specific SNV variant site combination is determined based on the Fujian oyster reference genome alignment with version number GCA_025765675.3; The species-specific SNV variant site combination includes the following SNV variant sites (a1) and (a2): (a1) at least one of canscf7:35341023, canscf7:35341084, canscf7:35341419, canscf7:35341500, canscf8:29552247, and canscf8:29552645; (a2) at least one of COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621, and COX3:736; The canscf7:35341023, the canscf7:35341084, the canscf7:35341419 and the canscf7:35341500 are respectively located at the 28th, 89th, 424th and 505th bases of the molecular marker shown in the nucleotide sequence of SEQ ID NO.7; The canscf8:29552247 and the canscf8:29552645 are located at the 333rd and 731st bases of the molecular marker shown in the nucleotide sequence of SEQ ID NO.8, respectively; The COX3:351, the COX3:381, the COX3:441, the COX3:465, the COX3:568, the COX3:576, the COX3:609, the COX3:621 and the COX3:736 are located at bases 207, 237, 297, 321, 424, 432, 465, 477 and 592 of the molecular marker of the nucleotide sequence shown in SEQ ID NO.9, respectively; At position canscf7:35341023, the base type of the long oyster is A, and the base type of the Fujian oyster is G; At position canscf7:35341084, the long oyster base type is T, and the Fujian oyster base type is C; At position canscf7:35341419, the long oyster base type is G, and the Fujian oyster base type is A; At position canscf7:35341500, the long oyster base type is T, and the Fujian oyster base type is A; At position canscf8:29552247, the base type of the long oyster is T, and the base type of the Fujian oyster is G; At position canscf8:29552645, the long oyster base type is T, and the Fujian oyster base type is A; At position COX3:351, the long oyster base type is A, and the Fujian oyster base type is T; At position COX3:381, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:441, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:465, the long oyster base type is C, and the Fujian oyster base type is T; At position COX3:568, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:576, the long oyster base type is G, and the Fujian oyster base type is A; At position COX3:609, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:621, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:736, the long oyster base type is C, and the Fujian oyster base type is G; Determine the breed of the individual to be tested based on the base type of the SNV variant site: Identification of long oysters and Fujian oysters based on the SNV variant sites described in (a1): When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the long oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster; When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one SNV variation site is selected from the SNV variation sites described in (a2) to identify the Changfu hybrid oyster and the Fuchang hybrid oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

2. Application of a molecular marker combination in identifying Crassostrea gigas, Crassostrea fujianensis, and their hybrids, characterized in that: The molecular marker combination includes the molecular markers described in (b1) and (b2): (b1) a molecular marker having a nucleotide sequence as shown in SEQ ID NO. 7 and / or SEQ ID NO. 8; (b2) a molecular marker having a nucleotide sequence as shown in SEQ ID NO. 9; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 7 has SNV variant sites at bases 28, 89, 424, and 505, which are named canscf7:35341023, canscf7:35341084, canscf7:35341419, and canscf7:35341500, respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 8 has SNV variant sites at bases 333 and 731, which are named canscf8:29552247 and canscf8:29552645 respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 9 has SNV variant sites at bases 207, 237, 297, 321, 424, 432, 465, 477, and 592, which are named COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621, and COX3:736, respectively; At position canscf7:35341023, the base type of the long oyster is A, and the base type of the Fujian oyster is G; At position canscf7:35341084, the long oyster base type is T, and the Fujian oyster base type is C; At position canscf7:35341419, the long oyster base type is G, and the Fujian oyster base type is A; At position canscf7:35341500, the long oyster base type is T, and the Fujian oyster base type is A; At position canscf8:29552247, the base type of the long oyster is T, and the base type of the Fujian oyster is G; At position canscf8:29552645, the long oyster base type is T, and the Fujian oyster base type is A; At position COX3:351, the long oyster base type is A, and the Fujian oyster base type is T; At position COX3:381, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:441, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:465, the long oyster base type is C, and the Fujian oyster base type is T; At position COX3:568, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:576, the long oyster base type is G, and the Fujian oyster base type is A; At position COX3:609, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:621, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:736, the long oyster base type is C, and the Fujian oyster base type is G; Determine the breed of the individual to be tested based on the base type of the SNV variant site of the molecular marker combination: Select at least one SNV variant site from the SNV variant sites in the molecular markers described in (b1) to identify the long oyster and the Fujian oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the long oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster; When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one SNV variation site is selected from the SNV variation sites in the molecular markers described in (b2) to identify the Changfu hybrid oyster and the Fuchang hybrid oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

3. Use of a primer combination in identifying Crassostrea gigas, Crassostrea fujianensis, and their hybrids, characterized in that: The primer combination includes the primer pairs described in (c1) and (c2): (c1) a primer pair having a nucleotide sequence as shown in SEQ ID NOs. 1-2 and / or a primer pair having a nucleotide sequence as shown in SEQ ID NOs. 3-4; (c2) a primer pair having nucleotide sequences as shown in SEQ ID NOs. 5-6; The primer pair with the nucleotide sequence shown in SEQ ID NO.1-2 is used to amplify the molecular marker with the nucleotide sequence shown in SEQ ID NO.7; the primer pair with the nucleotide sequence shown in SEQ ID NO.3-4 is used to amplify the molecular marker with the nucleotide sequence shown in SEQ ID NO.8; the primer pair with the nucleotide sequence shown in SEQ ID NO.5-6 is used to amplify the molecular marker with the nucleotide sequence shown in SEQ ID NO.9; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 7 has SNV variant sites at bases 28, 89, 424, and 505, which are named canscf7:35341023, canscf7:35341084, canscf7:35341419, and canscf7:35341500, respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 8 has SNV variant sites at bases 333 and 731, which are named canscf8:29552247 and canscf8:29552645 respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 9 has SNV variant sites at bases 207, 237, 297, 321, 424, 432, 465, 477, and 592, which are named COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621, and COX3:736, respectively; At position canscf7:35341023, the base type of the long oyster is A, and the base type of the Fujian oyster is G; At position canscf7:35341084, the long oyster base type is T, and the Fujian oyster base type is C; At position canscf7:35341419, the long oyster base type is G, and the Fujian oyster base type is A; At position canscf7:35341500, the long oyster base type is T, and the Fujian oyster base type is A; At position canscf8:29552247, the base type of the long oyster is T, and the base type of the Fujian oyster is G; At position canscf8:29552645, the long oyster base type is T, and the Fujian oyster base type is A; At position COX3:351, the long oyster base type is A, and the Fujian oyster base type is T; At position COX3:381, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:441, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:465, the long oyster base type is C, and the Fujian oyster base type is T; At position COX3:568, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:576, the long oyster base type is G, and the Fujian oyster base type is A; At position COX3:609, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:621, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:736, the long oyster base type is C, and the Fujian oyster base type is G; Determine the breed of the individual to be tested based on the base type of the SNV variant site: At least one SNV variant site is selected from the SNV variant sites in the molecular markers represented by the nucleotide sequences of SEQ ID NO. 7 and / or SEQ ID NO. 8, and used to identify the long oyster and the Fujian oyster. When the individual to be tested is homozygous for the same base type as the long oyster, the individual to be tested is identified as the long oyster; when the individual to be tested is homozygous for the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster. When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one SNV variation site is selected from the SNV variation sites in the molecular marker such as the nucleotide sequence shown in SEQID NO.9 to identify the Changfu hybrid oyster and the Fuchang hybrid oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

4. A method for identifying Crassostrea gigas, Crassostrea fujianensis, and hybrid oysters thereof, characterized in that: The following steps are involved: Extracting genomic DNA from the individual to be tested; Performing multiple PCR amplification using the genomic DNA as a template to obtain PCR amplification products, sequencing the PCR products to obtain the genotype of each SNV variation site; The PCR product includes a DNA fragment containing the molecular marker described in (b1) and a DNA fragment containing the molecular marker described in (b2): (b1) a molecular marker having a nucleotide sequence as shown in SEQ ID NO. 7 and / or SEQ ID NO. 8; (b2) a molecular marker having a nucleotide sequence as shown in SEQ ID NO. 9; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 7 has SNV variant sites at bases 28, 89, 424, and 505, which are named canscf7:35341023, canscf7:35341084, canscf7:35341419, and canscf7:35341500, respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 8 has SNV variant sites at bases 333 and 731, which are named canscf8:29552247 and canscf8:29552645 respectively; The nucleotide sequence of the molecular marker shown in SEQ ID NO. 9 has SNV variant sites at bases 207, 237, 297, 321, 424, 432, 465, 477, and 592, which are named COX3:351, COX3:381, COX3:441, COX3:465, COX3:568, COX3:576, COX3:609, COX3:621, and COX3:736, respectively; At position canscf7:35341023, the base type of the long oyster is A, and the base type of the Fujian oyster is G; At position canscf7:35341084, the long oyster base type is T, and the Fujian oyster base type is C; At position canscf7:35341419, the long oyster base type is G, and the Fujian oyster base type is A; At position canscf7:35341500, the long oyster base type is T, and the Fujian oyster base type is A; At position canscf8:29552247, the base type of the long oyster is T, and the base type of the Fujian oyster is G; At position canscf8:29552645, the long oyster base type is T, and the Fujian oyster base type is A; At position COX3:351, the long oyster base type is A, and the Fujian oyster base type is T; At position COX3:381, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:441, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:465, the long oyster base type is C, and the Fujian oyster base type is T; At position COX3:568, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:576, the long oyster base type is G, and the Fujian oyster base type is A; At position COX3:609, the long oyster base type is T, and the Fujian oyster base type is C; At position COX3:621, the long oyster base type is A, and the Fujian oyster base type is G; At position COX3:736, the long oyster base type is C, and the Fujian oyster base type is G; Determine the breed of the individual to be tested based on the base type of the SNV variant site: Select at least one SNV variant site from the SNV variant sites in the molecular markers described in (b1) to identify the long oyster and the Fujian oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the long oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fujian oyster; When the individual to be tested is a heterozygote carrying the base types of both the long oyster and the Fujian oyster, at least one SNV variation site is selected from the SNV variation sites in the molecular markers described in (b2) to identify the Changfu hybrid oyster and the Fuchang hybrid oyster. When the individual to be tested is a homozygote with the same base type as the long oyster, the individual to be tested is identified as the Changfu hybrid oyster; when the individual to be tested is a homozygote with the same base type as the Fujian oyster, the individual to be tested is identified as the Fuchang hybrid oyster.

5. The method according to claim 4, characterized in that The reaction system for the multiplex PCR amplification was as follows: 17 μL of ddH2O, 25 μL of 2 × Phanta Max Buffer, 1 μL of dNTP Mix, 2 μL of upstream primer, 2 μL of downstream primer, 1 μL of Phanta Max Super-Fidelity DNA Polymerase, and 2 μL of template DNA.

6. The method according to claim 4, characterized in that The reaction procedure of the multiplex PCR amplification was as follows: pre-denaturation at 95°C for 2 min; denaturation at 95°C for 15 s, annealing at 52°C for 15 s, extension at 72°C for 30 s, 35 cycles; and final extension at 72°C for 5 min.

Images