A primer-probe combination, kit, detection method and application for detecting fungi

Abstract

The present invention provides a primer-probe combination, kit, detection method, and application for detecting fungi. The primer-probe combination comprises primers with nucleotide sequences shown in SEQ ID NOs: 1-2 and a single-stranded fluorescent probe with the nucleotide sequence shown in SEQ ID NO: 3. The primer-probe combination for detecting fungi provided by the present invention has good specificity and a wide detection range, capable of detecting all bacterial species containing the target sequence amplified by the primer set, including fungi commonly found during fermentation.

Description

Technical Field

[0001] The present invention belongs to the technical field of fungus detection, and in particular relates to a primer-probe combination, a kit, a detection method and an application thereof for detecting fungi. Background Art

[0002] In the process of Baijiu brewing, fungi play a vital role, especially in the koji making and fermentation stages. One of the core steps in Baijiu brewing is koji making, a process that relies on a variety of fungi, especially Aspergillus ( Aspergillus spp.), Rhizopus ( Rhizopus spp.) and yeasts ( Saccharomyces spp.). These fungi secrete a rich system of enzymes, such as amylases, proteases, and cellulases, which break down macromolecules like starch, protein, and cellulose in the raw materials into fermentable small sugars and amino acids, providing the necessary substrates for subsequent alcohol fermentation. During the fermentation stage, yeasts are the primary alcohol producers, converting glucose into ethanol and carbon dioxide through the glycolysis pathway. Furthermore, some fungi produce a variety of flavor compounds, such as esters, alcohols, and acids, which contribute significantly to the aroma and taste of baijiu. For example, esters are one of the main aroma components in baijiu, and their formation is closely related to the metabolic activities of yeasts and molds. Fungi, with their unique metabolic and transformation capabilities, drive the fermentation process. Changes in their content directly affect the quality, efficacy, and market competitiveness of the fermentation products. Therefore, rapid quantitative detection of fungi is of great significance for precise fermentation control and digital intelligent fermentation.

[0003] Currently available fungal detection methods have many defects. Traditional microbial culture methods, although intuitive, are time-consuming. Some fungi require weeks or even months to form visible colonies, which seriously delays detection. They are also easily interfered with by environmental factors and are cumbersome to operate. Microscopic examination can quickly provide fungal morphological images, but has low sensitivity and is prone to miss detection of fungi with low content and atypical morphology. Detection reagents developed based on the principle of antigen-antibody specific binding can achieve a certain degree of quantitative detection, but the antibody specificity is obviously limited. One antibody is only targeted at a few fungi, and the broad-spectrum detection capability is insufficient. With the development of molecular biology, PCR-based nucleic acid amplification technologies, such as real-time fluorescence quantitative PCR and multiplex PCR, are widely used in fungal detection. They rely on nucleic acid recognition and amplification to improve the accuracy and depth of detection. However, PCR technology requires cycles of heating and cooling, relies on sophisticated and expensive instruments and equipment, and takes a long time to detect and relies on professional technicians, making it unsuitable for rapid and immediate detection.

[0004] Recombinase polymerase-mediated isothermal amplification (RPA) is a novel nucleic acid amplification technology that breaks away from traditional thermal cycling and efficiently amplifies nucleic acids at a constant temperature of 37°C-42°C. It is easy to operate; after sample processing, reagents are added, and the reaction can be initiated using a small constant temperature device or even at body temperature. Amplification is completed within 5-20 minutes, significantly shortening detection time and meeting real-time testing needs. Its simple reaction system requires low sample purity, is less susceptible to impurity inhibition, and offers high accuracy and reliability, facilitating precise monitoring of fermentation fungal dynamics. A search has found no reports on the use of recombinase polymerase-based isothermal amplification technology for general brewing fungi detection. Summary of the Invention

[0005] In view of this, the present invention aims to overcome the defects in the prior art and proposes a primer-probe combination, a kit, a detection method and an application for detecting fungi.

[0006] To achieve the above object, the technical solution of the present invention is achieved as follows:

[0007] In a first aspect, the present invention provides a primer-probe combination for detecting fungi, comprising primers having nucleotide sequences shown in SEQ ID NOs: 1-2 and a single-stranded fluorescent probe having a nucleotide sequence shown in SEQ ID NO: 3.

[0008] The primer-probe combination is designed for the conserved region of the 18S rDNA gene of brewing-related fungi, wherein the nucleotide sequence of the conserved region of the fungal 18S rDNA gene is shown in SEQ ID NO:8.

[0009] In the present invention, tetrahydrofuran (THF) is inserted into the sequence of the single-stranded fluorescent probe as a cleavage site, and a fluorescent group and a quenching group are labeled on both sides of the tetrahydrofuran, with a spacing of 1-10 nt between the fluorescent group and the quenching group, and a modifying group is labeled at the 3' end of the single-stranded fluorescent probe;

[0010] The fluorescent group is selected from FAM, TET, NED, ROX, CY3, CY5, VIC, JOE, HEX, Texas RED, and LCRED460; the quenching group is selected from MGB, TAMRA, NFQ, ECLIPSE, DABCYL, BHQ1, and BHQ2; and the modifying group is selected from an amino group, a phosphate group, and a C3-Spacer.

[0011] In some specific embodiments, the fluorescent group is FAM, the quenching group is BHQ, the interval between the fluorescent group and the quenching group is 3 nt, and the modifying group is C3-Spacer.

[0012] In some specific embodiments, the length of the single-stranded fluorescent probe is 45-60 nt.

[0013] In some specific embodiments, a dSpacer (tetrahydrofuran, THF) is labeled at the middle position of 30-35 nt away from the 5' end (any base, no special requirement) to serve as a recognition site for nuclease.

[0014] In some specific embodiments, the T base upstream of the THF site is labeled with a fluorescent group (FAM), and the T base downstream is labeled with a quencher group (BHQ1), and the distance between the two groups is 1-10 nt.

[0015] In some specific embodiments, THF is approximately 15 nt away from the 3' end, and the 3' end is labeled with a modification group (C3-spacer).

[0016] In a second aspect, the present invention also provides the use of the above primer-probe combination in preparing a kit for detecting fungi.

[0017] In some embodiments, the kit of the present invention further comprises a primer pair and a single-stranded fluorescent probe: the sequences of the primer pair are shown in SEQ ID NOs: 1-2; the sequence of the single-stranded fluorescent probe is shown in SEQ ID NO: 3.

[0018] In some specific embodiments, THF is inserted into the sequence of the single-stranded fluorescent probe as a cleavage site, and both sides of THF are labeled with a fluorescent group FAM and a quencher group BHQ1, respectively. The 3' end of the probe primer is labeled with a modification group C3-Spacer.

[0019] In some specific embodiments, the final concentration of the primers is 0.001 μM to 30 μM; the final concentration of the single-stranded fluorescent probe is 0.001 μM to 20 μM.

[0020] In some specific embodiments, the kit further comprises rehydration buffer, magnesium acetate, RPA lyophilized enzyme powder and ddH2O.

[0021] The RPA freeze-dried enzyme powder is a mixture of recombinase, single-strand binding protein, DNA polymerase and creatine kinase required for the RPA amplification reaction, and exists in the RPA reaction tube in the form of RPA freeze-dried enzyme powder.

[0022] In some specific embodiments, the kit includes: 32.9 μL of rehydration buffer, 0.5 μL of 20 μM upstream primer, 0.5 μL of 20 μM downstream primer, 0.3 μL of 10 μM single-stranded fluorescent probe, 2 μL of DNA sample to be tested, 9.8 μL of ddH2O, and 1 μL of magnesium acetate.

[0023] The present invention also provides a method for detecting fungi, which uses the primer-probe combination of the present invention to perform RPA (recombinase polymerase amplification) detection on a sample to be tested.

[0024] In some embodiments, the method for detecting fungi comprises the following steps:

[0025] S1: Extract DNA from the test substance containing fungi to obtain a DNA template;

[0026] S2: Perform RPA amplification using the extracted DNA as a template, and use a primer-probe combination to interpret the RPA amplification results to identify the fungi in the sample to be tested.

[0027] In some specific embodiments, step S2 also includes configuring an RPA reaction system, and the specific steps are: adding the following components in sequence to a reaction tube containing RPA freeze-dried enzyme powder: 32.9 μL of rehydration buffer, 0.5 μL of 20 μM forward primer, 0.5 μL of 20 μM reverse primer, 0.3 μL of 10 μM single-stranded fluorescent probe, and 9.8 μL of ultrapure water, vortex mixing, and then using a pipette to divide the prepared solution in the tube into two and add them to eight consecutive rows, and then adding 2 μL of DNA template to the eight consecutive rows in sequence, and finally adding 1 μL of magnesium acetate to the wall of the eight consecutive reaction tubes in sequence, and adding them to the system by centrifugation to catalyze the reaction.

[0028] In some specific embodiments, the RPA amplification step is: placing the reaction tube in a fluorescent quantitative PCR instrument, reacting at 37°C for 5-20 minutes, collecting the fluorescent signal every 30 seconds, and analyzing the fluorescence signal intensity collected at different time points by the instrument software to construct an amplification curve. If an amplification curve is obtained, it is judged as positive; otherwise, if there is no amplification curve, it is judged as negative.

[0029] The above primer-probe combination, kit and detection method can be used for, but not limited to, the detection of fungi in wine, beverages, fermented foods, tobacco leaves, etc.

[0030] Compared with the prior art, the present invention has the following advantages:

[0031] (1) The present invention retrieves more than 500 brewing-related fungi (such as Saccharomyces, Aspergillus, Rhizopus, Penicillium, Mucor, Candida, etc.) from the NCBI database and downloads their 18S rDNA gene sequences. The software DNAman is used to perform sequence comparison on the downloaded large number of gene sequences, and the homologous regions in more than 500 sequences are accurately screened. Based on these highly conserved homologous regions, fungal primers and probes for real-time fluorescence RPA detection are designed. The designed primers and probes have outstanding specificity and can widely and accurately cover a variety of common fungi in the brewing process, such as Saccharomyces (including Saccharomyces cerevisiae, Pichia pastoris, Baeyer's yeast, Candida utilis, etc.), Aspergillus (including Aspergillus niger, Monascus, Aspergillus oryzae, etc.), Rhizopus, Mucor, Penicillium, etc. In complex fermentation environment samples, the primers and probes can effectively avoid nonspecific binding with other microbial nucleic acid sequences by virtue of their unique sequence design, and only specifically amplify and detect the target fungi.

[0032] (2) The primer set for detecting fungi provided by the present invention is designed using the conserved region sequence of the 18S rDNA portion of the fungi as a template and has good specificity. The primer set has the advantage of a wide detection range and can detect all bacterial species containing the target sequence amplified by the primer set, including common fungi in the fermentation process. BRIEF DESCRIPTION OF THE DRAWINGS

[0033] Figure 1 Amplification curves for RPA primer screening of brewing fungi;

[0034] Figure 2 This is the RPA amplification curve of the feasibility test of the primer and probe combination of the present invention on brewing fungi;

[0035] Figure 3 Optimize the enzyme dosage for RPA-based fungal quantitative detection;

[0036] Figure 4 Optimization of reaction temperature for RPA-based fungal quantitative detection; Figures A-E are amplification curves at 33°C, 35°C, 37°C, 39°C, and 41°C, respectively;

[0037] Figure 5 Optimization of primer and probe concentrations for RPA-based fungal quantitative detection reactions; Figures A-D are amplification curves under conditions of systems one, two, three, and four, respectively;

[0038] Figure 6 This is the RPA amplification curve for the universality test of the primer and probe combination of the present invention on brewing fungi;

[0039] Figure 7This is an RPA amplification curve for the specificity test of the primer and probe combination of the present invention on brewing fungi; the fungal group includes Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces boulardii, Baumannii, Kazakhstan yeast, and Aspergillus niger; the non-fungal group includes Bacillus amyloliquefaciens, Bacillus subtilis, Escherichia coli, Lactobacillus paracasei, Lactobacillus reuteri, human papillomavirus, norovirus, and NC (negative control, nuclease-free pure water as the target);

[0040] Figure 8 This is the RPA amplification curve of the sensitivity test of the primer and probe combination of the present invention to brewing fungi;

[0041] Figure 9 This is a linear relationship graph between time and concentration. DETAILED DESCRIPTION

[0042] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.

[0043] Unless defined otherwise herein, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this application belongs.

[0044] Where values ​​are described herein as ranges, it should be understood that such disclosure includes disclosure of all possible sub-ranges within that range, as well as specific values ​​falling within that range, regardless of whether a specific value or sub-range is explicitly stated.

[0045] In this document, "a plurality of" and the like, unless otherwise specified, refer to a number greater than or equal to 2. For example, "one or more" means one or more than or equal to two.

[0046] In this document, the terms “preferably” and “more preferably” are only used to describe implementation methods or examples with better effects. It should be understood that they do not limit the scope of protection of the present invention.

[0047] In this document, the word "further" and the like are used for descriptive purposes to indicate differences in content, but should not be construed as limiting the scope of protection of the present invention.

[0048] In this article, the term "and / or" is used to describe the association relationship between objects, indicating that three relationships can exist. For example, A and / or B means: A or B, or A and B.

[0049] As used herein, the term "about" means + / - 10%, preferably + / - 5%, more preferably + / - 1% of the specified value.

[0050] In this document, the terms “include,” “including,” “have,” “contain,” etc. are open-ended terms, meaning including but not limited to.

[0051] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the invention pertains. Although preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein can also be used in the practice or testing of the present invention.

[0052] The present invention will be described in detail below with reference to the embodiments.

[0053] Example 1: Design, screening and preparation of primer and probe sequences

[0054] (1) RPA primer design: This experiment first retrieved and downloaded the 18S rDNA gene sequences of more than 500 common fungi in the brewing process (such as Saccharomyces cerevisiae, Pichia pastoris, Baeyer's yeast, Candida utilis, Aspergillus niger, Monascus purpureus, Aspergillus oryzae, Rhizopus niger, etc.) from the NCBI database (National Center for Biotechnology Information). Then, a large number of retrieved sequences were aligned in the software DNAman to screen for conserved sequences with high homology. The nucleotide sequence is shown in SEQ ID NO.8. Three forward primers, three reverse primers and one fluorescent probe were designed in this conserved region. The primer sequences were synthesized by Qingke Biotechnology Co., Ltd., and the fluorescent probe was synthesized by Shanghai Sangon Biotechnology Co., Ltd. The sequences are shown in Table 1.

[0055] Table 1. Primer combinations for isothermal amplification of brewing fungi

[0056]

[0057] Among them: FAM-dT is a thymine nucleotide carrying a fluorescein group, THF is tetrahydrofuran, BHQ1-dT is a thymine nucleotide carrying a fluorescence quenching group BHQ1, and C3-Spacer is a spacer introduced at the 3' end to prevent chain extension.

[0058] (2) RPA reaction system and conditions

[0059] RPA reaction system: Follow the instructions for the DNA Isothermal Amplification Reaction Kit (Fluorescence Type). Add the following components, in sequence, to a reaction tube containing lyophilized RPA powder: 32.9 μL of Buffer A, 0.5 μL of forward primers BF-F1 / F2 / F3 (20 μM), 0.5 μL of reverse primers BF-R1 / R2 / R3 (20 μM), 0.3 μL of fluorescent probe BF-P1 (10 μM), and 9.8 μL of ultrapure water. Vortex to mix thoroughly, then use a pipette to divide the solution in the tube into two equal parts. Then, add 2 μL of DNA template to each of the eight strips. Finally, add 1 μL of magnesium acetate to the wall of each strip and centrifuge to catalyze the reaction. The system should be prepared on ice throughout.

[0060] RPA reaction conditions: Place the RPA reaction tube containing all components in a fluorescent quantitative PCR instrument and incubate at 37°C for 20 minutes, collecting fluorescence signals every 30 seconds. The instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0061] The results are as follows Figure 1 As shown, based on the cross-matching method, a group of RPA primers with the best overall performance were successfully screened out: BF-F1 and BF-R1 and probe BF-P1.

[0062] from Figure 1 It can be seen that in the RPA primer screening experiment, the amplification curves corresponding to the negative controls of BF-F1 and BF-R1 are flatter than those of the other two groups, and the corresponding positive control group has the highest fluorescence value. In this way, the negative group can show obvious differences from the positive group. Therefore, BF-F1 and BF-R1 and probe BF-P1 will be used in subsequent experiments.

[0063] Example 2: Feasibility test and condition optimization of RPA primers for brewing fungi

[0064] (1) Plasmid synthesis and DNA template preparation: Using the double restriction sites of BamH I and EcoR I, the synthesized target gene was inserted into the puc57 vector as a feasibility test target.

[0065]

[0066] (2) RPA reaction system and conditions

[0067] The DNA templates were the above-mentioned synthetic plasmids and the control group NC (the control group NC was an empty pUC57 vector without the target sequence).

[0068] RPA reaction system: Follow the instructions for the DNA Isothermal Amplification Reaction Kit (Fluorescence Type). Add the following components to a reaction tube containing lyophilized RPA powder: 32.9 μL of Buffer A, 0.5 μL of forward primer BF-F1 (20 μM), 0.5 μL of reverse primer BF-R1 (20 μM), 0.3 μL of fluorescent probe BF-P1 (10 μM), and 9.8 μL of ultrapure water. Vortex to mix thoroughly, then use a pipette to divide the solution in the tube into two equal parts. Then, add 2 μL of DNA template to each of the eight strips. Finally, add 1 μL of magnesium acetate to the wall of each strip and centrifuge to catalyze the reaction. The system should be prepared on ice throughout.

[0069] RPA reaction conditions: Place the RPA reaction tube containing all components in a fluorescent quantitative PCR instrument and incubate at 37°C for 15 minutes, collecting fluorescence signals every 30 seconds. The instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0070] The results are as follows Figure 2 As shown in the figure, the negative control (NC) group showed extremely low fluorescence signals throughout the experiment, with no significant changes in the detection line, ensuring the reliability of the results, eliminating the risk of false positives, and ensuring the credibility of positive results. However, when a synthetic plasmid was used as a DNA template, the fluorescence signal climbed rapidly at the beginning of the reaction and quickly reached saturation, demonstrating the feasibility of this method for detecting brewing fungi.

[0071] (3) Optimization of reaction conditions for RPA-based quantitative detection of fungi

[0072] By optimizing the enzyme amount, temperature and primer probe concentration respectively, an efficient, sensitive and stable detection system and method were established.

[0073] 1) Enzyme dosage optimization:

[0074] By setting up experiments (100% enzyme volume, 50% enzyme volume, 30% enzyme volume, 25 μL reaction system), the effects of different enzyme volumes on amplification efficiency and signal intensity were evaluated to determine the optimal enzyme volume.

[0075] 100% enzyme reaction system: BF-F1 (5 μM) 2 μL, BF-R1 (5 μM) 2 μL, BF-P1 (1 μM) 3 μL, ddH2O 4.1 μL, buffer A 32.9 μL (mix the above solutions and take an average of 22 μL into each reaction tube), template to be detected 2 μL, magnesium acetate 1 μL.

[0076] 50% enzyme reaction system: BF-F1 (5 μM) 4 μL, BF-R1 (5 μM) 4 μL, BF-P1 (1 μM) 6 μL, ddH2O 8.2 μL, buffer A 65.8 μL (mix the above solutions and take an average of 22 μL into each reaction tube), template to be detected 2 μL, magnesium acetate 1 μL.

[0077] 30% enzyme reaction system: 6 μL of BF-F1 (5 μM), 6 μL of BF-R1 (5 μM), 9 μL of BF-P1 (1 μM), 12.3 μL of ddH2O, 98.7 μL of buffer A (mix the above solutions and take an average of 22 μL into each reaction tube), 2 μL of the template to be detected, and 1 μL of magnesium acetate.

[0078] Reaction conditions: Incubate at 37°C for 20 minutes, collecting fluorescence signals every 30 seconds. Instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0079] The results are as follows Figure 3 As shown in the figure, at 100% enzyme dosage, the difference in signals between the positive and negative groups is significant. The positive group has a clear amplification curve and fluorescence enhancement, while the negative group has no obvious amplification signal, indicating that this enzyme dosage supports the specific amplification of the target DNA and avoids non-specific amplification and background interference. 8 ) The positive target amplification curve rises slowly and the final intensity is low, indicating that the reduction in enzyme amount leads to a decrease in amplification efficiency. Low concentration (such as 10 2 ) The positive target group showed no clear amplification curve at low enzyme dosages. Therefore, 100% enzyme dosage is the optimal dosage for this detection system, achieving a balanced amplification efficiency, detection specificity, and signal-to-noise ratio.

[0080] 2) Reaction temperature optimization:

[0081] By setting a temperature gradient (33°C, 35°C, 37°C, 39°C and 41°C), the kinetic curves and amplification efficiency of the amplification reaction at different temperatures were analyzed to determine the optimal reaction temperature.

[0082] The results are as follows Figure 4As shown, at 37°C, the fluorescence signal of the positive target group amplification curve rises rapidly, with a high plateau fluorescence intensity. Meanwhile, the negative control group shows no significant nonspecific amplification signal, demonstrating that the RPA reaction is highly efficient and specific at this temperature. In contrast, at temperatures below 37°C (e.g., 33°C and 35°C), amplification efficiency is low, and the fluorescence signal in the negative control group tends to peak after 15 minutes of amplification. While temperatures above 37°C (e.g., 39°C and 41°C) accelerate amplification, the risk of nonspecific amplification increases, and reaction stability decreases. Therefore, 37°C has been determined to be the optimal reaction temperature for this RPA detection system, ensuring efficient amplification while minimizing nonspecific reactions, providing a reliable temperature condition for quantitative fungal detection.

[0083] 3) Primer and probe concentration optimization:

[0084] By adjusting the ratio of primer and probe concentrations, the effects on amplification specificity, sensitivity, and signal-to-noise ratio were evaluated to determine the optimal concentration combination. Four different reaction systems (25 μL) were designed as follows:

[0085] System 1: 5 μM BF-F1: 1 μL, 5 μM BF-R1: 1 μL, 1 μM BF-P1: 1.5 μL, ddH2O: 2.05 μL, Buffer A: 16.45 μL, target (NC\10 2 \10 8 ): 2 μL, magnesium acetate: 1 μL.

[0086] System 2: 5 μM BF-F1: 0.5 μL, 5 μM BF-R1: 0.5 μL, 1 μM BF-P1: 1.5 μL, ddH2O: 3.05 μL, Buffer A: 16.45 μL, target (NC\10 2 \10 8 ): 2 μL, magnesium acetate: 1 μL.

[0087] System 3: 5 μM BF-F1: 1 μL, 5 μM BF-R1: 1 μL, 1 μM BF-P1: 0.75 μL, ddH2O: 2.8 μL, Buffer A: 16.45 μL, target (NC\10 2 \10 8 ): 2 μL, magnesium acetate: 1 μL.

[0088] System 4: 5 μM BF-F1: 0.5 μL, 5 μM BF-R1: 0.5 μL, 1 μM BF-P1: 0.75 μL, ddH2O: 3.8 μL, Buffer A: 16.45 μL, target (NC\10 2 \10 8 ): 2 μL, magnesium acetate: 1 μL.

[0089] Reaction conditions: Incubate at 37°C for 20 minutes, collecting fluorescence signals every 30 seconds. Instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0090] The experimental results are as follows Figure 5 As shown, the amplification reaction exhibited optimal performance when the final primer concentration was 200 nM and the probe concentration was 60 nM. At this concentration combination, the fluorescence signal in the amplification curve for the positive target group rose rapidly and exhibited a high plateau fluorescence intensity. Meanwhile, no significant nonspecific amplification signal was observed in the negative control group, demonstrating the excellent selectivity and sensitivity of this condition. Furthermore, the signal-to-noise ratio was significantly higher with this concentration combination than in other experimental groups, further validating its reliability.

[0091] Example 3: Broad-spectrum and specific detection test of RPA primers for brewing fungi in the present invention

[0092] (1) Genome extraction

[0093] The strains used in the present invention include Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces boulardii, Baumannii, Saccharomyces sergeri, Torulopsis delakii, Rhizopus niger, Rhizopus oryzae, Aspergillus niger, Acetobacter, Lactobacillus paracasei, Lactobacillus reuteri, Bacillus amyloliquefaciens, Streptococcus lactis, Bacillus subtilis and Escherichia coli.

[0094] Before use, the strain was first streaked on the corresponding solid culture medium and activated by culturing at 37°C overnight. Then, a single colony was picked and inoculated into liquid culture medium and cultured at 37°C overnight for secondary activation.

[0095] The genome used in the experiment was extracted using the reagent method. The steps are as follows:

[0096] A. Add approximately 200 μL of quartz sand to a centrifuge tube, followed by 200 μL of lysis buffer, 200 μL of TE buffer, and 200 μL of DNA extraction solution (phenol:chloroform:isoamyl alcohol ratio of 25:24:1, Catalog No. p1012). Using a laminar flow hood, scrape the bacterial sludge into the tube. Cap the tube, vortex at high speed for 5 minutes, and centrifuge at 12,000 rpm for 10 minutes.

[0097] B. Carefully aspirate the supernatant (be careful to aspirate gently to avoid aspirating protein) and transfer it to a new 1.5 mL EP tube. Add 1 mL of anhydrous ethanol and mix thoroughly by inverting.

[0098] C. Centrifuge at 12,000 rpm for 5 minutes, discard the supernatant, and dry the tube at room temperature or in an open oven at 60°C for 15-20 minutes until the ethanol smell is gone.

[0099] D. Dissolve the DNA pellet extracted from the centrifuge tube in an appropriate volume of ultrapure water (to achieve a concentration suitable for PCR, typically 100 μL of ultrapure water).

[0100] (2) RPA reaction system and conditions

[0101] The RPA reaction system was the same as step (2) in Example 2.

[0102] Reaction conditions: Place the RPA reaction tube containing various components in a fluorescent quantitative PCR instrument and incubate at 37°C for 20 minutes. Collect the fluorescence signal every 30 seconds. The instrument software analyzes the fluorescence signal intensity collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0103] The positive group consisted of fungal strains from different genera, including Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces boulardii, Saccharomyces cerevisiae, and Baumannia baillensis. The negative group consisted of a control group with pure water as the target.

[0104] The experimental results are as follows Figure 6 As shown, it can be seen that when the sample to be detected is a fungal strain, even if these strains come from different ecological environments and different species, this method can still stably detect the target fungus. Through the fluorescent quantitative PCR instrument, it can be clearly observed that over time, the intensity of the fluorescent signal representing the amplification of the target fungal nucleic acid is gradually increasing. Although there are certain differences in the fluorescence signal intensity corresponding to fungal samples of different genera, they are all in a clearly readable state. Based on these experimental results, the reagents and methods of the present invention are expected to become a universal and efficient fungal screening method.

[0105] In addition, common fungi in the brewing process (Saccharomyces cerevisiae, Pichia pastoris, Saccharomyces boulardii, Baumannii, Kazakhstan yeast, Aspergillus niger) and common bacteria (Lactic acid bacteria, Bacillus, Escherichia coli), and viruses (HPV, NoV) were used as test samples for specificity testing. Amplification was performed according to the fluorescent RPA reaction system, and fungi were used as positive controls to verify the specificity of the universal primer combination for fungi. The peak time and peak value of the fluorescence quantitative PCR instrument program were analyzed, such as Figure 7As shown in the figure, the primers only reacted positively with fungi, and no amplification reaction occurred with lactic acid bacteria, Bacillus, Escherichia coli, HPV, NoV and blank control, which proved that the universal primer combination for fungi had good specificity.

[0106] Example 4: Sensitivity test of RPA primers for brewing fungi in the present invention

[0107] (1) DNA preparation: Prepare DNA template (i.e., plasmid containing target) using plasmid extraction kit, and then use TE buffer to dilute the template DNA in 10-fold gradient to obtain a concentration of 10 0 , 10 1 , 10 2 , 10 3 , 10 4 , 10 5 , 10 6 , 10 7 , 10 8 , 10 9 , 10 10 Ten gradient samples were prepared, with the unit accurate to copies / μL. Next, 2 μL of sample at each dilution was accurately taken and injected into the fluorescent RPA amplification system to verify the sensitivity of the method; an empty plasmid vector served as a negative control (NC group).

[0108] (2) RPA reaction system and conditions

[0109] The RPA reaction system is the same as step (2) of Example 2 above.

[0110] RPA reaction conditions: Place the RPA reaction tube containing all components in a fluorescent quantitative PCR instrument and incubate at 37°C for 20 minutes, collecting fluorescence signals every 30 seconds. The instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0111] (3) The results are as follows Figure 8 As shown in the figure, when the template DNA concentration changes from high to low, the fluorescence signal intensity changes regularly, and there is no amplification in the negative control. 6 , 10 8 , 10 10 When the concentration was 10 copies / μL, the fluorescence signal increased rapidly to a higher peak value. 2 , 10 0 When the concentration was 2.5477 / μL, the fluorescence signal was weakened but still identifiable, indicating that this method can efficiently capture nucleic acid amplification information in this concentration range with high sensitivity and a wide detection concentration range.

[0112] Further explore the experimental data and construct a linear relationship model between time and concentration. Fit the fluorescence intensity data of each gradient sample at different reaction times and draw a linear regression curve ( Figure 9 ), its linear regression equation is y=23.19048-2.02143x, R 2 =0.980 (where y is time, x is template concentration, and the correlation coefficient is R² = 0.980). In subsequent actual testing, the initial concentration of the template DNA can be quickly estimated based on the real-time fluorescence intensity and the corresponding time, achieving the transition from qualitative to quantitative analysis.

[0113] Example 5: Detection of different fermented grain samples using the primer set of the present invention

[0114] (1) Sample preprocessing:

[0115] Use a sterile sampling tool to collect mash samples from the fourth round. Immediately place the collected samples in sterile sealed bags and store them in a -20°C freezer. Weigh 20 g of each mash sample into a 100 mL centrifuge tube and suspend it in 35 mL of sterile 1× PBS buffer (136 mM NaCl, 2.6 mM KCl, 2 mM KH2PO4, and 8 mM Na2HPO4, pH 7.2) along with 3–5 glass beads. Vortex thoroughly for 7 minutes, centrifuge at 400 rpm for 5 minutes, and aspirate the supernatant.

[0116] The precipitate was washed with 1× PBS, vortexed for 4 min, centrifuged at 400 rpm for 5 min, and the supernatant was collected.

[0117] Repeat the previous step to collect a total of 40-50 mL of supernatant. After balancing, centrifuge at 12,000 r / min for 5 min, discard the supernatant, and store the precipitate in a -20°C refrigerator.

[0118] (2) DNA extraction from samples: DNA in the samples was extracted using the quartz sand-assisted phenol-chloroform method. The specific steps were the same as step (1) in Example 3.

[0119] (3) The RPA reaction system is the same as step (2) in Example 2.

[0120] RPA reaction conditions: Place the RPA reaction tube containing all components in a fluorescent quantitative PCR instrument and incubate at 37°C for 20 minutes, collecting fluorescence signals every 30 seconds. The instrument software analyzes the fluorescence signal intensities collected at different time points to construct an amplification curve, and the results are judged based on the curve.

[0121] (4) After the reaction is completed, an amplification curve is drawn based on the fluorescence signal data. And according to the standard curve equation y=23.19048-2.02143x (where y is time, x is template concentration, and correlation coefficient R is fitted in step (3) of Example 4), 2 =0.980) to calculate the fungal content in each mash sample. Comparison was also conducted with the gold standard q-PCR method for fungal detection. Specifically, q-PCR amplified the extracted mash DNA using universal primers for brewing fungi, 5'-CAAATTTCTGCCCTATCAACTT-3' (SEQ ID NO:9) and 5'-AACTGCAACAACTTTAATATAC -3' (SEQ ID NO:10). The reaction system consisted of 25 μL of SYBR Premix Ex Taq™ (TaKaRa), 0.8 μL of 10 μM forward / reverse primers, 2 μL of template DNA, and 11.4 μL of nuclease-free water. A real-time quantitative PCR system was used, with the following conditions: pre-denaturation at 95°C for 5 min, followed by denaturation for 10 s, annealing at 60°C, and extension for 50 s, for 40 cycles. The comparison results are shown in Table 2. It can be concluded that the fungal content calculated by the method of the present invention is consistent with that by the q-PCR method, and can more accurately reflect the actual content of fungi in the mash sample.

[0122] Table 2. Comparison of quantitative results of nucleic acid detection by q-PCR and q-RPA

[0123]

[0124] The above description is only a preferred embodiment of the present invention and is not intended to limit the present invention. Any modifications, equivalent substitutions, improvements, etc. made within the spirit and principles of the present invention should be included in the scope of protection of the present invention.

Claims

1. A primer-probe combination for detecting brewing fungi, characterized in that: The invention comprises a primer and a single-stranded fluorescent probe, wherein the nucleotide sequence of the primer is shown in SEQ ID NO: 1-2; the nucleotide sequence of the single-stranded fluorescent probe is: ATGGTTTCAACGGGTAACGGGGAATAAGGGT[FAM-dT][THF]GA[BHQ1-dT]TCCGGAGAGGGAGCC-C3spacer; the FAM-dT is a thymine nucleotide carrying a fluorescein group, the THF is tetrahydrofuran, and the BHQ1-dT is a thymine nucleotide carrying a fluorescence quenching group BHQ1; The primer-probe combination is designed based on the conserved region of the 18S rDNA gene of fungi, and the nucleotide sequence of the conserved region is shown in SEQ ID NO:

8.

2. A kit for detecting brewing fungi, characterized in that: The method comprises the primer-probe combination according to claim 1.

3. The kit according to claim 2, wherein: The final concentration of the primer is 0.001 μM to 30 μM; the final concentration of the single-stranded fluorescent probe is 0.001 μM to 20 μM.

4. A method for detecting brewing fungi for purposes other than disease diagnosis, characterized in that: The primer-probe combination according to claim 1 is used to perform RPA detection on the sample to be tested.

5. The method for detecting brewing fungi for non-disease diagnosis purposes according to claim 4, characterized in that: The method for detecting fungi comprises the following steps: S1: Extract DNA from the test substance containing fungi to obtain a DNA template; S2: Using the extracted DNA as a template, perform RPA amplification using a primer-probe combination, interpret the RPA amplification results, and identify the fungi in the sample to be tested.

Images