CAR-NK cell for treating non-small cell lung cancer and / or esophageal squamous carcinoma as well as application and composition of CAR-NK cell

Abstract

The invention provides a CAR (Chimeric Antigen Receptor)-NK (Natural Killer) cell for treating non-small cell lung cancer and / or esophageal squamous carcinoma. The CAR-NK cell is prepared by constructing a pMFG-EGFR-CAR-CXCR3 or a pMFG-EGFR-CAR-CIL15 plasmid vector, preparing an anti-EGFR CAR-CXCR3 or an anti-EGFR CAR-CIL15 retroviral vector, and preparing an anti-EGFR CAR-CXCR3-NK cell or an anti-EGFR CAR-CIL15-NK cell. The chemotactic anti-EGFR CAR-CXCR3-NK has the advantages that the chemotactic anti-EGFR CAR-CXCR3-NK has high killing activity on A549 and KYSE150 cells, the killing activity is obviously higher than that of NK cells, and the chemotactic ability and the killing activity of the EGFR-CAR-NK are improved after the EGFR-CAR-NK expresses a CXCR3 chemokine receptor.

Description

Technical Field

[0001] The present invention relates to the field of cell therapy, and particularly to CAR-NK cells for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma, and their applications and compositions. Background Art

[0002] In recent years, chimeric antigen receptor T (CAR-T) cells have achieved remarkable results in the treatment of hematological malignancies. However, in clinical applications, they still face the following dilemmas: prone to adverse reactions (cytokine storm, neurotoxicity, graft-versus-host disease), poor treatment effect on solid tumors, antigen escape, limited tumor infiltration, etc. Compared with CAR-T cells, due to their higher activation threshold and limited proliferation ability, CAR-NK cells release less cytokines when recognizing and attacking tumor cells, thus significantly reducing the incidence and severity of cytokine release syndrome (CRS). At the same time, due to their limited proliferation ability and low cytokine production, they are not likely to cause extensive infiltration of immune cells and neuroinflammation, so the risk of neurotoxicity is greatly reduced. Since NK cells do not express TCR, they will not cause TCR-mediated rejection reactions. Therefore, the advantage of CAR-NK therapy is that allogeneic CAR-NK cells will not cause graft-versus-host disease (GVHD) and hardly cause serious adverse reactions, and its safety is higher. As a member of the innate immune system, NK cells do not rely on MHC to present antigens, but directly bind to target cells to exert their killing function. After genetically engineering the expression of CAR on NK cells, the killing targeting of NK cells can be enhanced to achieve the effect of treating tumors. CAR-NK cells can recognize and kill tumors through multiple recognition mechanisms, and have a broad anti-tumor spectrum. Therefore, CAR-NK cells have broad application prospects in anti-tumor treatment and have become a hot spot in the research and development field of cellular immunotherapy.

[0003] However, the insufficient infiltration of CAR-NK cells into solid tumors remains a huge challenge for their clinical application. Solid tumors have mechanisms to interfere with the transport of immune cells for immune escape. On the one hand, different from the dispersed state of hematological tumor cells, solid tumors often form solid masses, plus abundant cancer-associated fibroblasts (CAFs) and blood vessels, forming a natural physical barrier. On the other hand, some solid tumors will inhibit the secretion of certain chemokines. The chemokine network plays an important role in the migration of lymphocytes, and it is crucial to drive the intratumoral infiltration of NK cells through the interaction between soluble chemokines and their receptors. Among the chemokine receptors worthy of attention in the transport of NK cells are CCR2, CCR5, CCR7, CXCR3, and CX3CR1.

[0004] The epidermal growth factor receptor (EGFR), also known as human epidermal receptor 1 (Her-1), is a transmembrane glycoprotein that is ubiquitously expressed in human epidermal cells and stromal cells. It plays an important role in cell growth, differentiation, and survival. The abnormal activation or overexpression of EGFR is closely related to the occurrence and progression of various tumors. At the same time, EGFR is related to the proliferation, angiogenesis, tumor invasion, metastasis, and inhibition of apoptosis of tumor cells. Studies have shown that high expression or abnormal expression of EGFR exists in many solid tumors, making EGFR a promising therapeutic target. Summary of the Invention

[0005] To solve the above problems, the present invention provides a CAR-NK cell for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma, and the CAR-NK cell is prepared by the following method:

[0006] Step 1, constructing a pMFG-EGFR-CAR-CXCR3 or pMFG-EGFR-CAR-IL15 plasmid vector: Design a CAR vector sequence targeting the epidermal growth factor receptor EGFR, and this sequence is sequentially connected with a signal peptide region, an antigen-binding domain targeting EGFR, a CD8 hinge region, a transmembrane domain, a 4-1BB intracellular co-stimulatory factor domain, an intracellular signal transduction molecule CD3ζ signal transduction domain, and a CXCR3 gene fragment or an IL15 cytokine connected by a P2A self-cleaving peptide from the amino terminus to the carboxyl terminus. Insert the above gene fragments between the xhoI and NotI restriction enzyme sites of the retroviral vector pMFG plasmid to obtain a pMFG-EGFR-CAR-CXCR3 or pMFG-EGFR-CAR-IL15 plasmid vector;

[0007] Step 2, preparing an anti-EGFR CAR-CXCR3 or anti-EGFR CAR-IL15 retroviral vector: Transfect the pMFG-EGFR-CAR-CXCR3 or pMFG-EGFR-CAR-IL15 plasmid vector into Phoenix-Ampho cells respectively and collect the cell supernatant to harvest an amphotropic retroviral vector. Mix it with BaEV-WT cells to obtain a stable BaEV retroviral vector packaging cell line; Collect the culture supernatant of the BaEV-WT retroviral vector stable transfection cell line, which is the final anti-EGFR CAR-CXCR3 or anti-EGFR CAR-IL15 retroviral vector;

[0008] Step 3, Preparation of anti-EGFR-CAR-CXCR3-NK or anti-EGFR-CAR-IL15-NK cells: NK cells are transduced with anti-EGFR CAR-CXCR3 and anti-EGFR CAR-IL15 retroviral vectors to prepare anti-EGFR-CAR-CXCR3-NK or anti-EGFR-CAR-IL15-NK cells.

[0009] In one embodiment, the EGFR-VH sequence of the EGFR scFv of the antigen-binding domain targeting EGFR is SEQ ID NO: 1: ATGGCCCAGGTGCAGCTGGTGCAGTCAGGCGCCGAGGTGAAGAAGCCAGGCTCCAGCGTGAAGGTGAGTTGTAAAGCCTCCGGCGGCACATTCTCTAGTTATGCCATCAGCTGGGTGAGGCAGGCCCCCGGCCAGGGACTGGAATGGATGGGCGGAATTATCCCTATTTTCGGAACTGCCAACTACGCTCAGAAATTTCAGGGCAGAGTGACAATTACCGCCGACGAGAGCACCTCCACAGCCTACATGGAGCTGTCCAGTCTGCGGAGCGAGGACACAGCCGTGTACTACTGCGCTCGGACCCGGCTGAAGCACCAGTGGGGCCAGGGCACCCTGGTGACAGTGAGTTCA; the EGFR-VL sequence of the EGFR scFv of the antigen-binding domain targeting EGFR is SEQ ID NO: 2: GCCCTGTCCTCTGAACTGACACAGGATCCCGCCGTGAGCGTGGCCCTGGGCCAGACCGTGAGAATCACATGCCAGGGAGACAGCCTGCGCAGTTATTATGCTAGTTGGTATCAGCAGAAACCCGGCCAGGCTCCCGTGCTGGTGATCTACGGAAAGAACAACAGACCATCCGGGATTCCAGACAGGTTCAGCGGCTCATCCTCCGGCAATACCGCTTCTCTGACCATCACAGGAGCCCAGGCCGAGGACGAAGCTGATTATTATTGCAACTCTAGAGATTCTAGCGGCCCTGTGTTCGGCGGCGGAACTAAGCTGACAGTGCTGGGAGCTGCTGCT.

[0010]

[0011] In one embodiment, a chimeric antigen receptor targeting EGFR is provided, which comprises, sequentially connected from the amino terminus to the carboxyl terminus, a signal peptide region, an antigen-binding domain targeting EGFR, a CD8 hinge region, a transmembrane domain, a 4-1BB intracellular co-stimulatory factor domain, an intracellular signal transduction molecule CD3ζ signal transduction domain, and a CXCR3 gene fragment or an IL15 cytokine linked by a P2A self-cleaving peptide.

[0012] In one embodiment, an isolated nucleic acid is provided, and the isolated nucleic acid comprises a nucleotide sequence for expressing the above-mentioned chimeric antigen receptor targeting EGFR.

[0013] In one embodiment, a recombinant vector is provided, and the recombinant vector comprises the isolated nucleic acid as described above.

[0014] In one embodiment, an application of the above-mentioned CAR-NK cells in the preparation of a drug is provided, and the drug is used for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma.

[0015] In one embodiment, an application of the above-mentioned chimeric antigen receptor targeting EGFR in the preparation of a drug is provided, and the drug is used for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma.

[0016] In one embodiment, an application of the above-mentioned isolated nucleic acid in the preparation of a drug is provided, and the drug is used for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma.

[0017] In one embodiment, an application of the above-mentioned recombinant vector in the preparation of a drug is provided, and the drug is used for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma.

[0018] In one embodiment, a pharmaceutical composition for treating non-small cell lung cancer and / or esophageal squamous cell carcinoma is provided, which comprises the above-mentioned CAR-NK cells, the above-mentioned chimeric antigen receptor targeting EGFR, the above-mentioned isolated nucleic acid, or the above-mentioned recombinant vector, and a pharmaceutically acceptable carrier, diluent or excipient.

[0019] In one embodiment, a method for inhibiting non-small cell lung cancer and / or esophageal squamous cell carcinoma cells in vitro is provided, which comprises contacting the non-small cell lung cancer and / or esophageal squamous cell carcinoma cells in vitro with the above-mentioned CAR-NK cells or the above-mentioned pharmaceutical composition, thereby inhibiting the non-small cell lung cancer and / or esophageal squamous cell carcinoma cells.

[0020] In the present invention, when non-small cell lung cancer cell line A549 and esophageal squamous cell carcinoma KYSE150 are used as target cells, the killing efficiency of anti-EGFR CAR-CXCR3-NK cells and anti-EGFR CAR-IL15-NK cells against specific target cell A549 is significantly higher than that of unmodified NK cells; Chemotactic anti-EGFR CAR-CXCR3-NK has strong killing activity against A549 and KYSE150 cells, and is significantly higher than NK cells, demonstrating that after EGFR-CAR-NK expresses the CXCR3 chemokine receptor, its chemotactic ability and killing activity are enhanced. After anti-EGFR-CAR-CXCR3-NK cells are co-incubated with A549 and KYSE150 cells for 24 hours respectively, the expression levels of pro-inflammatory cytokine IFN-γ and granzyme Granzyme are significantly higher than those of NK cells, indicating that anti-EGFR-CAR-CXCR3-NK cells have enhanced anti-tumor function against specific target cells. After anti-EGFR-CAR-CXCR3-NK cells are stimulated by specific target cells A549 and KYSE150 for 4 hours, the expression level of CD107α is significantly higher than that of NK cells, and the degranulation activity is enhanced. It is proved that anti-EGFR-CAR-CXCR3-NK cells enhance their activation level under specific stimulation. Brief Description of the Drawings

[0021] In order to more clearly illustrate the technical solutions in the embodiments of the present application, the following will briefly introduce the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments recorded in the present application. For those of ordinary skill in the art, without creative efforts, other drawings can also be obtained based on these drawings.

[0022] Figure 1 It is a schematic structural diagram of the retroviral vector in the present invention;

[0023] Figure 2 It is a result diagram of flow cytometry for detecting the transduction positive rate of BaEV retroviral vector packaging cell line;

[0024] Figure 3 It is a result diagram of the transduction positive rate of CAR-NK;

[0025] Figure 4 It is a result diagram of the purity of CAR-NK;

[0026] Figure 5 It is a result diagram of flow cytometry for detecting the expression of CXCR3 in CAR-NK;

[0027] Figure 6It is the result graph of the in vitro killing detection of A549 by NK, anti-EGFR CAR-CXCR3-NK and anti-EGFR CAR-IL15-NK cells;

[0028] Figure 7 It is the result graph of the influence of A549 cells, chemokines CXCL9 and CXCL10 on the chemotactic ability of CAR-NK detected by flow cytometry;

[0029] Figure 8 It is the result graph of the influence of KYSE150 cells, chemokines CXCL9 and CXCL10 on the chemotactic ability of CAR-NK detected by flow cytometry;

[0030] Figure 9 It is the result graph of the killing activity of NK and CAR-NK cells after chemotaxis against A549 cells detected by flow cytometry;

[0031] Figure 10 It is the result graph of the killing activity of NK and CAR-NK cells after chemotaxis against KYSE150 cells detected by flow cytometry;

[0032] Figure 11 It is the result graph of the expression levels of IFN-γ and Granzyme after co-incubation of NK and CAR-NK cells with A549 cells detected by CBA;

[0033] Figure 12 It is the result graph of the expression levels of IFN-γ and Granzyme after co-incubation of NK and CAR-NK cells with KYSE150 cells detected by CBA;

[0034] Figure 13 It is the result graph of the relative expression level of CD107α after co-incubation of NK and CAR-NK cells with A549 cells detected by flow cytometry;

[0035] Figure 14 It is the result graph of the relative expression level of CD107α after co-incubation of NK and CAR-NK cells with KYSE150 cells detected by flow cytometry. Detailed implementation mode

[0036] In order to enable those skilled in the art to better understand the technical solutions in this application, the present invention will be further described below in conjunction with embodiments. Obviously, the described embodiments are only a part of the embodiments of this application, rather than all of the embodiments. Based on the embodiments in this application, all other embodiments obtained by those of ordinary skill in the art without creative efforts shall fall within the protection scope of this application.

[0037] Example 1: Construction of CAR expression plasmid

[0038] The sequence of the CAR vector (anti-EGFR-CAR) targeting epidermal growth factor receptor EGFR designed by the present invention includes the EGFR scFv sequence, the CD8 hinge (Hinge) region and transmembrane segment, the 4-1BB intracellular co-stimulatory factor domain and the intracellular signal transduction molecule CD3ζ, and the CXCR3 gene fragment or IL15 cytokine linked by the P2A self-cleaving peptide. The schematic diagram of the gene element structure is shown in Figure 1 。

[0039] The EGFR scFv sequence, CXCR3 sequence and IL15 sequence were synthesized by gene synthesis. The above gene fragments were inserted between the XhoI and NotI restriction enzyme cleavage sites of the retroviral vector pMFG plasmid to construct the pMFG-EGFR-CAR-CXCR3 and pMFG-EGFR-CAR-IL15 vectors, and the sequences were verified to be correct by sequencing.

[0040] EGFR scFv sequence:

[0041] EGFR-VH (SEQ ID NO:1):

[0042] ATGGCCCAGGTGCAGCTGGTGCAGTCAGGCGCCGAGGTGAAGAAGCCAGGCTCCAGCGTGAAGGTGAGTTGTAAAGCCTCCGGCGGCACATTCTCTAGTTATGCCATCAGCTGGGTGAGGCAGGCCCCCGGCCAGGGACTGGAATGGATGGGCGGAATTATCCCTATTTTCGGAACTGCCAACTACGCTCAGAAATTTCAGGGCAGAGTGACAATTACCGCCGACGAGAGCACCTCCACAGCCTACATGGAGCTGTCCAGTCTGCGGAGCGAGGACACAGCCGTGTACTACTGCGCTCGGACCCGGCTGAAGCACCAGTGGGGCCAGGGCACCCTGGTGACAGTGAGTTCA

[0043] EGFR-VL (SEQ ID NO:2):

[0044] GCCCTGTCCTCTGAACTGACACAGGATCCCGCCGTGAGCGTGGCCCTGGGCCAGACCGTGAGAATCACATGCCAGGGAGACAGCCTGCGCAGTTATTATGCTAGTTGGTATCAGCAGAAACCCGGCCAGGCTCCCGTGCTGGTGATCTACGGAAAGAACAACAGACCATCCGGGATTCCAGACAGGTTCAGCGGCTCATCCTCCGGCAATACCGCTTCTCTGACCATCACAGGAGCCCAGGCCGAGGACGAAGCTGATTATTATTGCAACTCTAGAGATTCTAGCGGCCCTGTGTTCGGCGGCGGAACTAAGCTGACAGTGCTGGGAGCTGCTGCT

[0045] CXCR3 sequence (SEQ ID NO:3):

[0046]

[0047] IL15 sequence (SEQ ID NO: 4):

[0048] AACTGGGTGAATGTAATAAGTGATTTGAAAAAAATTGAAGACCTTATTCAATCTATGCATATTGATGCTACTTTATATACGGAAAGTGATGTTCACCCCAGTTGCAAAGTAACAGCAATGAAGTGCTTTCTCTTGGAGTTACAAGTTATTTCACTTGAGTCCGGAGATGCAAGTATTCATGATACAGTAGAAAATCTGATCATCCTAGCAAACAACAGTTTGTCTTCTAATGGGAATGTAACAGAATCTGGATGCAAAGAATGTGAGGAACTGGAGGAAAAAAATATTAAAGAATTTTTGCAGAGTTTTGTACATATTGTCCAAATGTTCATCAACACTTCT

[0049] The amino acid sequences of the CD8 hinge region, transmembrane segment, 4-1BB intracellular co-stimulatory factor domain, intracellular signal transduction molecule CD3ζ, and the P2A self-cleaving peptide are sequences commonly used in the art. For example, as described in CN 118290596A, which will not be elaborated herein.

[0050] Example 2: Preparation of retroviral vectors

[0051] The "two-step method" was adopted to construct the BaEV-EGFR-CAR-CXCR3 and BaEV-EGFR-CAR-IL15 virus-producing cell lines. The Phoenix-Ampho and BaEV-WT retroviral vector packaging cell lines were used successively. The pMFG-EGFR-CAR-CXCR3 and pMFG-EGFR-CAR-IL15 plasmids were transfected into Phoenix-Ampho cells respectively, and the cell supernatants were collected to harvest amphotropic retroviral vectors. These were mixed with BaEV-WT cells, and the retroviral vectors were promoted to transduce BaEV cells by horizontal centrifugation to obtain stable BaEV retroviral vector packaging cell lines. Flow cytometry detected that the positive rate of BaEV-EGFR CAR-IL15 was 66.8%, and the positive rate of BaEV-EGFR CAR-IL15 was 76.6% ( Figure 2 ). The culture supernatant of the BaEV-WT retroviral vector stably transfected cell line was collected, which was the final anti-EGFR CAR-CXCR3 and anti-EGFR CAR-IL15 retroviral vectors.

[0052] Example 3: Preparation of Retrovirus and Detection of Biological Titer

[0053] Expand BaEV-EGFR-CAR-CXCR3 cells and BaEV-EGFR-CAR-IL15 cells to T75 culture flasks and place them in an incubator at 32 °C for virus production. Collect the cell culture supernatants at 24 h, 48 h, 72 h, and 96 h respectively. Filter the cell culture supernatants using a 0.45 μm filter membrane and label them as H1-H4.

[0054] Seed 293T cells in a 24-well plate, with 2×10 5 cells per well. After 24 h, discard the cell culture medium, add 500 μL of the virus liquid to be tested, and then add 1 μg / mL of polybrene. Centrifuge at 2500 rpm at 32 °C for 1 h. Place it in an incubator at 37 °C for continued culture. After 24 h of virus transduction, replace with fresh medium. After 48 h, detect the positive rate of G4S by flow cytometry to calculate the transduction efficiency. The positive rates of anti-EGFR CAR-CXCR3 retrovirus infecting 293T cells detected by flow cytometry are H1 (7.17%), H2 (13.1%), H3 (10.9%), and H4 (12.1%) respectively; the positive rates of anti-EGFR CAR-IL15 retrovirus infecting 293T cells detected by flow cytometry are H1 (6.37%), H2 (11.2%), H3 (11.9%), and H4 (12.1%) respectively. The calculation method of virus titer: Virus titer (TU / mL) = number of infected cells × percentage of positive cells / volume of virus stock solution. The titers of the anti-EGFR CAR-CXCR3 retroviral vector are shown in Table 1, and the titers of the anti-EGFR CAR-IL15 retroviral vector are shown in Table 2.

[0055] Table 1

[0056]

[0057] Table 2

[0058]

[0059] Example 4: Transduction of NK Cells with Retrovirus

[0060] 1. Sorting and Purification of NK Cells

[0061] Purify NK cells from human peripheral blood mononuclear cells (PBMC) by magnetic bead sorting method and perform activation and amplification culture. Transduce NK cells with anti-EGFR CAR-CXCR3 and anti-EGFR CAR-IL15 retroviral vectors to prepare anti EGFR-CAR-CXCR3-NK and anti EGFR-CAR-IL15-NK cells.

[0062] 2. Transduce NK cells

[0063] Add RetroNectin (10 μg / mL) to a 12-well plate (without tissue treatment), 1 mL per well. Incubate overnight at 4°C in the dark. The next day, remove the RetroNectin solution and rinse with PBS. Dilute the viral vector with medium 1:2. In the coated 12-well plate, add 1 mL of the above anti-EGFR CAR-CXCR3 and anti-EGFR CAR-IL15 retroviral vectors respectively, place in a centrifuge at 32°C, centrifuge at 2500 rpm for 1 h, and remove the viral supernatant in the well plate. Take 4×10 5 activated NK cells, resuspend with 1 mL of anti-EGFR-CAR-CXCR3 and anti-EGFR-CAR-IL15 retroviral vectors, add the cell suspension to the corresponding wells, and add polybrene (final concentration 6 μg / mL). Centrifuge the 12-well plate at 32°C at 2500 rpm for 1 h, then incubate in a 37°C incubator for 2 h. Discard the supernatant in the well plate, add the corresponding retroviral vector (containing polybrene), place in a centrifuge at 32°C, centrifuge at 2500 rpm for 1 h. After completion, place the cells in a 37°C incubator and incubate for 2 h. Discard the supernatant in the well plate, add 1 mL of fresh complete medium for NK cells to resuspend the cells, and continue the culture.

[0064] 3. Detection of transduction positive rate

[0065] After 48 h of transduction, take 2×10 5 transduced NK cells, add anti-G4S, anti-CD3, and anti-CD56 antibodies, incubate at 4°C for 30 min, and then detect the transduction efficiency of NK cells by flow cytometry. The transduction efficiencies of anti-EGFR-CAR-CXCR3 and anti-EGFR-CAR-IL15 are 50.5% and 49.9% respectively, as Figure 3 shown, and the purities of anti-EGFR-CAR-CXCR3 and anti-EGFR-CAR-IL15 are 94% and 93.9% respectively, as Figure 4 shown.

[0066] 4. Expression of CXCR3 in CAR-NK cells

[0067] Take 2×10 5 transduced NK cells, add anti-CXCR3 antibody and incubate at 4°C for 30 min, then detect the expression of CXCR3 in NK, anti-EGFR-CAR-CXCR3-NK and anti-EGFR-CAR-IL15-NK cells by flow cytometry respectively.

[0068] The results are as Figure 5 shown. The expression rate of chemokine receptor CXCR3 on anti-EGFR-CAR-CXCR3-NK cells is significantly higher than that on NK and anti-EGFR-CAR-IL15-NK cells. This indicates that the anti-EGFR CAR-CXCR3 retrovirus has successfully transduced NK cells and is highly expressed.

[0069] Example 5: Anti-tumor function of CAR-NK cells in vitro

[0070] Use NK, anti-EGFR-CAR-CXCR3-NK, and anti-EGFR-CAR-IL15-NK cells as effector cells, and use the non-small cell lung cancer cell line A549 as the target cell. Take 2×10 4 target cells per well and seed them into a 96-well plate. According to the effector-to-target ratios of 2:1, 1:1, 1:2, 1:4, and 1:8, add effector cells and target cells and co-incubate. After 24 h, collect all cells into a 1.5 ml centrifuge tube, centrifuge at 400 g for 5 min, and discard the supernatant. Add 100 μl of Binding Buffer to wash the cells, centrifuge at 400 g for 5 min, and discard the supernatant. Resuspend the cells again with 100 μl of Binding Buffer, add CD56 antibody to label NK and CAR-NK cells, and at the same time add 2.5 μl of AnnexinV and 2.5 μl of PI, and stain at room temperature for 30 min. Detect the apoptosis level of target cells by flow cytometry to reflect the killing activity of CAR-NK.

[0071] The results show that the killing efficiencies of anti-EGFR CAR-CXCR3-NK cells and anti-EGFR CAR-IL15-NK cells against the specific target cell A549 are both significantly higher than those of unmodified NK cells( Figure 6 and Table 3), and the killing trends are the same. The killing efficiency is high when the effector cells and target cells are between 2:1 and 1:2. It is proved that the expression of chemokine receptor CXCR3 and cytokine IL15 does not affect the anti-tumor activity of CAR-NK cells.

[0072] Table 3

[0073]

[0074] Example 6: Detection of chemotactic ability of anti-EGFR CAR-CXCR3-NK

[0075] The chemotactic ability of NK cells was detected by transwell assay. Before the experiment, 200 μl of serum-free medium was added to the upper chamber and placed in an incubator at 37 °C for 30 min to moisten the ECM membrane of the chamber. Anti-EGFR CAR-CXCR3-NK cells were pre-incubated with CXCR3 antibody for 30 min as the anti-EGFR CAR-CXCR3-NK-anti-CXCR3 group. 2×10 5 target cells (A549 or KYSE150) were added to each well of the lower chamber, and chemokines CXCL9 and CXCL10 (final concentration 100 ng / ml) were added. Effector cells NK, anti-EGFR CAR-CXCR3-NK, anti-EGFR CAR-IL15-NK, anti-EGFR CAR-CXCR3-NK-anti-CXCR3 cells were added to the upper chamber at an effector-to-target ratio of 2:1. At the same time, a group without target cells and chemokines was set up to detect the number of spontaneously dropped cells of NK, anti-EGFR CAR-CXCR3-NK, anti-EGFR CAR-IL15-NK, anti-EGFR CAR-CXCR3-NK-anti-CXCR3 cells. After incubation in an incubator at 37 °C for 6 hours, all cell suspensions in the lower chamber were collected into 1.5 ml centrifuge tubes, centrifuged at 400 g for 5 min, and the supernatant was discarded. The cells were washed with 100 μl of PBS, centrifuged at 400 g for 5 min, and the supernatant was discarded. The cells were resuspended again with 100 μl of PBS, and CD56 antibody was added to label NK and CAR-NK cells, and stained at room temperature for 30 min. The number of migrated cells was analyzed and quantified by flow cytometry. Chemotactic cell number = total number of chemotactic cells - number of spontaneously dropped cells.

[0076] The results are shown in Table 4, Figure 7 and Table 5, Figure 8 showing that under the induction of target cells and CXCL9 and CXCL10 chemokines, compared with NK cells, the chemotactic cell number of anti-EGFR CAR-CXCR3-NK cells was significantly increased, and after anti-CXCR3 treatment, the chemotactic cell number of anti-EGFR CAR-CXCR3-NK cells decreased to the level of the control group (NK cells), demonstrating that after EGFR-CAR-NK expressed the CXCR3 chemokine receptor, its chemotactic ability was enhanced.

[0077] Table 4

[0078]

[0079] Table 5

[0080]

[0081] Example 7: Detection of killing activity after anti-EGFR CAR-CXCR3-NK chemotaxis

[0082] The chemotactic ability of NK cells was detected by transwell assay. Before the experiment, 200 μl of serum-free medium was added to the upper chamber and placed in an incubator at 37 °C for 30 min to moisten the ECM membrane of the chamber. The anti-EGFR CAR-CXCR3-NK cells were incubated with CXCR3 antibody for 30 min in advance as the anti-EGFR CAR-CXCR3-NK-anti-CXCR3 group. 2×10 5 target cells (A549 or KYSE150, using non-small cell lung cancer cell line A549 and esophageal squamous cell carcinoma KYSE150 as target cells) were added to the lower chamber respectively, and chemokines CXCL9 and CXCL10 (final concentration 100 ng / ml) were added. Effector cells NK, anti-EGFR CAR-CXCR3-NK, anti-EGFR CAR-IL15-NK, anti-EGFRCAR-CXCR3-NK-anti-CXCR3 cells were added to the upper chamber at an effector-to-target ratio of 2:1. After incubation in an incubator at 37 °C for 6 hours, all cell suspensions in the lower chamber were collected into 1.5 ml centrifuge tubes, centrifuged at 400 g for 5 min, and the supernatant was discarded. 100 μl of Binding Buffer was added to wash the cells, centrifuged at 400 g for 5 min, and the supernatant was discarded. The cells were resuspended again with 100 μl of Binding Buffer, and CD56 antibody was added to label NK, anti-EGFR CAR-CXCR3-NK, anti-EGFR CAR-IL15-NK, anti-EGFR CAR-CXCR3-NK-anti-CXCR3 cells. At the same time, 2.5 μl of AnnexinV and 2.5 μl of PI were added and stained at room temperature for 30 min. The apoptosis level of target cells was analyzed by flow cytometry.

[0083] The results are shown in Table 6, Figure 9 and Table 7, Figure 10As shown, the chemotactic anti-EGFR CAR-CXCR3-NK has enhanced killing activity against A549 and KYSE150 cells, and is significantly higher than that of NK cells. There is no significant difference in the killing activity of the anti-EGFR CAR-CXCR3-NK-anti-CXCR3 group against A549 and KYSE150 cells compared with NK cells. It is proved that after the EGFR-CAR-NK expresses the CXCR3 chemokine receptor, its chemotactic ability and killing activity are enhanced.

[0084] Table 6

[0085]

[0086] Table 7

[0087]

[0088] Example 8: Detection of cytokine secretion of CAR-NK cells

[0089] Using NK, anti-EGFR-CAR-CXCR3-NK, and anti-EGFR-CAR-IL15-NK cells as effector cells, and non-small cell lung cancer cell line A549 and esophageal squamous cell carcinoma KYSE150 as target cells. Take 1×10 5 target cells per well and seed them into a 24-well plate. Add effector cells and target cells at an effector-to-target ratio of 2:1 and co-incubate. Take effector cells with the same cell number and culture them alone in a 24-well plate as the control group. After 24 h, collect all the cells into a 1.5 ml centrifuge tube, centrifuge at 400 g for 5 min, and collect the supernatant. Take 100 μl of supernatant from each well, dilute it 3 times with serum-free medium, take 25 μl of the diluted solution, add 25 μl of detection buffer, add 25 μl of IFN-γ and Granzyme B capture microspheres, and incubate at room temperature with shaking in the dark at 500 rpm for 2 h. Centrifuge at 250 g for 5 min, discard the supernatant, add 200 μl of washing solution to each well, incubate for 1 min and then centrifuge and discard the supernatant. Add 25 μl of detection antibody, and incubate at room temperature with shaking in the dark at 500 rpm for 1 h. Add 25 μl of SA-PE, and incubate at room temperature with shaking in the dark at 500 rpm for 30 min. Centrifuge at 250 g for 5 min, discard the supernatant, add 200 μl of washing solution to each well, incubate for 1 min and then centrifuge and discard the supernatant. Add 150 μl to each well, resuspend the microspheres into a flow tube, and detect them on the machine.

[0090] The results are shown in Table 8 and Figure 11 and Table 9 and Figure 12As shown, after co-incubating anti-EGFR-CAR-CXCR3-NK cells with A549 and KYSE150 cells for 24 hours respectively, the expression levels of the pro-inflammatory cytokine IFN-γ and granzyme were significantly higher than those of NK cells, indicating that anti-EGFR-CAR-CXCR3-NK cells have anti-tumor functions against specific target cells.

[0091] Table 8

[0092]

[0093] Table 9

[0094]

[0095] Example 9: Detection of CD107α in CAR-NK cells

[0096] Using NK, anti-EGFR-CAR-CXCR3-NK, and anti-EGFR-CAR-IL15-NK cells as effector cells, and non-small cell lung cancer cell line A549 and esophageal squamous cell carcinoma KYSE150 as target cells. Take 1×10 5 target cells per well and seed them into a 24-well plate. Add effector cells and target cells at an effector-to-target ratio of 2:1 for co-incubation. Take the same number of effector cells and culture them alone in a 24-well plate as the control group. Add anti-CD107a antibody directly after inoculating the cells. After co-culturing for 1 hour, add Monensin Solution and incubate the cells for another 3 hours. After the co-culture ends, collect all the cells. Add CD56 antibody to label NK and CAR-NK cells, stain them at room temperature for 30 minutes, and then detect the expression of CD107α by flow cytometry.

[0097] The results are shown in Tables 10 - 11 and Figure 13-14 As shown, calculate the relative expression level of CD107α in effector cells of each group (co-culture group minus control group). After being stimulated by specific target cells A549 and KYSE150 for 4 hours, the expression level of CD107α in anti-EGFR-CAR-CXCR3-NK cells was significantly higher than that of NK cells, and the degranulation activity was enhanced. It is proved that anti-EGFR-CAR-CXCR3-NK cells enhanced their activation level under specific stimulation.

[0098] Table 10

[0099]

[0100] Table 11

[0101]

[0102] Those skilled in the art will also recognize, or be able to ascertain using no more than routine experimentation, many equivalents to the specific embodiments of the invention described herein. These equivalents are also encompassed by the appended claims.

Images